Appendix
Stem cells derived from ‘inflamed’ and healthy periodontal
ligament tissues and their sheet functionalities: a patientmatched comparison
Hao-Ning Tang*, Yu Xia*, Yang Yu, Rui-Xin Wu, Li-Na Gao, Fa-Ming Chen
State Key Laboratory of Military Stomatology Biomaterials Unit, Department of
Periodontology, School of Stomatology, Fourth Military Medical University, Xi’an, P.
R. China
* These authors contributed equally to this work.
Running title: Patient-matched comparison of I-PDLSCs and H-PDLSCs
Address:
Professor Fa-Ming Chen
State Key Laboratory of Military Stomatology Biomaterials Unit
Department of Periodontology, School of Stomatology
Fourth Military Medical University
145th West Changle Road, Xi’an 710032, P. R. China.
E-mail: cfmsunhh@fmmu.edu.cn
1
Materials and Methods
Cell cultures
Following tooth extraction at the Dental Clinic of the School of Stomatology of the
Fourth Military Medical University (FMMU) in Xi’an, China, patient-matched
‘inflamed’ and healthy PDL tissues were collected from the root surface of the
periodontitis-involved tooth and the third molar, respectively, and were subjected to
parallel cell isolation procedures. If patient-matched I-PDLSCs and H-PDLSCs were
not successfully obtained (for example, because insufficient PDL tissue was collected
or because the cell isolation procedure failed) or if the cells could not be used in parallel
for further investigation (for example, due to contamination or damage of the I-PDLSCs,
H-PDLSCs, or both), the cells from that donor were automatically excluded from the
study. Cell isolation was performed based on methods that have been previously used
in our laboratory, with minor modifications (Liu et al. 2011). Briefly, the obtained teeth
were rinsed with phosphate-buffered saline (PBS; Gibco BRL, Gaithersburg, MD,
USA), and the PDL tissues were then gently scraped from the surface of the root.
‘Healthy’ PDL tissues were obtained from the middle third of the root of the third
molars, whereas ‘inflamed’ root-attached PDL tissues were obtained from the root
surfaces, according to the following criteria: (1) at least 1 mm distal to the periodontalpocket-involved areas to avoid contamination by granulation tissue and (2) at least 1
mm distal to the apical apex to avoid the involvement of dental pulp tissues. The
obtained PDL tissues were digested with 3 mg/mL collagenase (type I) (Sigma-Aldrich,
St. Louis, MO, USA) and 4 mg/mL dispase (Sigma-Aldrich) for 1 h at 37°C. After
2
digestion, the tissues were transferred to 6-well culture dishes (Costar, Cambridge, MA,
USA) containing basal medium, i.e., α-minimum essential medium (α-MEM; Gibco
BRL) supplemented with 10% fetal bovine serum (FBS; Hangzhou Sijiqing Biological
Engineering Materials Co., Ltd. Zhejiang, China), 0.292 mg/mL glutamine (Invitrogen
Life Technologies, Carlsbad, CA, USA), 100 U/mL penicillin (Gibco BRL), and 100
mg/mL streptomycin (Gibco BRL). The culture dishes were then incubated at 37°C in
a humidified atmosphere containing 5% CO2. The medium was refreshed every 3 days
until the cells approached subconfluence. The limiting dilution method was
subsequently used to purify stem cells, which were then subjected to further
investigation. To avoid changes in cellular behavior caused by prolonged culture, only
cells at passages 2-4 (P2-P4) were used.
Immunofluorescent staining of vimentin and cytokeratin in cells
Immunofluorescent staining was used to evaluate the levels of vimentin and cytokeratin
expression in I-PDLSCs and H-PDLSCs, as previously described (Chen et al. 2012).
Briefly, suspensions of I-PDLSCs and H-PDLSCs (P2) were seeded in 24-well plates
(Costar) at a density of 1×104 cells/well. After incubation at 37°C for 24 h to allow cell
adhesion, the cells were fixed with 4% paraformaldehyde, permeabilized with 0.1%
Triton-X-100, and blocked with 1% bovine serum albumin (BSA; Sigma-Aldrich). The
cells were then incubated with primary antibodies at 4°C for 24 h and subsequently
with a fluorophore-conjugated secondary antibody at room temperature for 1 h. Finally,
the nuclei were stained with Hoechst 33342 (10 μg/mL; Sigma-Aldrich) for 10 min at
3
room temperature, and the excess dye was removed by washing with PBS. The
fluorescently labeled cells were immediately observed under an immunofluorescence
microscope (Leica Microsystems, Heerbrugg, Switzerland). The antibodies used in this
experiment included the following: anti-vimentin (GeneTex, Irvine, CA, USA), anticytokeratin (Bioworld, Atlanta, GA, USA), and Alexa Fluor 488-conjugated goat antirabbit IgG and Cy3-conjugated goat anti-mouse IgG (Zhuangzhi Biotech Co., Ltd,
Xi’an, China).
Colony-forming unit (CFU) assay
Single-cell suspensions of I-PDLSCs and H-PDLSCs (P2) were plated in 10-cmdiameter culture dishes (Corning, Lowell, MA, USA) in basal medium at a density of
1×103 cells/well and were cultured for 2 weeks (the medium was refreshed every 3
days). The cells were then fixed with 4% paraformaldehyde and stained with 1%
toluidine blue. A group 50 or more cells viewed under the microscope was scored as a
CFU, and the number of CFUs was counted for comparative analysis of the two types
of cells.
Cell proliferation and migration assays
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and 5-ethynyl2’-deoxyuridine (EdU) incorporation assays were used to characterize cell proliferation.
Briefly, I-PDLSCs and H-PDLSCs (P2) were plated in 96-well plates (Corning) at a
density of 2×103 cells/well and were cultured in basal medium for 24 h to allow cell
4
attachment. The MTT assay was then performed on each day of the 7-day cell culture
period. At each testing point, 20 μL of 5 mg/mL MTT solution (Sigma-Aldrich) was
added to each well, and the plate was incubated for 4 h. The medium was then replaced
with 150 μL of dimethyl sulfoxide (DMSO; Sigma-Aldrich), and the absorbance of
each well at 490 nm was measured using a microplate reader (ELx800, BioTek
Instruments Inc., Winooski, VT, USA). In parallel, cells were seeded 24-well plates
(Corning) at a density of 1 × 105 cells/well and cultured in basal medium 24 h for cell
adhesion. Then, cells were incubated with EdU for another 2 h and EdU incorporation
assay was then performed according to the manufacturer’s protocol using a CellLight™ EdU Apollo®567 In Vitro Imaging Kit (Ribobio, Guangzhou, China).
Additionally, the migratory ability of the cells was tested via a scratch assay. Briefly, IPDLSCs and H-PDLSCs were plated in 6-well plates (Corning) at a density of 1×105
cells/well and were cultured in basal medium. When the cells reached subconfluence,
10 μg/mL mitomycin C (Sigma-Aldrich) was added to the medium to inhibit
proliferation. Following an additional incubation of 2.5 h at 37°C, the cellular
monolayer was scratched using the tip of a 1000-μL pipette and was then washed three
times with PBS to remove the floating cells. Both of the cell populations were
visualized using an inverted microscope at 0 and 12 h to compare the cell migration
distances (measured using Image-Pro Plus 6.0). The migration distance was defined as
the average value of the migration distances of the fastest and slowest migrating cells,
which were measured in the photographs using Image-Pro Plus 6.0 and calculated
according to the magnification. To further evaluate cell motility, we determined the
5
levels of C-X-C chemokine receptor type-4 (CXCR-4) and stromal cell-derived factor1 (SDF-1) expression in both cell populations via real-time polymerase chain reaction
(RT-PCR) (see section on RT-PCR assay). Additionally, we determined the levels of
CXCR-4 protein in both types of cells via Western blotting (see section on Western
blotting assay), and we determined the levels of SDF-1 protein in both types of cells
using an enzyme-linked immunosorbent assay (ELISA) kit (NeoBioscience, Shenzhen,
China) according to the manufacturer’s instructions.
Flow cytometric analysis
The cell surface markers of I-PDLSCs and H-PDLSCs were analyzed via flow
cytometry (Zhang et al. 2012). Briefly, P2 cells were harvested, and 5×105 cells were
placed in microfuge tubes, washed three times with PBS containing 3% FBS and
incubated with allophycocyanin (APC)-conjugated monoclonal antibodies directed
against human STRO-1 (Biolegend, San Diego, CA, USA); fluorescein isothiocyanate
(FITC)-conjugated monoclonal antibodies directed against human CD146 and CD105
(eBioscience, San Diego, CA, USA); and phycoerythrin (PE)-conjugated monoclonal
antibodies directed against human CD44 (Abcam, Cambridge, UK), CD45 and CD34
(Biolegend) at 4°C in the dark for 1 h. Cell suspensions without antibodies served as
the negative controls. The cells were then washed three times and were resuspended in
200 μL of PBS containing 3% FBS. Finally, the cells were analyzed using a flow
cytometer (Beckman Coulter, Fullerton, CA, USA).
6
Differentiation potential of I-PDLSCs and H-PDLSCs in vitro
I-PDLSCs and H-PDLSCs (P3) were plated in 6-well plates at a density of 1×105
cells/well and were cultured in basal medium until subconfluence. The medium was
then changed to osteo-induction medium, i.e., basal medium supplemented with 50
μg/mL L-ascorbic-2-phosphate (MP Biomedicals, LLC, Santa Ana, CA, USA), 0.1 mM
dexamethasone, and 5 mM β-glycerophosphate (Sigma-Aldrich), or adipo-induction
medium, i.e., basal medium supplemented with 200 μM indomethacin, 0.5 mM 3isobutyl-1-methylxanthine (IBMX), 10 μM insulin and 1 μM dexamethasone (SigmaAldrich). The osteo- and adipo-induction media were refreshed every 3 days. To
evaluate the expression of adipogenic and osteogenic genes (see section on RT-PCR
assay), the cells were harvested after 10 days of induction. To determine the ability of
the cells to form lipid droplets (adipogenesis) or mineralized nodules (osteogenesis),
the cells were induced for 3 (adipogenesis) or 4 (osteogenesis) weeks. Briefly, after 3
weeks of adipo-induction, the cells were fixed with 4% paraformaldehyde for 30 min
at room temperature and stained with 0.3% Oil Red O staining (Sigma-Aldrich) for 20
min. The excess stain was then removed by washing with PBS, and the lipid droplets
were imaged under an inverted microscope. Finally, the lipid droplets were dissolved
with isopropanol, and the cell absorbance was measured. Alternatively, after 4 weeks
of osteogenic induction, the cells were fixed with 4% paraformaldehyde and stained
with 0.1% Alizarin Red S (pH 8; Sigma-Aldrich) for 30 min. The excess stain was then
removed by washing with PBS, and the mineralized nodules were imaged. Finally, the
mineralized nodules were dissolved with hexadecylpyridinium chloride, and cell
7
absorbance was quantitatively measured at 560 nm.
RT-PCR analysis
For all of the RT-PCR assays, total RNA was harvested from I-PDLSCs and H-PDLSCs
using TRIzol reagent (Invitrogen Life Technologies) and was reversed transcribed into
cDNA using the First Strand cDNA Synthesis Kit (Takara Bio, Otsu, Japan) according
to the manufacturer’s protocol. RT-PCR was then performed using SYBR Green Master
Mix (Roche Life Sciences, Branford, CT, USA) and a quantitative PCR system (BioRad, Hercules, CA, USA). Amplification was performed under the following
conditions: denaturation at 95°C for 3 min and 39 cycles of 95°C for 15 s and 60°C for
30 s. The results were evaluated via the SmartCycler II software program. The primer
sequences used in the present study were as follows: CXCR-4 (forward, 5’TCATCCTCATCCTGGCTTTC-3’; reverse, 5’-CAAACTCACACCCTTGCTTG-3’);
SDF-1
(forward,
5’-GTCAGCCTGAGCTACAGATGC-3’;
reverse
5’-
CACTTTAGCTTCGGGTCAATG-3’); peroxisome proliferator-activated receptor-γ
(PPAR-γ; forward, 5’-CCACTTTGATTGCACTTTGGTACTCTTG-3’; reverse, 5’CTTCACTACTGTTGACTTCTCCAGCATTTC-3’); osteocalcin (OCN; forward, 5’CCCAGGCGCTACCTGTATCAA3’;
reverse,
5’-
GGTCAGCCAACTCGTCACAGTC-3’), Runt-related transcription factor-2 (RUNX2;
forward,
5’-CACTGGCGCTGCAACAAGA-3’;
reverse,
5’-
CATTCCGGAGCTCAGCAGAATAA-3’), alkaline phosphatase (ALP; forward, 5’GGACCATTCCCACGTCTTCAC-3’; reverse, 5’-CCTTGTAGCCAGGCCCATTG8
3’); and β-actin (forward, 5’-TGGCACCCAGCACAATGAA-3’; reverse, 5’CTAAGTCATAGTCCGCCTAGAAGCA-3’). β-actin served as the internal reference.
Immunosuppression analyses
Peripheral blood mononuclear cells (PBMNCs) were extracted from fresh blood
obtained from three systemically healthy donors using density-gradient centrifugation,
and immunosuppression analyses were performed via co-culturing PBMNCs with
either I-PDLSCs or H-PDLSCs (PBMNCs from each donor were used independently)
(Liu et al. 2012; Yazid et al. 2014). The entire research process conformed to the
guidelines of the Blood Transfusion Department, Xijing Hospital, FMMU. Before coculture, the PBMNCs were cultured in Roswell Park Memorial Institute (RPMI)-1640
medium supplemented with 10% FBS, 2 mM glutamine and 2% antifungal antibiotic
(Gibco BRL) and were activated with 10 μg/mL phytohemagglutinin (PHA; SigmaAldrich). Subsequently, 10 μg/mL mitomycin C was added to the medium to inhibit
proliferation. Finally, the PBMNCs were plated in 96- and 24-well plates at densities
of 4.8×104 and 4.8×105 cells/well, respectively, and PDLSCs were plated at a ratio of
1:12, 1:24, or 1:48 (PDLSCs:PBMNCs) according to a previous study (Yazid et al.
2014). The control group consisted of cultured PBMNCs stimulated with PHA (without
PDLSCs). The proliferation rate of the PBMNCs was determined at 12, 24, 48, and 72
h using a Cell Counting Kit-8 (CCK-8, 7 Sea Pharmtech, Shanghai, China) according
to the manufacturer’s instructions, and the data were analyzed using the following
formula: % change in PBMNC proliferation = 100 × [(cells + PBMNCs +
9
PHA)]/(PBMNCs + PHA) (Yazid et al. 2014). The rate of apoptosis after 72 h of coculture was determined using an annexin V/propidium iodide (annexin V/PI) kit (7 Sea
Pharmtech) according to the manufacturer’s instructions. Briefly, PBMNCs were
harvested, suspended, and washed, followed by staining with 5 μL of annexin V-FITC
and 5 μL of PI in 500 μL of binding buffer for 15 min at room temperature in the dark.
The apoptosis percentage was determined using a flow cytometer. To evaluate the
capacity of PDLSCs to suppress the cytokine production of PBMNCs, changes in the
concentrations of interleukin (IL)-2, IL-10, interferon (IFN)-γ, and tumor necrosis
factor (TNF)-α in the culture supernatants following 72 h of co-culturing of PBMNCs
and I-PDLSCs (or H-PDLSCs) at a ratio of 1:24 were determined using ELISA kits
(NeoBioscience).
Cell-sheet formation and evaluation
Morphology of the cell sheets
I-PDLSCs and H-PDLSCs (P4) were plated in 6-well plates at a density of 1×105
cells/well and cultured in basal medium until subconfluence. The medium was then
changed to cell-sheet induction medium, i.e., basal medium supplemented with 50
µg/mL vitamin C (the medium was refreshed every 3 days) (Wu et al. 2015). After 10
days of induction, the cell sheets that had formed were harvested in PBS using
ophthalmology forceps and were subjected to morphological evaluation using H&E
staining, Masson staining and scanning electron microscopy (SEM). For the H&E
staining and Masson staining, the cell sheets were fixed with 4% paraformaldehyde,
10
embedded in paraffin blocks, and cut into 5-µm-thick sections. Then, the obtained
samples were stained and observed. The thickness of the cell sheets was defined as the
average thickness of three randomly selected sites in each part of the cell sheet,
measured in photographs using Image-Pro Plus 6.0 and converted based on the
magnification. For SEM observation, the cell sheets were fixed with 2.5%
glutaraldehyde at 4°C for 2 h and then dehydrated with a gradated series of ethanol
solutions. The obtained samples were observed using SEM (Hitachi S-4300; EIKO
Engineering, Tokyo, Japan).
Cell viability in the cell sheets
Cell sheets were quantitatively analyzed using the MTT assay to assess cell viability.
Briefly, following cell-sheet formation (10 days of sheet induction), 200 μL of MTT
solution was added to each well (with each well containing a sheet), and the MTT assay
was performed as described previously.
Western blotting assay
The matrix proteins present in the cell sheets were analyzed via Western blotting.
Briefly, the total proteins in the cell sheets were harvested in Radio
Immunoprecipitation Assay (RIPA) Lysis Buffer supplemented with a protease
inhibitor cocktail (Sigma-Aldrich), and the protein concentrations were determined
using a bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, China). To
determine the CXCR-4 protein level in the cells (in the cell migration assay), as
11
mentioned previously, the total proteins in the cells were harvested using this method.
Then, 40 μg of protein was loaded into each lane of a Tris-glycine SDS-polyacrylamide
gel (Invitrogen), and the proteins were separated, transferred to polyvinylidene fluoride
membranes (Millipore, Billerica, MA, USA) and blocked in 5% BSA (Sigma-Aldrich)
for 2 h. Subsequently, the membranes were incubated with primary antibodies at 4°C
overnight and then with secondary antibodies at room temperature for 2 h. Finally,
signals were detected using the Western-Light Chemiluminescent Detection System
(Peiqing, Shanghai, China) after exposing the membranes to a chemiluminescent
horseradish peroxidase (HRP) substrate (Thermo Scientific Inc., Rockford, IL, USA).
The antibodies used to evaluate the cell/matrix proteins included anti-CXCR-4 (Abcam,
Cambridge, UK), anti-collagen type I (COL-1; Epitomics, Burlingame, CA, USA),
anti-periostin (Abcam PLC., Cambridge, UK), anti-integrin β1 (Millipore), and anti-βactin and HRP-conjugated anti-rabbit or anti-mouse secondary antibodies (Cowin
Biotech Co., Ltd., Beijing, China).
In vitro differentiation potential of the cell sheets
To examine the differentiation potential of the cell sheets in vitro, the cell sheets were
cultured in osteo-induction medium, adipo-induction medium or chondro-induction
medium, i.e., high-glucose Dulbecco’s modified Eagle’s medium (DMEM; Gibco BRL)
supplemented with 0.1 μM dexamethasone, 50 mg/mL L-ascorbic acid-2-phosphate
(Sigma-Aldrich), 40 mg/mL L-proline (Sigma-Aldrich), 1% insulin-transferrinselenium (ITS+1 premix, 100×; Sigma), 15% FBS, 10 ng/mL transforming growth
12
factor β1 (CytoLab/PeproTech, Rehovot, Israel), and 2% antifungal antibiotic reagent
(Yang et al. 2013). For adipogenic/osteogenic induction, mRNA levels and the lipid
droplets/mineralized nodules that had formed were analyzed using the methods
described above. ALP assays were performed using a kit (Beyotime) according to the
manufacturer’s instructions, and ALP activities were determined using a kit (Nanjing
Jiancheng Bioengineering Institute, Nanjing, China) after 10 days of osteogenic
induction. The antibodies used for the Western blotting assays included anti-RUNX-2
(Cell Signaling, Boston, MA, USA) and anti-OCN (Santa Cruz Biotechnology, Dallas,
TX, USA). To determine the chondrogenic potential of the cells, RNA and protein
assays were conducted after 3 weeks of chondrogenic induction of the cell sheets (Sato
et al. 2013). After 8 weeks of chondrogenic induction, the cell sheets were
immunohistochemically stained with an antibody against collagen type II (COL-2;
Rockland, PA, USA), and the integrated intensity per field was measured using ImagePro Plus 6.0. The sequences of the primers used for the RT-PCR assays were COL-2
(forward,
5’-CCAGTTGGGAGTAATGCAAGGA-3’;
ACACCAGGTTCACCAGGTTCA-3’)
and
aggrecan
reverse,
(ACAN;
forward,
reverse,
AGCAGTCACACCTGAGCAGCA-3’;
5’5’5’-
GTTCAGGCCGATCCACTGGTA-3’); the sequences of the other primers used are
described above (see section on RT-PCR assay).
Transplantation of I-PDLSC and H-PDLSC sheets into immunodeficient mice
The in vivo tissue regenerative capacity of PDLSCs was evaluated by transplanting cell
13
sheets formed by I-PDLSCs and H-PDLSCs in an ectopic transplantation model (Park
et al 2011; Gao et al 2013). All of the animal experimental procedures followed specific
protocols approved by the Animal Care and Use Committee of the Fourth Military
Medical University, Xi’an, China. The scaffold used was a hydroxyapatite-tricalcium
phosphate (HA-TCP; HA/TCP:60/40) ceramic powder (Engineering Research Center
in Biomaterials of Sichuan University, Chengdu, China) with a volumetric porosity of
approximate 55%. Briefly, 40 mg of scaffold was wrapped with the prepared I-PDLSC
or H-PDLSC sheets, and the cell-material constructs were transplanted into a
subcutaneous site in the dorsal region of immunodeficient female mice (6 animals, 6-8
weeks old, Fourth Military Medical University Animal Center, Xi’an, China). The cellmaterial constructs prepared with I-PDLSCs and H-PDLSCs were randomly
transplanted into the left or right side of each animal. After 8 weeks, the mice were
sacrificed, and the transplants were harvested, fixed with 4% neutral formaldehyde,
decalcified with 17% ethylene diamine tetraacetic acid (EDTA) and embedded in
paraffin. Paraffin sections (5-µm thick) were then analyzed by H&E staining and
quantitatively analyzed with Image-Pro Plus 6.0 to determine the percentage of new
bone formation. Meanwhile, randomly selected paraffin sections were stained with antihuman mitochondrial antibody to identify the origin of the reparative cells involved in
the formation of new bone tissue (Lei et al. 2014).
Results
14
Tracing cell origin by immunohistochemical staining
In terms of anti-human mitochondrial antibody staining, the cells surrounding the newly
formed bone generated by cell transplants were found to be reactive with anti-human
mitochondrial antibody, demonstrating that these cells were of human origin and not
mouse origin (Appendix Fig. 1). This finding indicates that the newly formed bone was
a result of human cell transplantation.
Appendix Fig. 1
Appendix Fig. 1. Immunohistochemical staining of the randomly selected transplants
with human-specific anti-mitochondria showing cells of mouse origin (nuclei: blue)
cover the surfaces of the transplants (#), while cells of human origin (mitochondria:
brown) are distributed within the relatively central area (*) and surround the newly
formed bone (NB), suggesting the cells contributing new bone formation are of human
origin. HA-TCP: hydroxyapatite-tricalcium phosphate.
Appendix References
15
Chen, B., Sun, H.H., Wang, H.G., Kong, H., Chen, F.M. & Yu, Q. (2012) The effects
of human platelet lysate on dental pulp stem cells derived from impacted human third
molars. Biomaterials 33, 5023-5035.
Gao, L.N., An, Y., Lei, M., Li, B., Yang, H., Lu, H., Chen, F. M. & Jin, Y. (2013) The
effect of the coumarin-like derivative osthole on the osteogenic properties of human
periodontal ligament and jaw bone marrow mesenchymal stem cell sheets.
Biomaterials 34, 9937-9951.
Lei, M., Li, K., Li, B., Gao, L. N., Chen, F. M. & Jin, Y. (2014) Mesenchymal stem cell
characteristics of dental pulp and periodontal ligament stem cells after in vivo
transplantation. Biomaterials 35:6332-6343.
Liu, N., Shi, S., Deng, M., Tang, L., Zhang, G., Liu, N., Ding, B., Liu, W., Liu, Y., Shi,
H., Liu, L. & Jin, Y. (2011) High levels of β-catenin signaling reduce osteogenic
differentiation of stem cells in inflammatory microenvironments through inhibition
of the noncanonical Wnt pathway. Journal of Bone and Mineral Research 26, 20822095.
Liu, D., Xu, J., Liu, O., Fan, Z., Liu, Y., Wang, F., Ding, G., Wei, F., Zhang, C. &
Wang, S. (2012) Mesenchymal stem cells derived from inflamed periodontal
ligaments exhibit impaired immunomodulation. Journal of Clinical Periodontology
39, 1174-1182.
Park, J. C., Kim, J. M., Jung, I. H., Kim, J. C., Choi, S. H., Cho, K. S. & Kim, C. S.
(2011) Isolation and characterization of human periodontal ligament (PDL) stem
16
cells (PDLSCs) from the inflamed PDL tissue: in vitro and in vivo evaluations.
Journal of Clinical Periodontology 38, 721-731.
Sato, Y., Wakitani, S. & Takagi, M. (2013) Xeno-free and shrinkage-free preparation
of scaffold-free cartilage-like disc-shaped cell sheet using human bone marrow
mesenchymal stem cells. Journal of Bioscience and Bioengineering 116, 734-739.
Wu, R. X., Bi, C. S., Yu, Y., Zhang, L. L. & Chen, F. M. (2015) Age-related decline in
the matrix contents and functional properties of human periodontal ligament stem
cell sheets. Acta Biomaterialia 22, 70-82.
Yazid, F. B., Gnanasegaran, N., Kunasekaran, W., Govindasamy, V. & Musa, S. (2014)
Comparison of immunodulatory properties of dental pulp stem cells derived from
healthy and inflamed teeth. Clinical Oral Investigations 18, 2103-2112.
Yang, H., Gao, L. N., An, Y., Hu, C. H., Jin, F., Zhou, J., Jin, Y. & Chen, F. M. (2013)
Comparison of mesenchymal stem cells derived from gingival tissue and periodontal
ligament in different incubation conditions. Biomaterials 34, 7033-7047.
Zhang, J., An, Y., Gao, L. N., Zhang, Y. J., Jin, Y. & Chen, F. M. (2012) The effect of
aging on the pluripotential capacity and regenerative potential of human periodontal
ligament stem cells. Biomaterials 33, 6974-6986.
17