1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 ONLINE RESOURCE Molecular and biochemical identification of inositol 1,3,4,5,6-pentakisphosphate 2-kinase encoding mRNA variants in castor bean (Ricinus communis L.) seeds, Planta, Jaeju Yu, Adolfo Saiardi, John S. Greenwood* and J. Derek Bewley * Corresponding author: Department of Molecular and Cellular Biology University of Guelph, Guelph, Ontario, N1G 2W1 Canada E-mail: jgreenwo@uoguelph.ca 1 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 Online Resource 1. A list of synthesized primer sequences described in the text of this study. Underlined regions indicate restriction enzyme sites or histidine encoding sequences. 2 Name Oligonucleotide sequence (5’-3’) and Description 50F CTAGATCATATGGAGGTCAAATTAGAGAAAAAGG 51R TAATTTCTCGAGCAAGCAAACGTCGCATCTC Amplification and cloning RcIPK1 cDNA with restriction enzyme sites, NdeI and XhoI 57F TAATACGACTCACTATAGGGG 58R CTAGTTATTGCTCAGCGG Sequencing inserts cloned in pET-22b(+) vector Sac67F ACGTGAGCTCATGGAGGTCAAATTAGAGAAAAAGG Not73R555 ACGTGCGGCCGCCTACAAGCAAACGTCGCATCTCTG Amplification and cloning DS46 RcIPK1 variant with restriction enzyme sites, SacI and NotI Sac67F ACGTGAGCTCATGGAGGTCAAATTAGAGAAAAAGG Not72R452 ACGTGCGGCCGCCTATATAGTTTCACAAACCTCCATATTCTC Amplification and cloning DB39 RcIPK1 variant with restriction enzyme sites, SacI and NotI Sac67F ACGTGAGCTCATGGAGGTCAAATTAGAGAAAAAGG Not71R450 ACGTGCGGCCGCTTATTTATTGCTCTCCATATTCTCGTTG Amplification and cloning AB56 RcIPK1 variant with restriction enzyme sites, SacI and NotI 3 Sac67F ACGTGAGCTCATGGAGGTCAAATTAGAGAAAAAGG Not70R277 ACGTGCGGCCGCTCATCTGCCTGGATAAATCCC Amplification and cloning DB37 RcIPK1 variant with restriction enzyme sites, SacI and NotI Sac67F ACGTGAGCTCATGGAGGTCAAATTAGAGAAAAAGG Not69R224 ACGTGCGGCCGCTCAATGCATCTTCAAAACCTTGTC Amplification and cloning AS14 RcIPK1 variant with restriction enzyme sites, SacI and NotI Sac67F ACGTGAGCTCATGGAGGTCAAATTAGAGAAAAAGG Not68R215 ACGTGCGGCCGCTCATATTGGCTTACCTCCGATG Amplification and cloning AB55 RcIPK1 variant with restriction enzyme sites, SacI and NotI Sac67F ACGTGAGCTCATGGAGGTCAAATTAGAGAAAAAGG Not73R555His ACGTGCGGCCGCCTAGTGGTGGTGGTGGTGGTGCAAGCAAACGTCGCATCTCTG Amplification and cloning DS46 RcIPK1 variant with restriction enzyme sites, SacI and NotI and 6 histidine encoding sequences 80 81 82 83 84 85 86 87 88 89 4 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 ONLINE RESOURCE Molecular and biochemical identification of inositol 1,3,4,5,6-pentakisphosphate 2-kinase encoding mRNA variants in castor bean (Ricinus communis L.) seeds, Planta, Jaeju Yu, Adolfo Saiardi, John S. Greenwood* and J. Derek Bewley * Corresponding author: Department of Molecular and Cellular Biology University of Guelph, Guelph, Ontario, N1G 2W1 Canada E-mail: jgreenwo@uoguelph.ca 5 130 131 132 133 134 135 Online Resource 2. Multiple sequence alignment of RcIPK1 genes. Following sequencing analysis, the corresponding cDNA sequences from AB (3, 10, 55, and 56), CB (24, 25, 27, and 31), DB (33, 37, 39, and 40), AS (14, 17, 22, and 80), DS (46, 50, 52, and 106) were aligned and grouped. Six mRNA sequences representative of each group, RcIPK1A: the RcIPK1 genomic DNA sequence (NCBI accession number: NW_002994277.1), and RcIPK1B: the RcIPK1 mRNA sequence (NCBI accesssion number: XM_002510379.1) were aligned using DNAMAN 4.1.1.1 software (Lynnon Biosoft). Eleven exons are indicated by nucleotides in bold. Retained introns, deleted exons and nucleotides inserted into exons are represented by underlining, dashed spaces, and circles, respectively. Different sequences are in lower case letters. Each termination codon is indicated by boxes. 6 136 7 137 8 138 9 139 10 140 11 141 12 142 13 143 14 144 15