2-oxoglutarate enhances NtcA binding activity to promoter regions of the
microcystin synthesis gene cluster
Taís M. Kuniyoshi (a), Andres Gonzalez (a), Sara Lopez-Gomollon (a), Ana Valladares (b), M.
Teresa Bes (a), Maria F. Fillat (a), M. Luisa Peleato (a)
(a) Departamento de Bioquímica y Biología Molecular y Celular, Facultad de Ciencias and BIFI,
Unidad Asociada Rocasolano (CSIC), Universidad de Zaragoza, Pedro Cerbuna 12, 50009Zaragoza, Spain
(b) Instituto de Bioquímica Vegetal y Fotosintesis and Universidad de Sevilla, Consejo Superior
de Investigaciones Científicas. E-41092 Sevilla, Spain
Abstract
The binding affinity of NtcA towards promoter regions of the microcystin gene cluster from
Microcystis aeruginosa PCC 7806 has been analyzed by band-shift assay (EMSA). The key
nitrogen transcriptional regulator exhibits affinity for two fragments of the bidirectional
mcyDA promoter, as well as for promoter regions of mcyE and mcyH. The presence of 2oxoglutarate increased by 2.5 fold the affinity of NtcA for the mcyA promoter region. The 2oxoglutarate effect peaked at 0.8 mM, a physiological concentration for this compound under
nitrogen-limiting conditions. The results suggest that the 2-oxoglutarate level, as a signal of the
C to N balance of the cells, regulates the microcystin gene cluster.
Highlights
► New putative NtcA boxes identified in mcy promoters (Microcystis aeruginosa PCC7806). ►
2-oxoglutartate increased the affinity of NtcA for the mcyA promoter region. ► Data suggest
that NtcA acts in this case as a repressor of microcystin synthesis. ► Data suggest that
microcystin synthesis is regulated responding to the C/N balance.
Keywords
Microcystin; Microcystis; mcy operon; NtcA; 2-oxoglutarate
1. Introduction
Microcystins (MC) are the most frequently reported cyanotoxin class to cause outbreaks of
mass poisoning [1] and [2]. MCs are cyclic heptapeptides produced nonribosomally by
microcystin synthetases [3]. In Microcystis aeruginosa PCC 7806, genes of microcystin
synthetase have been identified and sequenced [4]. This is a 55-kb gene cluster consisting of
10 open reading frames bidirectionally transcribed from a central promoter of 732-bp located
in an intergenic region between mcyA and mcyD. Two transcriptional start sites (tsp) for the
bidirectional promoter region have been identified and appear to be dependent on light
conditions [5]. However, other start sites have been detected for mcyA and mcyD [6] and [7].
Putative internal promoters have also been determined for the genes mcyE, mcyF, mcyG,
mcyH, mcyI and mcyJ employing RACE [5].
1
The environmental and nutritional factors involved in the expansion of harmful algal blooms in
surface waters have remained largely unresolved. Multiple laboratory culture or field sample
studies have shown conflicting results in relation to the effects of several nutrients or physical
factors. For instance, published results concerning phosphorus [8] and [9] nitrogen [10] and
[11] and iron [12] and [13] in microcystin synthesis are frequently contradictory. Recent
findings using molecular methods have indicated that Fur, the Ferric uptake regulator from
Microcystis aeruginosa PCC 7806 binds in vitro promoter regions of genes of the mcy operon
[14] and that in batch cultures, iron starvation conditions result in both mcyD transcription and
an increase in microcystin synthesis [6]. NtcA, a key regulator for nitrogen metabolism control
in cyanobacteria, exhibits binding activity to the bidirectional promoter mcyDA [15] and [16].
In apparent contradiction, under laboratory conditions, nitrogen availability correlated
positively with M. aeruginosa growth rate without increasing the mcyD transcription and MC
production per cell [7].
Many studies have shown the key role of the master regulator NtcA in the regulation of genes
involved in nitrogen metabolism, carbon metabolism, photosynthesis and stress response,
performing as an activator and also as a repressor [17], [18], [19] and [20]. NtcA has a Cterminal binding DNA domain helix-turn-helix which interacts with a palindromic sequence
signature GTAN8TAC [21] or TGTN9 or 10ACA [22]. It has been suggested that NtcA activates
promoters carrying a vegetative-type sigma factor (SigA), similar to the -10 box TAN3T E. coli σ
70[20] and a consensus GTAN8TAC variably located between 20 and 24 bp upstream from the 10 hexamer [20]. In Synechocystis sp. PCC 6803, NtcA represses gifA and gifB expression and
the NtcA-binding site is located closer to the tsp than in the case of NtcA activated promoters
[23]. It has been suggested that the position of the NtcA binding site related to tsp determines
the NtcA repressor or activator action [22]. A number of NtcA dependent promoters have also
been described which do not match the canonical NtcA-activated structure, and it has been
suggested that another factor is required to stimulate the gene expression [20] and [24]. The
signalling function of 2-oxoglutarate (2-OG) has been observed in Anabaena PCC 7120 and
Synechococcus elongatus PCC 7942 performing as a positive effector of NtcA binding activity
[26] and [27]. Tanigawa et al [25] found that in Synechococcus the binding of NtcA to glnA and
nctA promoters in vitro was enhanced by 2-oxoglutarate, and they described that 2oxoglutarate was required for transcriptional initiation meditated by NtcA (25). 2-Oxoglutarate
levels in cyanobacteria are directly related to nitrogen availability in relation to the carbon
metabolism and they provide feedback information to the cells of the status of the C/N
balance. Analysis of the crystal structure of the complex 2-OG and NtcA from Anabaena sp. has
revealed that the presence of this metabolite enhances the DNA-binding activity of NtcA due
to the fact that the complex conformation is more suitable for recognizing successive DNA
major grooves [28].
Here we report new checkpoints in the mcy cluster from M. aeruginosa PCC 7806 potentially
operated by NtcA. Furthermore, we report that the presence of 2-oxoglutarate enhances NtcA
binding activity in vitro suggesting that the nitrogen and carbon nutritional status in the
cyanobacteria may have an important role in microcystin synthesis.
2. Materials and methods
2.1. Strains and culture conditions
2
This study was carried out with M. aeruginosa PCC 7806 provided by the Pasteur Culture
Collection. Cells were photoautotrophically grown in a BG110 medium supplemented with 2
mM of NaNO3 and 10 mM of NaHCO3, as described previously by Rippka et al. (1988), and as
recommended by the Pasteur Institute [29]. The culture medium was air bubbled at 25 to 30°C
with continuous illumination (25 μmol of photon m-2 s-1).
2.2. DNA extraction and promoter region amplification
Total DNA from M. aeruginosa PCC 7806 was isolated using 0.03 g of dry weight culture as
described previously [30]. The amplification of mcy promoters was performed using primers
listed in Table 1, based on the mcy operon sequence published by Tillet et al. [4]. PCR products
were purified using GFXTM PCR DNA Kit (GE Healthcare). As non specific competitor DNA, a
224 bp DNA fragment of the fourth exon of the human apoE gene and the promoter region of
the Anabaena sp. PCC 7120 flavodoxin gene isiB were used as described previously [19].
2.3. Protein–DNA gel retardation assays
Binding assays were performed using a core binding buffer containing 12 mM HEPES–NaOH
(pH 8), 4 mM Tris–HCl pH 8, 60 mM KCl, 1 mM dithiothreitol, 50 μg μl−1 of bovine serum
albumin, and 8% glycerol as described by Vazquez-Bermudez et al. [26]. A mixture of 40 ng of
each DNA fragment and different concentrations of Anabaena PCC 7120 recombinant NtcA
(from 125 nM to 500 nM) were incubated at room temperature for 30 min and subsequently
loaded on a non-denaturing polyacrylamide gel (3.75% to 5%). MgCl2 and 2-oxoglutarate were
added when indicated. The gel was developed using as running buffer 25 mM Tris-Cl pH 8, 190
mM of glycine and 13 V.cm-1. To demonstrate the specificity of the DNA-binding activity of the
proteins to the promoters, reactions were performed in the presence of an equal
concentration of non-specific competitor DNA. Gels were stained with SYBR Safe DNA
(Invitrogen). We evaluated binding activity by estimating the unbound DNA remaining in each
sample. Free DNA was taken as reference, assigning arbitrarily a value of 100% (Gel Doc 2000
Image Analyser from BioRad). For estimation of Kd (app), unbound DNA percentage data were
used as described previously [14] and [19]. NtcA from Anabaena sp. PCC7120 was obtained as
described in [31].
3. Results
3.1. Identification of NtcA-binding sites
In previous studies, two palindromic partially overlapping signature sequences TGTN9 or
10ACA and GTAN8TAC were described as the consensus NtcA binding site [20] and [22]. Using
biocomputational approaches, several sequences with high homology to the NtcA consensus
were found in the mcy operon intergenic region. Fig 1A shows additional putative NtcA-target
sites to those previously described [16]. In the case of mcyA promoter, multiple NtcA boxes
were found at flanking regions of tsp. Recent data, as result of cyanobacteria genome
comparisons and NtcA affinity assays revealed that the nucleotides “GT” of the first triplets
and “AC” from the second are more important for NtcA binding [32] and [33]. In Fig 1A we
identify these nucleotides in the NtcA boxes. In Fig 1B, other putative NtcA boxes are identified
in silico in mcyE and mcyH promoters. The NtcA binding site was also located in mcyG and
mcyJ (data not shown).
3
3.2. NtcA binds several mcy promoters with high affinity
Once the NtcA boxes were identified in silico, band-shift assays (EMSA) were carried out using
recombinant NtcA protein from Anabaena sp. PCC 7120 (with 67% similarity to the NtcA from
M. aeruginosa PCC 7806), and several DNA probes of mcy promoters. Since EMSA is not
recommended for fragments over 500 bp, the bidirectional mcyAD promoter was divided into
two fragments, a 438 bp mcyA upstream sequence and a 331 bp mcyD gene upstream
sequence. Fig 2A shows the bands shifts obtained with the 438 bp fragment using increasing
NtcA concentrations, while Fig 2C shows the activity of NtcA using the 331 bp fragment. DNAbinding activity of NtcA was also assayed using the complete promoter regions of mcyE, mcyG,
mcyH and mcyJ genes (data not shown) and only promoter regions of mcyE (Fig 3) and mcyH
(data not shown) showed affinity for the protein. In the case of the mcyE upstream region (203
bp), strong DNA-binding activity of NtcA was found using 200 nM of NtcA. The complexes were
similar in the presence and absence of 4 mM of MgCl2 (Fig 3). The presence of Mg2+ did not
appear to affect binding activity.
3.3. 2-oxoglutarate enhances NtcA binding activity to mcy promoters
The metabolite 2-oxoglutarate (2-OG) is the carbon skeleton for the assimilation of nitrogen in
cyanobacteria, and it has been reported that 2-OG is a signalling molecule of nitrogen
starvation, which could act as an effector on NtcA-dependent transcription activation [25], [26]
and [27]. When 2-OG was present in the binding assays, NtcA exhibited enhanced affinity for
pmcyA (Fig 2A). We evaluated the EMSA by estimating the unbound DNA remaining in each
sample (Fig 2B). Free DNA was taken as reference, assigning arbitrarily a value of 100%, and
the obtained values should be considered only as indicative. The apparent Kd of the NtcA-DNA
complex was calculated in the presence (Kd 0.625μM) and absence (Kd 0.354 μM) of 2oxoglutarate. The effect of 0.6 mM 2-OG stimulated the binding activity of NtcA by two and a
half times more than that obtained in the absence of this metabolite (Fig 2B). In order to
characterize the effect of 2-OG, the influence of several concentrations of 2-OG was tested on
the binding affinity of NtcA to the 448 bp mcyA upstream fragment. The data are shown in Fig
4. The 2-oxoglutarate effects peaked at about 0.6-0.8 mM, a physiological concentration for
this compound.
4. Discussion
In the present work, we have located other putative NtcA binding sites in the intergenic region
of mcy operon in addition to that described previously [16] as well as some boxes included in
the internal promoter regions of the mcy gene cluster. Multiple NtcA boxes have also been
described in Anabaena sp. PCC 7120 [22] and S. elongates[21] which display a complex
regulation of NtcA affinity dependent on the binding site position with respect to tsp. EMSA
gave positive results in the case of the promoter regions of mcyA, mcyD, mcyE and mcyH, cited
in decreasing order of affinity.
Our results indicate that the binding of NtcA to the mcyA upstream region is enhanced in the
presence of 2-OG. The latter compound is a commonly accepted key indicator of the
carbon/nitrogen balance in the cell, suggesting that microcystin synthesis responds to the
equilibrium between both metabolisms [34]. In Synechococcus, 2-OG acts as a positive effector
of the NtcA binding to the glnA promoter, with an observed five-fold increase in the EMSA
[26]. Studies related to the optimum 2-OG concentration in vitro in NtcA binding experiments
4
have revealed different results [25], [26] and [27]. In Anabaena sp. PCC 7120, the binding of
both promoters of nctA and glnA was enhanced with increasing concentrations of 2-OG, being
obtained a maximal effect at 5 mM [27]. However, in glnA promoter from Synechococcus sp.,
NtcA binding activity was more effective at 0.6 mM of 2-OG, and at higher levels of this
metabolite a decrease in the electrophoretic retardation was observed [26]. This order of
magnitude coincides with our results. The accumulation of 2-OG acts as a nitrogen starvation
signal and therefore it is possible that with a specific C/N ratio in cyanobacteria there would be
a maximum NtcA activity state for each promoter. Consistent with this notion, the binding of
NtcA to pmcyA has a maximal enhancement at 0.8 mM of 2-OG and a lower stimulation was
observed at increasing concentrations of this effector. Crystal structure studies of the NtcA
apoform and 2-OG-NtcA complex indicate that the presence of this metabolite is not essential
to the DNA-binding capacity of this regulator [28], which could have interesting physiological
implications. The complex NtcA/2-OG does not have an off-to-on state, but subtle changes in
the distance between the two F-helices for DNA recognition due to the presence of 2-OG
results in a stronger DNA-binding activity of NtcA [28]. Thus, NtcA could bind the mcyA gene
and the complex with 2-OG would enhance its activity in a specific state of nitrogen
deprivation. The data strongly suggest that MC synthesis depends on the C/N status sensed by
2-OG.
Master regulator NtcA has been described acting both as an activator and also as a repressor
[17], [18], [19] and [20]. If bound NtcA activates transcription, a deficit of nitrogen should
induce microcystin synthesis since an imbalance of C/N, signalled by increased levels of 2-OG,
can increase its affinity. This would be a bizarre physiological response, since microcystin
synthesis needs a considerable amount of the scarce nitrogen. Previous experimental data
from our group shows that nitrogen availability in itself does not induce changes in mcyD
transcription or in microcystin level in M. aeruginosa cells [18]. It is also worth noting the
proximity of some of the putative NtcA boxes to the start sites. NtcA-binding sites in repressed
promoters usually overlap with -35 or -10 boxes, or even with the tsps, and bound NtcA blocks
the access of the RNA polymerase to the promoter [34]. This suggests that in our case NtcA
can repress the mcyA gene as described in the case of rbcL in Anabaena sp. [22] and gifA and
gifB in Synechocystis sp. [23].
All the data taken together suggest that NtcA acts in this case as a repressor of microcystin
synthesis, responding to the C/N balance. Indeed, the microcystin synthesis undoubtedly
involves different nutritional and environmental factors, sensed by different transcriptional
factors, and at the very least NtcA and Fur [14] are involved in the microcystin gene cluster
regulation.
Acknowledgements
This work was funded by the Spanish Ministry of Education and Science (BFU2006-03454 and
BFU2009-07424).
5
References
[1 ]F.A. Dörr, E. Pinto, R.M. Soares, S.M. Feliciano de Oliveira e Azevedo
Microcystins in South American aquatic ecosystems: Occurrence, toxicity and toxicological
assays
Toxicon, 56 (2010), pp. 1247–1256
[2] J. Meriluoto
Chapter 11B Toxins of freshwater cyanobacteria (blue-green algae)
J.B. Maciej (Ed.), Handbook of Analytical Separations, Elsevier Science B.V (2000), pp. 359–390
[3] M.A. Marahiel, T. Stachelhaus, H.D. Mootz
Modular Peptide Synthetases Involved in Nonribosomal Peptide Synthesis
Chemical Reviews, 97 (1997), pp. 2651–2674
[4] D. Tillett, E. Dittmann, M. Erhard, H. von Dohren, T. Borner, B.A. Neilan
Structural organization of microcystin biosynthesis in Microcystis aeruginosa PCC7806: an
integrated peptide-polyketide synthetase system
Chem Biol, 7 (2000), pp. 753–764
[5] M. Kaebernick, E. Dittmann, T. Borner, B.A. Neilan
Multiple alternate transcripts direct the biosynthesis of microcystin, a cyanobacterial
nonribosomal peptide
Appl Environ Microbiol, 68 (2002), pp. 449–455
[6] E. Sevilla, B. Martin-Luna, L. Vela, M.T. Bes, M.F. Fillat, M.L. Peleato
Iron availability affects mcyD expression and microcystin-LR synthesis in Microcystis
aeruginosa PCC7806
Environ Microbiol, 10 (2008), pp. 2476–2483
[7] E. Sevilla, B. Martin-Luna, L. Vela, M.T. Bes, M.L. Peleato, M.F. Fillat
Microcystin-LR synthesis as response to nitrogen: transcriptional analysis of the mcyD gene in
Microcystis aeruginosa PCC7806
Ecotoxicology, 19 (2010), pp. 1167–1173
[8] H.M. Oh, S.J. Lee, M.H. Jang, B.D. Yoon
Microcystin production by Microcystis aeruginosa in a phosphorus-limited chemostat
Appl Environ Microbiol, 66 (2000), pp. 176–179
6
[9] C. Vezie, J. Rapala, J. Vaitomaa, J. Seitsonen, K. Sivonen
Effect of nitrogen and phosphorus on growth of toxic and nontoxic Microcystis strains and on
intracellular microcystin concentrations
Microb Ecol, 43 (2002), pp. 443–454
[10] M.F. Watanabe, S. Oishi
Effects of environmental factors on toxicity of a cyanobacterium (Microcystis aeruginosa)
under culture conditions
Appl Environ Microbiol, 49 (1985), pp. 1342–1344
[11] B.M. Long, G.J. Jones, P.T. Orr
Cellular microcystin content in N-limited Microcystis aeruginosa can be predicted from growth
rate
Appl Environ Microbiol, 67 (2001), pp. 278–283
[12] H. Utkilen, N. Gjolme
Iron-stimulated toxin production in Microcystis aeruginosa
Appl Environ Microbiol, 61 (1995), pp. 797–800
[13] M. Lukac, R. Aegerter
Influence of trace metals on growth and toxin production of Microcystis aeruginosa
Toxicon, 31 (1993), pp. 293–305
[14] B. Martin-Luna, E. Sevilla, J.A. Hernandez, M.T. Bes, M.F. Fillat, M.L. Peleato
Fur from Microcystis aeruginosa binds in vitro promoter regions of the microcystin
biosynthesis gene cluster
Phytochemistry, 67 (2006), pp. 876–881
[15] Kuniyoshi, T.M., Martín-Luna, B, Valladares, A., González, A., Sevilla, E., Bes, M.T., Peleato,
M.L. Fillat, M.F. (2009) NtcA reconoce promotores del operon mcy de Microcystis aeruginosa
PCC 7806, CIC 2009. Oporto.
[16] H.P. Ginn, L.A. Pearson, B.A. Neilan
NtcA from Microcystis aeruginosa PCC 7806 is autoregulatory and binds to the microcystin
promoter
Appl Environ Microbiol, 76 (2010), pp. 4362–4368
[17] J.E. Frías, A. Mérida, A. Herrero, J. Martin-Nieto, E. Flores
General distribution of the nitrogen control gene ntcA in cyanobacteria
7
J Bacteriol, 175 (1993), pp. 5710–5713
[18] F. Jiang, B. Mannervik, B. Bergman
Evidence for redox regulation of the transcription factor NtcA, acting both as an activator, a
repressor, in the cyanobacterium Anabaena PCC 7120
Biochem J, 327 (Pt 2) (1997), pp. 513–517
[19] S. Lopez-Gomollon, J.A. Hernandez, S. Pellicer, V.E. Angarica, M.L. Peleato, M.F. Fillat
Cross-talk between iron, nitrogen regulatory networks in Anabaena (Nostoc) sp. PCC 7120:
Identification of overlapping genes in FurA and NtcA regulons
J Mol Biol, 374 (2007), pp. 267–281
[20] A. Herrero, A.M. Muro-Pastor, E. Flores
Nitrogen control in cyanobacteria
J Bacteriol, 183 (2001), pp. 411–425
[21] I. Luque, E. Flores, A. Herrero
Molecular mechanism for the operation of nitrogen control in cyanobacteria
EMBO J, 13 (1994), p. 5794
[21] I. Luque, E. Flores, A. Herrero
Molecular mechanism for the operation of nitrogen control in cyanobacteria
EMBO J, 13 (1994), p. 5794
[22] T.S. Ramasubramanian, T.F. Wei, J.W. Golden
Two Anabaena sp. strain PCC 7120 DNA-binding factors interact with vegetative cell- and
heterocyst-specific genes
J Bacteriol, 176 (1994), pp. 1214–1223
[23] M. Garcia-Dominguez, J.C. Reyes, F.J. Florencio
NtcA represses transcription of gifA and gifB, genes that encode inhibitors of glutamine
synthetase type I from Synechocystis sp. PCC 6803
Mol Microbiol, 35 (2000), pp. 1192–1201
[24] T.C. Huang, R.F. Lin, M.K. Chu, H.M. Chen
Organization and expression of nitrogen-fixation genes in the aerobic nitrogen-fixing
unicellular cyanobacterium Synechococcus sp. strain RF-1
Microbiology, 145 (Pt 3) (1999), pp. 743–753
8
[25] R. Tanigawa, M. Shirokane, S.I. Maeda, T. Omata, K. Tanaka, H. Takahashi
Transcriptional activation of NtcA-dependent promoters of Synechococcus sp PCC7942 by 2oxoglutarate in vitro
PNAS, 99 (2002), pp. 4251–4255
[26] M.F. Vázquez-Bermúdez, A. Herrero, E. Flores
2-Oxoglutarate increases the binding affinity of the NtcA (nitrogen control) transcription factor
for the SynechococcusglnA promoter
FEBS Letters, 512 (2002), pp. 71–74
[27] S. Laurent, H. Chen, S. Bedu, F. Ziarelli, L. Peng, C.C. Zhang
Nonmetabolizable analogue of 2-oxoglutarate elicits heterocyst differentiation under
repressive conditions in Anabaena sp. PCC 7120
Proc Natl Acad Sci U S A, 102 (2005), pp. 9907–9912
[28] M.X. Zhao, Y.L. Jiang, Y.X. He, Y.F. Chen, Y.B. Teng, Y. Chen, C.C. Zhang, C.Z. Zhou
Structural basis for the allosteric control of the global transcription factor NtcA by the nitrogen
starvation signal 2-oxoglutarate
Proc Natl Acad Sci U S A, 107 (2010), pp. 12487–12492
[29] R. Rippka
Isolation and purification of cyanobacteria
Methods Enzymol, 167 (1988), pp. 3–27
[30] Beatriz. Martín, Jose A. Hernandez, Sara López, Luis Ángel Inda, M. Teresa Bes, María F.
Fillat, M. Luisa Peleato
Estudios de homología entre regiones del operón mcy de Microcystis aeruginosa PCC 7806 y
muestras procedentes de La Estanca de Alcañiz (Teruel)
Rev. Real Academia de Ciencias, 57 (2002), pp. 231–239
[31] A. Valladares, E. Flores, A. Herrero
Transcription activation by NtcA and 2-oxoglutarate of three genes involved in heterocyst
differentiation in the cyanobacterium Anabaena sp. strain PCC 7120
J Bacteriol, 190 (2008), pp. 6126–6133
[32] M.F. Vazquez-Bermudez, J. Paz-Yepes, A. Herrero, E. Flores
The NtcA-activated amt1 gene encodes a permease required for uptake of low concentrations
of ammonium in the cyanobacterium Synechococcus sp. PCC 7942
Microbiology, 148 (2002), pp. 861–869
9
[33] Z. Su, V. Olman, F. Mao, Y. Xu
Comparative genomics analysis of NtcA regulons in cyanobacteria: regulation of nitrogen
assimilation and its coupling to photosynthesis
Nucleic Acids Res, 33 (2005), pp. 5156–5171
[34] Herrero, A. and Flores, E. (2008) The cyanobacteria: Molecular Biology, Genetics and
Evolution, Caister Academic Press.
10
Figure captions
Figure 1. Additional putative NtcA binding sites identified in silico in mcy operon promoter
regions of M. aeruginosa PCC 7806. The previously described NtcA boxes [16] are indicated
underlined. Panel A shows the mcyD/A promoter region with bold boxes indicating the new
putative NtcA-binding sites. Tsps (bold) described by Kaebernick et al. [5] are marked as D1,
D2, A1 and A2 wile the described in preceding work of our group are indicated with an asterisk
[6] and [7]. The boxes in dotted line are not perfectly matched with the consensus. The
bidirectional promoter was fragmented in two sequences for EMSA and two arrows indicate
the cut of the fragments, 438 bp upstream mcyA and 331 bp upstream mcyD. Panel B shows
other identified putative NtcA-binding sites of internal promoters of mcy gene cluster.
Figure 2. NtcA-pmcyA/D binding assays. The EMSA were performed with NtcA from Anabaena
sp PCC 7120, with fragments of exon IV from the human apoE gene or isiB gene as non-specific
competitor DNA (pN370S in the figure). NtcA concentrations are expressed in nM. Panel A:
Lane 1: free 438 bp fragment upstream mcyA. Lanes 2, 3, 4 and 5, 438 bp fragment with NtcA
125 nM, 250 nM, 375 nM and 500 nM, respectively. Lanes 6, 7, 8, 9 and 10, NtcA 125 nM, 250
nM, 375 nM and 500 nM respectively, in the presence of 0.6 mM of 2-oxoglutarate (2-OG).
Panel B: graphical representation of the binding affinity of NtcA to the mcyA promoter in the
presence and absence of 2-OG. Data were calculated from gel in Panel A. Panel C: Left: Lane 1:
free 331 bp fragment upstream mcyD. Lane 2, 3 and 4 disappearance of the promoter in the
presence of NtcA 250, 375 and 500 nM. Right: band shift of the pmcyD in the presence of 500
nM NtcA.
Figure 3. Effect of MgCl2 on NtcA binding activity using pmcyE. Lane 1: free mcyE promoter.
Lane 2: pmcyE in the presence of 200 nM NtcA. Lane 3: pmcyE with 200 nM NtcA, in the
presence of 4 mM MgCl2.
Figure 4. Effect of different concentrations of 2-OG on NtcA- pmcyA binding assay. NtcA was
used 200 nM. Lane 1: free mcyA promoter. Lanes 2, 3, 4, 5 and 6 contain increasing amounts of
2-OG, namely 0.3, 0.4, 0.6, 0.8, 1 and 1.5 mM respectively.
11
Table 1
Table 1. Oligonucleotides used as primers for promoter amplification
Primer designation
Primer sequences (5´→3´)
Description
DA 438-N
GTGTGGCATCCTAAGCTCTG
Forward primer for cloning mcyA promoter
DA 438-C
CCAGATGTGCTTCCATTGCTG
Reverse primer for cloning mcyA promoter
DA 331-N
CATAGTGTTAGAATCGACTTGG
Forward primer for cloning mcyD promoter
DA 331-C
GAGCTTAGGATGCCACACCC
Reverse primer for cloning mcyD promoter
pmcyE-N
CTCTCAACCATGCCCTATTCTC
Forward primer for cloning mcyE promoter
pmcyE-C
CGGAGCTTGATCAATATGGAGGTT Reverse primer for cloning mcyE promoter
pmcyG-N
CCTCCAAGACTGATGGAATGC
Forward primer for cloning mcyG promoter
pmcyG-C
CCAAAAAGCCCTTGACCATCG
Reverse primer for cloning mcyG promoter
pmcyH-N
GGAGGAGAAACAGCATTCCC
Forward primer for cloning mcyH promoter
pmcyH-C
CAAGAACTTACTGATTTGGAGG
Reverse primer for cloning mcyH promoter
pmcyJ-N
CTGATCTTGCAAAAACGCCATT
Forward primer for cloning mcyJ promoter
pmcyJ-C
GATTAATCCGGAGGCGTGGA
Reverse primer for cloning mcyJ promoter
pisiB-N
CTTCTCTACGTTTGCGC
Forward primer for cloning IsiB promoter
pisiB-C
CATTATGACACCTGATCTTTAG
Reverse primer for cloning IsiB promoter
12
Figure 1
13
Figure 2
14
Figure 3
15
Figure 4
16