#12 RNA Decoder Ring Activity Name ______________________ Date _____________ Core____ PART 1 : Construct your decoder ring 1. Carefully cut out the yellow inner ring. Try to cut just outside the line. 2. Being sure to line up the letters on the yellow ring EXACTLYwith the base ring above, glue the yellow ring onto the Decoder above. Be sure to glue the edges down. 3. Carefully cut out the green ring. You will need to cut out the notches very carefully! 4. Write your name on the back of this ring. It will need to stay loose. 5. To use the RNA Decoder ring, you will simply lay the green ring over the decoder and rotate it by hand. 6. Return your scissors and glue stick to the bin and put all scraps of paper in the recycle bin. How to use your decoder ring: 1. Transcribe the DNA into mRNA. Remember for transcribing DNA into mRNA… C transcribes to G G transcribes to C T transcribes to A A transcribes to U 2. Group the nucleotides into sets of three to form your mRNA codons. You can do this by drawing a line between each group. 3. You will now use the decoder ring to find the amino acid that the codon represents. 4. Find the first letter of the codon in the inner circle. 5. From that letter, find the second letter of the codon in the second circle. 6. Spin the ring around until the “3rd position” points to the third letter of the codon. 7. You will now see the letter that represents the amino acid for that codon in the “amino acid” window. 8. Remember that the word “stop” means that this is a stop codon and signals the end of the message. PRACTICE: 1. DNA: G A T T A G A A G C T C A C T mRNA:__________________________ message: _______________________ 2. DNA: G T G T A G T G C G T A C T T G C T C T C A C T mRNA: ________________________________________ message :____________________________________ PART 2:Decipher the coded messages 1. DNA: TAAACGCGTGCTTCCATGTACATAGGCCGAGCTCTCTTATGAAGGCTGTTACGGATT mRNA: ________________________________________________________ message: ______________________________________________________ 2. DNA: CCCCTCTTACTTTGATATACGAGGACACGTTTGAGTCTCCTTTACGTACGGGCTCTAACT mRNA:____________________________________________________________________ message: __________________________________________________________________ PART 3: DNA Crossword Puzzle Transcribe each DNA code into mRNA and then decode it with your decoder ring to find the answer for each answer in the crossword puzzle. Part 4: Create your own coded message. Message: _________________________________________________________________________ mRNA: ___________________________________________________________________________ DNA:_____________________________________________________________________________ #13 Name________________________ Mutations andDate ___________ Core ______ RNA Decoder Ring Part 2 Part 1: Mutation Power Point and Notes Mutation- ________________________________________________________________________ Can be __________________ or passed from the ____________(__) to the offspring. Can be __________________ from exposure to __________________, _________________, or some viruses or can result from a __________________ that occurs when DNA is being __________________. Gene Mutations: Point Mutuations- ___________________________________________________________ __________________________________________________________________ Substitution - ______ nucleotide is changed o Silent or_____________________ - the mutation _____________ _________ change the protein product. (THE CAT SaW THE DOG.) o _____________ - the mutation causes a ____________ in the protein product. (THE CAT SAW THE HOG or THE CAT SAT THE DOG) o Nonsense – the change causes a misplaced __________ ____________ to shorten the protein product. (THE CAT) Insertion – A nucleotide(s) is ______________ into the gene. (THE CAT SAW XFY THE DOG) Deletion – A nucleotide(s) is ______________________________________________. (THE SAW THE DOG) Frameshift Mutation – changes in the DNA that ___________________________________ ______________________________________________________ *The _____________ ____________ is the order of the codons. Insertion – extra nucleotide(s) ____________________________________________. (THE DCA TSA WTH EDO G) Deletion - ______________ nucleotide(s) shift the reading frame. (THE CAT SWT HED OG) Chromosome Mutations - __________________________________________________________ _________________________________________________________ Original Chromosome ABC*DEF Deletion AB*DEF Duplication ABBC*DEF Inversion AED*CBF Translocation ABC*JKL Lethal Mutation – a mutation that ______________________________________________________ Results of mutations: Neutral (_______________ or __________________) ________________ (Down Syndrome or Sickle Cell Anemia) Helpful (______________________ or ____________________________) Part 2: RNA Decoder Ring Activities Use your RNA Decoder Ring to decode each of the following mutations examples. Then answer each question related to that example. 1. Original DNA: DNA: T G A G T G T A AA G C T A G A G T T A C A T G A A C T A AAA G C T C A C T mRNA: ___________________________________________________________________ message:__________________________________________________________________ 2. Mutation #1: DNA: T G A G T G T A AA G A T A G A G T T A C A T G A A C T A AAA G C T C A C T mRNA: ___________________________________________________________________ message:___________________________________________________________________ A. Compare the DNA sequence to the original and circle the single nucleotide mutation that occurred. B. What effect did this mutation have on the message or protein? ____________________________ C. What type of mutation occurred? Point or Frameshift? ___________________________________ D. What specific type of mutation occurred? _____________________________________________ 3. Mutation #2: DNA: T G A G T G T A AA G C T A G A G T T A C A T G A C C T A AAA G C T C A C T mRNA: __________________________________________________________________ message:__________________________________________________________________ A. Compare the DNA sequence to the original and circle the single nucleotide mutation that occurred. B. What effect did this mutation have on the message or protein? ____________________________ C. What type of mutation occurred? Point or Frameshift? ___________________________________ D. What specific type of mutation occurred? _____________________________________________ 4. Mutation #3 DNA: T G A G T G T A AA G C T A G A G T T A C A T T A A C T A AAA G C T C A C T mRNA: __________________________________________________________________ message:__________________________________________________________________ A. Compare the DNA sequence to the original and circle the single nucleotide mutation that occurred. B. What effect did this mutation have on the message or protein? ____________________________ C. What type of mutation occurred? Point or Frameshift? ___________________________________ D. What specific type of mutation occurred? _____________________________________________ 5. Mutation #4 DNA: T G A G T G T A AA G C T A G A G T A T A C A T G A A C T A AAA G C T C A C T mRNA: ___________________________________________________________________ message:___________________________________________________________________ A. Compare the DNA sequence to the original and circle the single nucleotide mutation that occurred. B. What effect did this mutation have on the message or protein? ____________________________ C. What type of mutation occurred? Point or Frameshift? ___________________________________ D. What specific type of mutation occurred? _____________________________________________ 6. Which of the mutations above do you believe might be lethal mutations? Why?________________ ______________________________________________________________________________