Quinnipiac University
Master of Arts in Teaching Program
FORM E: Lesson Plan Template and Pre-Observation Questions1
Name of Student Teacher: ___Jacqueline Gabelmann_________________ Date:
June 2, 2010__________
Name of Placement School: Quinnipiac High School___________________________________________
Grade Level: ___10___ Subject: _Biology________Direct Instruction Final ____________________
Content Standards
Identify one or two primary local, state or national curricular standards to which your lesson aligns.

10.3 – Similarities in the chemical and structural properties of DNA in all living organisms allow the transfer of genes
from one organism to another.
Learner Background
Describe the students’ prior knowledge or skill related to the learning objective(s) and the content of this lesson. How did the
students’ prior performance in this content area or skill impact your planning for this lesson?
The class contains twenty students placed in a Level 7 class which is an on grade level class. The class behavior is generally
good. The students can be very talkative at times causing disruption during the lesson, but I have been able to handle and control
the situation as to not affect the atmosphere for student learning. This lesson is a continuation of the RNA Unit Plan. The students
will have a general overview of RNA, what it consists of, and its functions. The previous lessons/unit taught includes DNA, the
cell cycle and cell division. This lesson covers all learning styles so students will learn in multiple ways such as, visual, auditory,
written, and kinesthetic, hands on learning.
Student Learning Objectives(s)
Identify specific and measurable learning objectives for this particular lesson.


SWBAT identify an amino acid using the Amino Acid wheel.
SWBAT describe the process of translation.
Assessment
How will you ask students to demonstrate mastery of the student learning objective(s)? Attach a copy of any assessment
materials you will use, along with assessment criteria.
DURING
Guided: During guided practice I will be asking questions to the students and I will make sure that I only ask one question at a
time to prevent confusion. While asking questions if the students do not answer the question properly, I will make sure to
remediate the error; meaning that I will break down the answer into smaller concepts so it will be easier to understand.
Collaborative: During collaborative practice I will walk around the room and help any students that may need assistance on the
worksheet. The worksheet will be handed in the following day as a participation grade.
END
Independent: During independent practice students will work on a problem independently. I will not assist any students at this
time. The problems will be turned in and grade as a participation grade at the end of class.
AFTER
Homework: For homework students will be required to complete a worksheet which will be handed in and graded as a
homework grade the following day.
1
Adopted from the Connecticut State Department of Education Pilot Study of Student Teaching Evaluation
Form E
a
Materials/Resources
List the materials you will use in each learning activity including any technological resources.
Whiteboard
Powerpoint
Worksheets
Vocabulary Words
Amino Acids
Ribsomes
Proteins
Ribonucleic
DNA
RNA
tRNA
rRNA
mRNA
Learning Activities
Initiation: Briefly describe how you will initiate the lesson. (i.e., set expectations for learning and tell students why this learning
is important; articulate to learners what they will be doing and learning in this lesson, and tell students how they will demonstrate
learning.)
Do Now: Given the following DNA sequence, write the corresponding RNA sequence.
AGCTGGACTAACTCAGGAATC
Connect: Show how the DNA sequence from the Do Now can be split up into smaller subunits contained 3 nucleotides each.
Motivate: Explain how translation is an ongoing process in the body that is crucial for the lively hood of the human race. Show
short video of what they are going to be learning about so that they can visualize the process.
Agenda:
Do Now
Translation Lesson
Amino Acid Wheel
Cooperative Learning Activity
Homework
Exit Slip
Lesson Development: Describe how you will develop the lesson, what you what you will do to model or guide practice, and the
learning activities in which students will be engaged in order to gain the key knowledge and skills identified in the student
learning objective(s). Identify the instructional grouping (whole class, small groups, pairs, individuals) you will use in each phase
of instruction.
Focus
1)
2)
Modeling: I will introduce the Amino Acid Wheel and demonstrate how the wheel works. I will then introduce the
process of translation and how it works within the cell. I will go over the 4 main points topics of translation; initiation,
activation, elongation and termination.
Metacognitive: During the Metacognitive portion of the lesson plan I will show students how to use the amino acid
wheel and how it corresponds with translation. Each student will be given the amino acid wheel handout.

Students will be given a long RNA sequence. The students will then be instructed to split the code into
triplets.

The students will then take the triplets and find the corresponding amino acids.

The students will then be shown how to find the amino acids using the amino acid wheel.

The students must start in the middle with the first nucleotide in the triplet sequence. For example A.

The students will then, from the A, find the next nucleotide in the sequence, such as G. Then will then move
their finger from the A to the next outer part of the circle and find G.
Form E
b



The students will find the last nucleotide in the given sequence which is T. The students will then move their
finger from the G to the T.
The last step the students will more their finger one last time to the outer circle to find the corresponding
amino acid, which is serine.
The students will then be told that after the entire RNA sequence is “read” the amino acids fold up and
become an active protein.
3)
Think Aloud: During the think aloud I will demonstrate how I use the amino acid wheel and how it corresponds with
translation.

I will show the parents how I split up the RNA sequence. I will then show them the separate codons.

I will then show them how the separate codons correspond with the specific amino acids and the amino acid
wheel.

First I start by finding the first nucleotide for example, G in the middle of the wheel. From there I notice that
the second nucleotide in the sequence is A.

Therefore in the second step I move my finger from the large G in the middle to the smaller A outside of the
G area in the next smaller circle.

In the third step I find that the last nucleotide in the sequence is G. Therefore, I move my finger from the A to
the next outside circle and find the G.

From there, I move my finger outside to the next circle and find that the corresponding amino acid is
Glutamic Acid.
4)
Guided Practice: During guided practice I will walk around the room and answer any questions students may have
about the specific problem or the overall concept. If I find that there is a common mistake being made I will be sure to
get the attention of the whole class and tell the students the common mistake and how not to make the mistake.
Questions for Guided Practice: What is the corresponding amino acid to CCC?
What is the corresponding amino acid to TTC?
What are the stop codons?
5)
Collaborative Practice: During collaborative practice students will get together in groups of two and work on a
worksheet together. I will walk around and answer any questions the students may have regarding the worksheet. After
all the students have completed the worksheet I will go over the correct answers. The students will be able to keep the
worksheet as a study guide; however it will be collected the following day and used as a participation grade.
6)
Independent Practice: During independent practice, I will put a couple of problems on the board which the students
will copy down on a separate sheet of paper and complete individually. During this time I will not answer any
questions. After enough time I will collect the papers and grade them for the following day. The questions will be used
as a participation grade.
Questions for the board: What is the corresponding amino acid for CAA?
What is the corresponding amino acid for TCA?
What are all the codons for Glutamic Acid?
What is the function of translation?
What do the amino acids fold up to make?
Creative/Cooperative Learning Activity/Circle the Sage









At the end Independent Practice the students will count off 1-5. The students will then go to their corresponding lab
tables.
I will then tell the students that table 1 is activation; table 2 is initiation, table 3 is elongation; table 4 is termination and
table 5 is the amino acid wheel.
The students will then discuss their topics for an allotted time.
The students will be instructed to pick and expert or sage.
The sage will then be instructed to move to the next table in a clockwise table. At that table, the students will be
instructed to act the sage questions about the sage’s specific topic.
This process will then occur 3 more times until the sage is back at their first table.
Once the sages are back at their corresponding tables, the group will be instructed to write down the 3 main ideas.
One of the group members will then write the main ideas on the board.
The students will then be instructed to go back to their seats and write down the main ideas of each topic into their
notebooks.
Form E
c

At the end of the activity I will distribute and explain the homework assignment.
Closure: Briefly describe how you will close the lesson and help students understand the purpose of the lesson.



At the end of the period I will summarize the main points that were discussed during the class. I will go over the 4 main
points of translation and I will also discuss how codons and amino acids are related.
While I am summarizing I will make sure to ask questions to check for understanding.
o What is the function of translation?
o What are the 4 steps of translation?
o What do amino acid fold up to make?
o How many nucleotides does it take to create a codon with a matching amino acid?
I will then distribute an exit slip that the students will fill out and hand in while they are leaving class.
Individuals Needing Differentiated Instruction
In the chart below, describe 1 to 3 students with identified instructional needs. (These students may be special or general
education students; students may represent a range of ability and/or achievement levels.)
Student’s First Name
Student’s Instructional Need(s)
Strategy for Differentiating Instruction
Mike has cerebral palsy and therefore
cannot move around the classroom
easily.
I have assigned groups so the students can work
together, however I will also assign locations in the
room for each group to work so that Mike does not
have to move around the room.
Elizabeth has an auditory processing
disorder.
Elizabeth will have a copy of the notes that I will
verbally tell the class that way she only needs to focus
on filling in her powerpoint.
Mike
Elizabeth
Notes from Pre-conference
For use by:
 Cooperating Teacher or
 University Supervisor
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
Form E
d
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
________________________________________________________________________________________________________
Form E
e