Investigating the Catalytic Activity of P450
CYP1A1 and CYP1A2 Shuffled Clones
ALLURE PROGRAM 2011
Johanna Fluhrer
AUTHORS: JOHANNA FLUHRER AND TIM BORLACE
This report by Johanna Fluhrer Student # 42408307
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
ALLURE PROGRAM 2011 – J. FLUHRER 42408307
SUMMARY
INTRODUCTION
Cytochrome P450 are enormously versatile
enzymes that span across numerous hemecontaining monooxygenase families
(Bernhardt, 2006). In eukaryotic cells, they are
primarily involved in biosynthesis and
xenobiotic biotransformation (Bernhardt,
2006; Myasoedova, 2008). To date, over 5,000
P450 genes have been cloned and classified
(Bernhardt 2006). The catalytic power of P450
has become a hot topic in biotechnology
(Bernhardt 2006).
Cytochrome P450
In the University of Queensland ALLURE
program, biochemistry students studied a
previously generated library of shuffled P450
isoforms CYP1A1 and CYP1A2. Students
completed whole-cell assays to test the
bioactivity of the clones. Five clones were
assigned for characterisation and analysis. Our
intention was to determine the catalytic
activity and genomic integrity of the shuffled
clones. Our interest was in the capability of
the clones to display the following properties:
expression of P450 enzymes, catabolysis of
luciferin-CEE, production of indigo pigment
through indoxyl catalysis, participation in the
O-dealkylation of 7-benzyloxyresorufin
(BROD). Also of interest were genomic
features of the clones elucidated through
sequencing and bioinformatics analysis.
The presence of P450 in the five assigned
clones #1, #6, #122, #126 and #188 was
confirmed through expression profiling and
SDS-PAGE, and also through sequence
analysis. Minimal levels of indigo production
were detected from all clones. Clones #1 and
#6 were able to catalyse 20µM Luciferin-CEE
to ~1.75µM luciferin in a luminescent assay.
The substrate BROD was unable to be
converted by any of the clones.
Successful P450 expression in the clones
indicates the maintenance of some structural
integrity despite the genomic shuffling. Some
function of the parental clones 1A1 and 1A2
was maintained in clones #1 and #6. Further
investigation into the catalytic potential of
these clones may elucidate other features of
their promiscuity.
Cytochrome P450s are a taxonomically
ubiquitous enzyme that possess broad
substrate specificity (Myasoedova, 2008). They
are a super family of monoxygenase haemproteins and are usually membrane-bound
(Myasoedova 2008). The name ‘Cytochrome’
is indicative of their hemoprotein properties,
and ‘P450’ is derived from their spectral
properties: the CO-bound complex has a
maximum absorbtion peak at 450nm
(Bernhardt 2006) Generally, monoxygenases
incorporate a single oxygen atom into a
substrate, simultaneously reducing a second
oxygen atom to water (Bernhardt 2006).
P450 isoform CYP1A1 and its relation
CYP1A2 are members of the enzyme superfamily and share 74% DNA-sequence
similarity. Interestingly, their function and
expression profile differ significantly (Stiborov
et al. 2001). Both proteins are known to break
down carcinogenic intermediates of polycyclic
aromatic hydrocarbons, which are compounds
in cigarette smoke (Stiborov· et al. 2001). A
related family member, isoform CYP1A2
furthermore accepts caffeine, fluorescent
resorufins, aflatoxin B1, heterocyclic aromatic
amines and acetaminophen substrates
(Myasoedova 2008).
The diverse catabolyic activity of P450
enzymes is continuosly being researched. The
primary feature of P450 is their capacity for
xenobiotic metabolism, i.e., they can
catabolyse substrates that are foreign to the
organism. These include toxins, drugs and
pollutants. Table 1 shows lists of the types of
reactions that P450 cytochromes catalyse, and
a list of acceptable substrates.
The far stretching range of synthetic reactions
catalysed by P450 opens up their potential use
in biotechnology (Bernhardt 2006). Despite
the extensive potential P450 enzymes exhibit,
their low catalytic activity, instability and
complexity have arisen as barriers to their
biotechnological efficacy (Bernhardt 2006).
There is emerging potential for P450 enzymes
to be applied in whole-cell biocatalysis,
specifically in the technique of engineering
directed evolution (Bernhardt 2006; Johnston
et al. 2007).
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
2
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
ALLURE PROGRAM 2011 – J. FLUHRER 42408307
can be used to digest the genomic content
non-randomly, and PCR reactions can be used
to piece together a novel gene from these
fragments. This gene will consist of a random
arrangement of genomic material and can be
cloned into a vector, such as Escherida Coli.
The idea is that the native genomic structure
of the parent isoform is not maintained, and
the reshuffling of its gene fragments creates a
novel, mutant clone. A hybrid library of
mutants can be screened to test for structural
integrity and functional activity of the
recombinant clone (Johnston et al. 2007).
Should novel activity be detected in the
shuffled clones, the assay can then be used as
a springboard in investigating and establishing
directed evolution of the enzyme.
The ALLURE objective
Catalytic Promiscuity
Traditionally, enzymes have been understood
to be highly specific for the one reaction that
they catalyse (Nath & Atkins 2008). Recently,
the well-established yet under-acknowledged
notion of catalytic promiscuity is being more
broadly discussed (Khersonsky & Tawfik
2010). Catalytic promiscuity describes
coincidental conversion of substrates that are
different to the substrate for which the
enzyme evolved. (Khersonsky & Tawfik 2010).
Promiscuous enzymes may also have the
capacity to convert one substrate into
multiple products (Nath & Atkins 2008).
Importantly, catalytic promiscuity involves
catalysis of substrates that are not native to
the organism, such as toxic substrates or
drugs (Khersonsky & Tawfik 2010). There is a
plethora of literature that discusses the
evolutionary significance of promiscuous
enzymes. It is understood that these versatile
catalysts potentiate new evolutionary
functions (Nath & Atkins 2008).
In ALLURE, we used previously generated
recombinant E. coli as host microorganisms
expressing P450 in a whole-cell assays. We
studied a library of clones shuffled from P450
parental isoforms 1A1 and 1A2. This paper
describes assays performed on five of these
clones: #1, #6, #122, #126 and #188. P450 is
not native to E. coli, thus, plasmids that
encoded these shuffled genes included hPNR
to facilitate expression. These plasmids were
transformed into the recombinant E.coli and
libraries created in preparation for ALLURE.
The characterisation and catalytic activity of
these shuffled clones was studied as follows
 Genomic characterisation of shuffled
clones: Plasmid DNA extraction and
electrophoresis; Molecular weight of
recombinant P450; Sequencing of
plasmid DNA; Bioinformatic analysis of
the shuffled genes
 Catalytic activity of shuffled clones:
Production of indigo pigment via indoxyl
catabolism; Luciferin metabolism;
Resorufin metabolism
Shuffled enzyme libraries
A ‘shuffled library’ is one in which parental
isoforms of genes are shuffled at the genomic
level. In ALLURE, the parental isoforms were
CYP1A1 and CYP1A2. Restriction-enzymes
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
3
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
ALLURE PROGRAM 2011 – J. FLUHRER 42408307
RESULTS
Measuring P450 expression of samples
SDS-PAGE:
P450 is not native to E. coli. We confirmed
P450 expression in the recombinant mutants
using Sodium Dodecyl Sulphate Polyacrilamide
Gel Electrophoresis (SDS-PAGE). SDS-PAGE
separates protein on the basis of their size.
Figure 1 demonstrates the presence of P450
in and indicates the weight to be 5pmol.
Sequencing of Shuffled Clones
Plasmid DNA was extracted from shuffled
clones #1 and #188 using a QIAprep kit™.
The presence and quality of DNA was
demonstrated by electrophoresis.
Unfortunately the quality of the DNA
extracted was compromised (A260:A280 was 27.5 and -0.61 respectively)
Spectrophotometry was used to quantitate
DNA and determine the amount to send for
sequencing. Results from #1 were unreadable.
#188 was sequenced successfully for 700
nucleotides using a forward primer and for
344 nucleotides using a reverse primer (see
appendix). Construction of a contigous
sequence from the two sequencing reactions
was impossible due to the short length of
readable sequence.
Bioinformatic analysis of the sequence and of
CYP1A1 and CYP1A2, and #188 produced
the following results:
Prior to other assays, P450 expression was
also measured by tutor James Behrendorff.
These are outlined in Table 2.
P450 expression profiling confirmed the
presence of P450 enzymes in the control cells
and their recombinant clones. The overall
trend seems to be that the clones produced
more P450 than the parental isoforms.
* Using PROSITE (ExPASSy.org): CYP1A1 and
CYP1A2 both contain a P450 cystein-hemeiron ligand signature motif. The active site is
situated at 512aa in 1A1 and at 516aa in 1A2.
The site consists of the amino acid sequence:
FGMGKRKCIG. Upon translating the #188
sequence in 6 frames, this sequence was not
present.
* BLASTx was used to determine whether the
188 sequence contained any recognisable
protein sequences. Significant alignments
included detection of cytochrome P450
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
4
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
ALLURE PROGRAM 2011 – J. FLUHRER 42408307
[Homo Sapiens], with most prominent
isoform sequence detected being CYP2C9
(Sigrist et al. 2010). Further analysis and resequencing may confirm whether clone #188
has been shuffled to resemble this P450
isoform.
* Sequence similarity search using BLASTn:
Identicle sequences were found in 18 regions
of the 1A1, 1A2 and #188 sequences. The
identity of these sequences ranged from
between 63-100%. Much structural integrity
was maintained, however, there were a few
matches between the 1A1/1A2 and the clone
that were in very different genomic positions.
This confirms the clone #188 as a shuffled
clone of CYP1A1/1A2.
Indoxyl, a product of tryptophan metabolism
in E. coli is metabolised by P450 to produce
indigo in recombinant bacterium. Controls
(1A1, 1A2, hPNR) and shuffled clones 1, 6,
122, 126 and 188 were tested for their ability
to produce indigo pigment in solid and liquid
agar in two separate assays. Slight indigo
production was detected from all clones in the
liquid agar assay (see Figure 2) though it was
undetectable in solid agar. This may be a
limitation of the solid agar as a medium for
this assay.
Luminescence
Screening for indigo production in solid
and in liquid culture
concentrations. The standard curve was
successful in both a preliminary assay (luciferin
0µM-50µM) and in the final assay (luciferin
0µM-5µM). Figure 3 shows standard curve and
luminescence of clones in the final assay. In
both the preliminary and final attempts, clones
1 and 6 displayed activity, with product
concentrations equivalent to
approximately1.7µM and 1.8µM respectively.
There was no detectable activity in the other
Controls and clones
Luciferin
(µM)
Figure 3: Luminescence of controls (1A1, 1A2, hPNR)
and shuffled clones (, #6, #122, #126, #188) in the
final Luciferin metabolism assay. Activity in in clones
#1 and #6 suggest convertion of 20µM substrate to
approximately 1.7µM and 1.8µM luciferin product in
the respective clones
clones.
Screening for Luciferin Metabolism
Some P450 isoforms are able to catabolise
Luciferin-CEE to product luciferin in a
luminescent reaction. The intensitiy of
luminescence produced is a function of the
concentration of reaction product. Thus,
measurements of luminescence were
compared to a standard curve of known
Screening for O-Dealkylation via 7benzyloxyresorufin metabolism
Shuffled clones were tested for their ability to
metabolise probe-substrate 7benzyloxyresorufin (BROD) in a fluorescent
assay. Conversion of BROD to resorufin is an
oxidative dealkylation reaction known to be a
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
5
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
ALLURE PROGRAM 2011 – J. FLUHRER 42408307
marker of CYP3A isoform induction. There
was no detectable activity in the preliminary
assay, nor was there detectable activity in the
final assay. Adjustments to the preliminary
assay included an internal standard and
tightening up of sequence reaction times. Also,
the final assay included isoform CYP3A as a
control, however, it also did not display
detectable activity, suggesting the
experimental procedure be revised.
Generally, the P450 expression profile was
comparable between the preliminary and final
assay.
DISCUSSION
Cytochrome P450 is an extraordinary diverse
gene family which contains over 5,000
isoforms. CYP1A1 and CYP1A2 are members
of this family, and are known for their mutual
ability to produce indigo, convert luciferinCEE to lucifern, and catabolise carcinogenic
intermediates of cigarette smoke (Stiborov· et
al. 2001). 1A2 has the further capacity to
accept caffeine, fluorescent resorufins,
aflatoxin B1, heterocyclic aromatic amines and
acetaminophen substrates. In ALLURE, we
were able to complete whole cell assays of
five shuffled clones from parental isoforms
CYP1A1 and CYP1A2. Luciferin metabolism
was maintained in at least two clones ( #1 and
#6). Indigo production was minimal in all five
clones. No clones were able to participate in
resorufin metabolism, however, there was
also no activity in the positive controls,
deeming the results inconclusive.
There were technical aspects of the assays
that are worth considering in terms of result
analysis. Inconclusive results in the assay
testing resorufin metabolism could be of great
interest. The O-dealkylation of BROD is a
specific marker that assigns induction of P450
isoform CYP3A by xenobiot compounds
(Stiborov· et al. 2001). CPY3A isoforms are
responsible for 50% of the human metabolism
of clinical drugs. Apart from in the liver,
CYP3A human isoforms influence endocrine
function by mediating androgen level and
signalling in the brain. Conversion of
BRODresorufin is an oxidative dealkylation
reaction that is selective for 3A enzymes. The
parental isoforms (1A1, 1A2) of our clones
are not known to participate in this reaction,
thus, it would have been an enormous
surprise had their genes been shuffled in a way
that confers BROD dealkylation to clones.
However, using CYP3A as a positive control
in the final assay did not confirm these
speculations as the control results were
negligible. Further investigation into the Odealkylative activity of the clones is required.
Assays on the purified P450 protein fractions
rather than on the whole cells may provide
further information.
P450 genes are approximately 2,500 base pairs
(bps) in length. Sequencing reactions of the
shuffled clones produced between 340-700bps
of quality sequence. Despite this, sequence
similarity searches identified clone #188 as
similar (100%) to Cytochrome P450 gene
family. Unfortunately the heme-ligand binding
site was not confirmed present in the short
lengths of the #188 sequence. We assume
that the short clone sequence did not cross
over the usual site at which the signature
motif appears. We predict that the signature
motif exists in a part of the DNA that
unfortunately was unable to sequenced
successfully.
Shuffling of 1A1 and 1A2 in the clone #188
was confirmed using sequence similarity
search tools. Regions of up to 30 nucleotides
in length were 63-100% identical. There was
no pattern as to where on the parental
isoform genome these matching sequences
were existed. This suggests that the shuffling
of DNA happened in random orientation in
the clones.
Interestingly, the isoform that #188 seems
most similar to is one that is alternate to its
parental strains 1A1 and 1A2. The isoform
that #188 is most similar to is CYP2C9. The
catalytic of CYP2C9 is quite different from the
CYP1A1 and CYP1A2 from which #188 is
derived. 2C9 is induced into activity by
rifampim. The xenobiotics it metabolises
include S-warfarin, ibuprofen, phenytoin, and
tolbutamide. Furthermore, 2C9 is suggested
to be polymorphic. Variants of the gene are
often expressed in poor metabolisers of
phenytoin and tolbutamide (Nelson et al.
2004). Investigations of the catabolic activity of
clone #188 in relation to the 2C9 isoform
may elucidate novel properties possessed by
the clone that are not native to parental
isoforms. Such further study may prove useful
for directing the evolution of P450 clones and
the biotechnological advantage they may
confer.
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
6
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
ALLURE PROGRAM 2011 – J. FLUHRER 42408307
EXPERIMENTAL PROCEDURES
Recombinant library: Recombinant E. coli
library were previously produced as described
in Johnston et. al 2007 (Johnston et al.
2007)(Johnston et al. 2007). Maintenance of
this library was performed by tutor James
Behrendorff and UQ laboratory staff.
P450 expression profiling: This was done
by tutor James Behrendorff in preparation for
each ALLURE practical
SDS-PAGE: This technique separates
proteins based on their size as follows: prior
to electrophoresis, the proteins are treated
with SDS and heated in order to denature
quarternary and tertiary structures. SDS
confers a negative charge on the protein
relative to the length of the polypeptide.
Proteins in the sample are thus separated by
size. Materials and methods as per ALLURE
practical manual.
DNA minipreps: Plasmid DNA extracted
for sequencing was achieved using using
QIAprep kit. Protocol as per ALLURE
practical manual.
DNA Sequencing: Forward and reverse
primers were designed by UQ staff.
Sequencing was performed externally.
Indigo Production: As per ALLURE prac
manual
Luciferin metabolism: Standard curve set
up included luciferin concentrations of 0µM,
2.5µM, 5µM, 10µM 25µM and 50µM in the
preliminary assay, and concentrations of 0µM,
1.25µM, 2.5µM, 3.75µM and 5µM in the final
assay. Luminescent assay with 45µL cells
(controls1A1, 1A2, hPNR; clones 1, 6, 122,
126, 188), 5µL of 300µM stock luciferin-CEE
substrate. Incubation for 20mins 45mins was
at 37ºC/700rpm. Reactions were stopped by
the addition of 20µL luciferase. Other than
the standard curve set up, the final assay
proceeded as per the preliminary.
BROD catabolyic assay: Instead of 2mM
substrate solution as prescribed in the
ALLURE prac manual, a 1mM BROD solution
was used. Successful standard curve was
created using resorufin concentrations of
0µM, 2.5µM, 5µM, 10µM, 15µM and 20µM.
Fluorescent assay with 40µL cells in a 100µL
reaction volume: controls 1A1, 1A2, hpNR
cells; mutant clones 1, 6, 122, 126, and 188;
substrate: 20µM concentration of 1mM BROD
in 50% methanol; and buffer. Assay was
incubated for 30mins at 37C before reaction
was stopped by the addition of 100µL cold
methanol. Fluorescence measured with
ex=530nm, em=582nm. Additional
procedures in the final assay included the set
up of an an internal standard, tightening of
reaction time, and an additional control
isoform CYP3A.
ACCESSION NUMBERS:
CYP1A1: NC_000015;
CYPA12: NM_000761
ACKNOWLEDGEMENTS
James Behrendorff, tutor and mentor of
the ALLURE program. James maintained the
shuffled libraries, prepared samples of clones,
performed expression profiling and undertook
the laboratory work necessary to facilitate
assays achieved in ALLURE. During and inbetween practicals, James was always available
for discussion and was always encouraging and
patient in the way he advised students. I felt
honoured to be under his tutelage.
Susan Rowland: organising the grant,
scripting and coordinating the ALLURE
program. Susan has been critical in establishing
the opportunity for my fellow students and I
to partake in real research experience.
Laboratory partner Tim Borlace who
worked professionally and efficiently in the
laboratory. Collaborating with Tim has been
an invaluable learning experience. Tim also
completed the final Luciferin assay entirely
without my assistance and was extremely
willing to share his ideas and results with
regards to this assay.
Laboratory staff for assisting James with the
preparation and facilitation of the programme.
Fellow ALLURE students for their active
contribution to discussions and continuous
encouragement
University of Queensland – Thank you
incorporating the ALLURE program into the
biochemistry curriculum.
APPENDIX
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
7
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
ALLURE PROGRAM 2011 – J. FLUHRER 42408307
SEQUENCING RESULTS
From the forward primer:
TCCTGGCCCCACTCCTCTCCCAGTGAT
TGGAAATATCCTACAGATAGGTATTAAG
GACATCAGCAAATCCTTAACCAATCTCT
CAAAGGTCTATGGCCCTGTGTTCACTCT
GTATTTTGGCCTGAAACCCATAGTGGTG
CTGCATGGATATGAAGCAGTGAAGGAA
GCCCTGATTGATCTTGGAGAGGAGTTTT
CTGGAAGAGGCATTTTCCCACTGGCTG
AAAGAGCTAACAGAGGATTTGGAATTGT
TTTCAGCAATGGAAAGAAATGGAAGGA
GATCCGGCGTTTCTCCCTCATGACGCT
GCGGAATTTTGGGATGGGGAAGAGGAG
CATTGAGGACCGTGTTCAAGAGGAAGC
CCGCTGCCTTGTGGAGGAGTTGAGAAA
AACCAAGGCCTCACCCTGTGATCCCAC
TTTCATCCTGGGCTGTGCTCCCTGCAAT
GTGATCTGCTCCATTATTTTCCATAAAC
GTTTTGATTATAAAGATCAGCAATTTCTT
AACTTAATGGAAAAGTTGAATGAAAACA
TCAAGATTTTGAGCAGCCCCTGGATCC
AGATCTGCAATAATTTTTCTCCTATCATT
GATTACTTCCCGGGAACTCACAACAAAT
TACTTAAAAACGTTGCTTTTATGAAAAG
TTATATTTTGGAAAAAGTAAAAGAACAC
CAAGAATCAATGGACATGAACAACCCT
Sequencing results from the reverse Promer
CAACCATATTAATTTCCCTGACTTCTGT
GCTACATGACAACAAAGAATTTCCCAAC
CCAGAGATGTTTGACCCTCATCACTTTC
TGGATGAAGGTGGCAATTTTAAGAAAAG
TAAATACTTCATGCCTTTCTCAGCAGGA
AAACGGATTTGTGTGGGAGAAGCCCTG
GCCGGCATGGAGCTGTTTTTATTCCTGA
CCTCCATTTTACAGAACTTTAACCTGAA
ATCTCTGGTTGACCCAAAGAACCTTGAC
ACCACTCCAGTTGTCAATGGATTTGCCT
CTGTGCCGCCCTTCTACCAGCTGTGCT
TCATTCCTGTGTCGACCCATCATCATCA
TCATCATTGA
REFERENCE:
Bernhardt, R. (2006). Cytochromes P450 as
versatile biocatalysts. J Biotechnol. 124, 128-45.
Johnston, W.A., Huang, W., De Voss, J.J., Hayes,
M.A. & Gillam, E.M. (2007). A shuffled CYP1A
library shows both structural integrity and
functional diversity. Drug Metab Dispos. 35, 21772185.
Khersonsky, O., and Tawfik, D.S. (2010). Enzyme
promiscuity: a mechanistic and evolutionary
perspective. Annu Rev Bioche 79, 471-505.
Mathias, A., Kisdi, A., Olivieri, I. (2001). Divergent
evolution of dispersal in a heterogeneous
landscape. Evolution 55, 246-59.
Myasoedova, K.N. (2008). New findings in studies
of cytochromes P450. Biochemistry (Mosc) 73,
965-969.
Nath, A., and Atkins, W.M. (2008). A quantitative
index of substrate promiscuity. Biochemistry 47,
157-166.
Nelson, D.R., Zeldin, D.C., Hoffman, S.M., Maltais,
L.J., Wain, H.M. and Nebert, D.W. (2004).
Comparison of cytochrome P450 (CYP) genes
from the mouse and human genomes, including
nomenclature recommendations for genes,
pseudogenes and alternative-splice variants.
Pharmacogenetics 14, 1-18.
Sigrist, C., Cerutti, L., de Castro, E., LangendijkGenevaux, P., Bulliard, V., Bairoch, A., and Hulo, N.
(2010). PROSITE, a protein domain database for
functional characterization and annotation. Nucleic
Acids Research 38, 161-166.
Stiborov, M., Frei, E., Wiessler, M., and Schmeiser,
H.H. (2001). Human enzymes involved in the
metabolic activation of carcinogenic aristolochic
acids: evidence for reductive activation by
cytochromes P450 1A1 and 1A2. Chemical
research in toxicology 14, 1128-37.
Investigating the Catalytic Activity of P450 CYP1A1 and CYP1A2 Shuffled Clones
8