Detailed protocol for Telomere Length measurement by Quantitative PCR
(updated by RR, October 2012)
We measure telomere length using the quantitative-polymerase chain reaction (Q-PCR) method (1). A
crucial step in the success of telomere length measurements is accurate quantification of DNA
concetration. We quantify samples using a Nanodrop and/or the picogreen assay (if RNA contamination
is suspected). For each sample, two PCRs are performed: the first one to amplify the telomeric DNA
and the second one to amplify a single-copy control gene (36B4, acidic ribosomal phosphoprotein PO).
This provides an internal control to normalize the starting amount of DNA. A four-point standard curve
(2-fold serial dilutions from 10 to 1.25ng of DNA) is included in all PCRs to allow the transformation of
Ct (cycle threshold) into nanograms of DNA. All PCR reactions are performed in either a Rotor-Gene
3000 (in a 72 tubes rotor) or a Rotor Gene Q (in 100-well discs). Each reaction typically includes: 1X
Rotor Gene Sybrgreen PCR master mix (Qiagen) and 5ng of DNA. The telomere PCR uses 500nM of
each primer (tel1b: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT; tel2b:
GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT). The control-gene PCR uses 1uM of each
primer (36B4u: CAGCAAGTGGGAAGGTGTAATCC; 36B4d: CCCATTCTATCATCAACGGGTACAA).
Both PCR reactions are run with an initial denaturation step at 95C for 15min and 30 cycles of
amplification at 95C for 15sec and at 60C for 20sec (different times used for the Rotor Gene Q).
The raw data from the Rotor Gene software is exported in Excel and baseline background subtraction
is performed with an in-house software that aligns all the amplification plots to a baseline height of 2%
in the first 5 cycles of amplification. When the Rotor Gene Q is used, we include a HEX dye in the
reaction, which acts as a passive reference dye. We use this signal for normalization in the Rotor Gene
software and then we export to Excel and analyze the data as described above. The fluorescence
threshold for determination of the Ct is set at the beginning of the exponential phase of the plot, using a
constant value for all the PCRs in a given project. Cts are converted into nanograms of DNA using
standard curves. Rsquare for the telomere and control gene standard curves are typically >0.995.
Efficiency for the telomere and control gene PCRs are typically >0.90. All samples are run in triplicate
and the median is used for subsequent calculations. The amount of telomeric DNA is divided by the
amount of control-gene DNA, producing a relative measurement of the telomere length of the sample.
Two control samples are run in each experiment to allow for normalization between experiments and
periodical reproducibility experiments are performed to guarantee correct measurements. Potential
outlier samples with extreme long or short telomeres are usually repeated to confirm measurements.
The typical inter-assay variability (coefficient of variation) is between 6-8%. This level of variability is in
agreement with the variability reported by another expert laboratory (2). This group performed a
detailed comparative analysis of telomere length measured by Q-PCR and Southern blot and reported
a high correlation between both methods (r=0.847, p<0.0001) (2).
1. Cawthon, R. M. Telomere measurement by quantitative PCR. Nucleic Acids Res, 30: e47, 2002.
2. Aviv A, Hunt SC, Lin J, Cao X, Kimura M, Blackburn E. Impartial comparative analysis of
measurement of leukocyte telomere length/DNA content by Southern blots and qPCR. Nucleic
Acids Res. 2011 Nov 1;39(20):e134. Epub 2011 Aug 8.