New Phytologist Supporting Information Figs S1–S7 and Table S1 Article title: The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus Authors: Yafei Wang, Wei Peng, Xu Zhou, Fei Huang, Lingyun Shao and Meizhong Luo Article acceptance date: 28 April 2014 The following Supporting Information is available for this article: Fig. S1 Western blot analysis of the expression of VirD5△13 in yeast cells Fig. S2 Evolutionary relationships of VirD5 homologs and the NLSs on their amino acid sequences. Fig. S3 Subcellular localization assay for the Os12g0562400 Fig. S4 Coprecipitation assay for VirD5, AtVIP1 and VirE2 by glutathione sepharose beads. Fig. S5 Coprecipitation assay for VirD5, AtVIP1 and VBF by glutathione sepharose beads. Fig. S6 Sequence analysis of virD operon and RT-PCR assays for VirD5, VirD2, and VirE2. Fig. S7 A model for the putative functions of VirD5. Table S1 List of oligonucleotides Fig. S1 Western blot analysis of the expression of VirD5△13 in yeast cells. The total proteins were extracted from yeast strain AH109 cells and analyzed by Western blotting using anti-Myc antibody. VirD5△13, the total protein from yeast strain AH109 cells transformed with BDVirD5△13; AH109, the total protein from yeast strain AH109 Fig. S2 Evolutionary relationships of VirD5 homologs and the NLSs on their amino acid sequences. (a) Evolutionary relationships of VirD5 homologs. The evolutionary history was inferred using the Neighbor-Joining method. The optimal tree with the sum of branch length = 1.49483880 is shown. The tree is drawn to scale, with branch lengths (next to the branches) in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site. Evolutionary analyses were conducted in MEGA5. (b)The NLSs on the VirD5 homologous protein sequences Fig. S3 Subcellular localization assay for the Os12g0562400. The YFP-tagged Os12g0562400 and CFP-tagged Ghd7 were coexpressed in the rice protoplast cells. Ghd7 was used as a nucleus localization marker. Fig. S4 Coprecipitation assay for VirD5, AtVIP1 and VirE2 by glutathione sepharose beads Glutathione sepharose beads were used for coprecipitation. Lane 1, GST-AtVIP1+VirE2-CBD; Lane 2, GST-AtVIP1+His-VirD5; Lane 3, GST-AtVIP1+VirE2-CBD+His-VirD5; Lane 4, GST+VirE2-CBD+His-VirD5. Input, samples processed without precipitation. Fig. S5 Coprecipitation assay for VirD5, AtVIP1 and VBF by glutathione sepharose beads. Glutathione sepharose beads were used for coprecipitation. Lane 1, GST-AtVIP1+VBF-CBD; Lane 2, GST-AtVIP1+His-VirD5; Lane 3, GST-AtVIP1+VBF-CBD+His-VirD5; Lane 4, GST+VBF-CBD+His-VirD5. Input, samples processed without precipitation. Fig. S6 Sequence analysis of virD operon and RT-PCR assays for VirD5, VirD2, and VirE2. (a) Schematic representation of virD operon from Agropine-type Ti plasmid pTiBo542. Positions of the primers used for RT-PCR, -10, -35 and RBS (ribosome binding site) regions are indicated. (b) RT-PCR testing of VirD2 and VirD5. Total RNA was isolated from 2ml of Agrobacterium strain EHA105 culture. After digestion with gDNA Eraser, the RNA samples were used to carry out reverse transcription (+RT). The RNA samples without reverse transcription (-RT) were used as controls to show that all of Ti plasmid DNA was digested out. The reverse transcription was performed using gene-specific primer (D5-R07) of VirD5. The PCR reactions were carried out on the cDNA using primers of VirD2 (D2-F and D2-R) or VirD5 (D5-F06 and D5-R06). (c) Testing of VirD5 and VirE2 gene expression by RT-PCR. +AS: induced with acetosyringone (AS), - AS: non-induced with acetosyringone (AS). Three independent RT-PCR experiments were performed and the results were consistent. Fig. S7 A model for the putative functions of VirD5 Table S1 List of oligonucleotides Gene name and Gene ID VirD5 Gene ID 6382152 Primer name Sequence Restriction site D5-F06 TGGTTTACTGCTTCTGGGTCA D5-R06 GCGATACACTTGCTGCTCACG D5-R07 TTTCCGTCTTACGCCGACTGATT D-F09 gtcgacATGACAGGAAAGTCGAAAGTT Sal1 D-R9 ccatggcGCGTTTAAACGCTTTGTCTTG Nco1 D-F17 ACGCgtcgacATGACAGGAAAGTCGAAAGTT Sal1 D-R17 CATGccatggcATCTGTCCGTTGACCAATGGG Nco1 D-F18 ACGCgtcgacTCCTCCGATTCTTTTGTGTAT Sal1 D-R18: CATGccatggcGCGTTTAAACGCTTTGTCTTG Nco1 D-F12 CGCggatccgtATGACAGGAAAGTCGAAAGTT BamH1 D-R08 CGCggatccTCAGCGTTTAAACGCTTTGTC-3' BamH1 D-R12 ggatccATCCGGCGGAACAAGGACAGG BamH1 D-R13 ggatccCGCACCGGTTTCGGTCGCGAG BamH1 D-R14 ggatccCGTCAAGCTTGTGTACGACGG BamH1 D-R15 ggatccTTCATAAGCAGTTCGCTCAGG BamH1 D-R16 ggatccGCCCAAGGGAACACCGTTGTA BamH1 D-R19 CGCggatccTGTATACTCGCCGGTAATCCC BamH1 D-R20 CGCggatccTAAATCTCGGAGCCAGGTCAC BamH1 D-F19 CGCggatccgtGAAGAGGACACCCCCTCAACC BamH1 D-F20 CGCggatccgtCGCTGGAGTAAGAGGGAACGC BamH1 D-F21 5CGCggatccgtGATAGATCAGACGTCCCTTTA BamH1 D-F22 CGCggatccgtTATGAGTCGGAGCATATTTTC BamH1 D-F10 ggatccATGACAGGAAAGTCGAAAGTT BamH1 D-R10 ggtaccGCGTTTAAACGCTTTGTCTTG Kpn1 D-F03 ggatccATGACAGGAAAGTCGAAAGTT BamH1 D-R03 gtcgacTCAGCGTTTAAACGCTTTGTC Sal1 D-F25 ccatggctATGACAGGAAAGTCGAAAGTT Nco1 D-R25 gcggccgccGCGTTTAAACGCTTTGTCTTG Not1 D-F26 ccatggtcATGACAGGAAAGTCGAAAGTT Nco1 D-R26 ggatcccGCGTTTAAACGCTTTGTCTTG BamH1 D-F27 CGGggtaccATGACAGGAAAGTCGAAAGTT Kpn1 D-R27 GCtctagaGCGTTTAAACGCTTTGTCTTG Xba1 VirD2 D2-F GAATGGGCAGCCGAGATGTTT Gene ID:6382149 D2-R CGGGCGAGAAGTATCGGAATT VirE2-F01 GCAGCGAGCACGGAAATCAAG VirE2-R01 TATCGGGCAGCAGCGAACCAG 14640-F1 actagtATGGATCCGTCTAGCAATGAGA Spe1 14640-R1 ggtaccAAAGCTGTTGACGCTTTGGCTA Kpn1 VirE2 14640-F2 CATGccatggctATGGATCCGTCTAGCAATG Nco1 Gene ID:6382154 14640-R2 CCGctcgagAAAGCTGTTGACGCTTTGG Xho1 14640-F3 CATGccatggtcATGGATCCGTCTAGCAATG Nco1 14640-R3 CGGggtaccgAAAGCTGTTGACGCTTTGGC Kpn1 14640-F4 CGGggtaccATGGATCCGTCTAGCAATGAG Kpn1 14640-R4 CATGccatggcAAAGCTGTTGACGCTTTGGC Nco1 V1-F01 ggatccATGGAAGGAGGAGGAAGAGGA BamH1 V1-R01 ggtaccGCCTCTCTTGGTGAAATCCAT Kpn1 V1-F02 CGCggatccATGGAAGGAGGAGGAAGAGGA BamH1 V1-R02 CCGctcgagTCAGCCTCTCTTGGTGAAATC Xho1 V1-F03 CCGgaattcATGGAAGGAGGAGGAAGAGG EcoR1 V1-R03 CGCggatcccTCAGCCTCTCTTGGTGAAAT BamH1 V1-F06 ccatggtcATGGAAGGAGGAGGAAGAGGA Nco1 VIP1 V1-R06 ggatcccGCCTCTCTTGGTGAAATCCAT BamH1 Gene ID: 840957 V1-NR CCGctcgagTTCGATATTAAACGACGCCG Xho1 V1-CF CGCggatccTCGATTTTAGCTTCTGTGAGT BamH1 V1-R05 CCGctcgagGCCTCTCTTGGTGAAATCCAT Xho1 V1-CF01 CATGccatggagTCGATTTTAGCTTCTGTGAGT Nco1 V1-F08 CGGggtaccATGGAAGGAGGAGGAAGAG Kpn1 V1-R08 CCGgaattcGCCTCTCTTGGTGAAATCC EcoR1 6250-F gaattcATGATGATGTTACCAGAAGCA EcoR1 6250-R gagctcTGTTTTAGGCCTCACTTCAAT Sac1 6250-F1 CGCggatccATGATGATGTTACCAGAAGCA BamH1 6250-R1 CGGggtaccTGTTTTAGGCCTCACTTCAAT Kpn1 VBF 6250-F2 ccatggtcATGATGATGTTACCAGAAGCA Nco1 Gene ID: 842078 6250-R2 ggatcccTGTTTTAGGCCTCACTTCAAT BamH1 6250-R3 CCGctcgagTTATGTTTTAGGCCTCACTTC Xho1 6250-F4 CATGccatggctATGATGATGTTACCAGAAGCA Nco1 6250-R4 CCGctcgagTGTTTTAGGCCTCACTTCAAT Xho1 IMPA-1 importin alpha-1 06720-F ggatccATGTCACTGAGACCCAACGCT BamH1 Gene ID: 819857 06720-R ggtaccGCTGAAGTTGAATCCTCCGGA Kpn1 IMPA-4 importin alpha-4 Gene ID: 837448 09270-F ggatccATGTCGCTGAGGCCGAGCAC BamH1 09270-R: ggtaccGGCAAATTTGAATCCACCAAC Kpn1 Primers for RDSA RDSA_1 TAGTTGAGTCTCACAAACGAACAC(N20)CATTCCAAAATCCATGGCTGATA RDSA_1fo TAGTTGAGTCTCACAAACGAACAC RDSA_1re TATCAGCCATGGATTTTGGAATG RDSA_2 AATGGATCCAAGCTTAAGC(N18)CGTTGAATTCCCATGGACA RDSA_2fo AATGGATCCAAGCTTAAGC RDSA_2re TGTCCATGGGAATTCAACG Primers for Y1H assay D5RE-S agctACCAGCGACCGCGCTCAGGC Hind3 D5RE-AS tcgaGCCTGAGCGCGGTCGCTGGT Xho1 D5REm-S agctACCAGCGAatGCGCTCAGGC Hind3 D5REm-AS tcgaGCCTGAGCGCatTCGCTGGT Xho1 pAbAi-S GTTCCTTATATGTAGCTTTCGACAT D5REm1-S agctACCAGCGAatatGCTCAGGC Hind3 D5REm1-AS tcgaGCCTGAGCatatTCGCTGGT Xho1 Primers for EMSA assay D5RE2-F ACCAGCGACCGCGCTCAGGC D5RE2-R GCCTGAGCGCGGTCGCTGGT mD5RE2-F ACCAGCGAatGCGCTCAGGC mDRE2-R GCCTGAGCGCATTCGCTGGT