OPEN BOOK (NEB catalog only, no additional notes or internet access)
BIO 510 Mid-year Exam 2012 NAME (Please Print)___________________________
1( 20 pts)
The sequence of the SRF1 gene is presented below. You want to clone the 773 bp shaded region
of SRF1 into the EcoRV site of the Litmus 28i vector (page 336 NEB catalog). Describe all
steps needed to create this recombinant DNA construct. Assume that you start with one
microgram of the Litmus 28i vector and 10 nanograms of the DNA presented below. Assume
that you have access to any reagents, materials, and machinery that you need. The only
exception is that you cannot propose to chemically (that is, non-enzymatically) synthesize the
entire SRF1 gene.
Full credit requires that:
a) only the desired shagged sequence is inserted without any additional sequence into the
existing EcoRV site of the Litmus 28i.
b) the desired clone has the insert oriented such that the insert’s BamHI site (bold & underlined
below) is located closest to the Litmus 28i vector BamHI site and furthest from the Litmus 28i
vector’s EcoRI site. Be sure to tell how you will confirm the correct orientation.
Discuss in detail every enzymatic step required to accomplish this cloning, you must
1) State which specific enzymes you would use for each step, name the buffers, tell the
temperature and length of incubations, etc.
2) Describe any cleanup steps needed after one step is completed before the next step is initiated.
3) If PCR is to be done, write out in full the oligonucleotide sequences to be used for PCR and be
sure to mark the 5’-3’ polarity of each.
You need not discuss E. coli competent cell preparation, E. coli transformation, or any
subsequent plasmid “mini-prep” DNA isolation to recover the putative recombinant molecules.
However, you must say how you will determine whether or not you have the insert cloned in the
correct orientation.
SRF1
AAAAGTTGGTTTTGGGCAGATCAAAAAACTACGGGCAAAGATGTTGGTGGGGCAGCAGTA
TCATCCATGTCAGGGTGCCCAGTCATGCACGAGTCGTCGTCGTCGTCGCCACCATCCTCT
GAGTGCCCCGTTATGCAGGGAGATAACGATAGAATAAACCCGCTGAACAATATGCCGGAG
TTGGCAGCATCCAAACAGCCTGGCCAAAAGATGGACTTGCCCGTTGATCGGACCATCTCC
AGCATCCCCAAGAGTCCAGACAGTAACGAGTTCTGGGAGTATCCTTCTCCACAACAGATG
TACAATGCTATGGTTAGAAAGGGCAAGATTGGCGGTAGCGGCGAAGTCGCCGAAGATGCA
GTGGAGTCCATGGTGCAGGTCCACAACTTTCTAAATGAAGGGTGCTGGCAGGAAGTGCTC
GAATGGGAAAAACCGCACACAGATGAAAGCCACGTGCAGCCTAAGTTGCTGAAATTCATG
GGGAAACCGGGCGTATTGAGCCCTCGTGCTCGCTGGATGCACCTGTGCGGCCTACTGTTT
CCGTCCCATTTTAGCCAAGAACTACCATTCGACAGGCACGACTGGATTGTACTCCGAGGC
GAGCGCAAAGCGGAACAACAACCTCCAACCTTCAAGGAAGTTAGATACGTCTTGGATTTC
TACGGAGGGCCCGACGACGAAAACGGAATGCCTACTTTCCACGTGGATGTCCGTCCTGCC
CTAGATAGTCTAGACAATGCTAAGGACCGGATGACCCGTTTCTTGGACCGGATGATCTCG
GGTCCGGATCCCTCTTCGTCCTCCGCCCCTTAA (NOTE: BAMHI site is bold, primer
Sequences are underlined with the reverse primer being the
complement of the sequence here)
Simplified answer key (minus the buffer selection, times of incubation that you included).
This question is similar to question 1 of last year’s exam and related to our PCR lab
exercise as well as our cloning lab exercise & assigned reading.
- The easiest way to do this cloning is to first amplify the desired sequence by PCR. Use the
forward primer: 5’ ATGTTGGTGGGGCAGCAGTA 3’ and the reverse primer 5’
TTAAGGGGCGGAGGACGAA 3’ (which is the opposite orientation of the end of the gene).
- If you use Taq polymerase, then you need to get rid of the additional non-encoded “dA” that
Taq places at the 3’ end of DNA using mung bean nuclease or an equivalent activity(you do not
need to do this with the Phusion DNA polymerase) .
- Gel purify the PCR product & then phosphorylate the 5’ ends of the PCR product using ATP
and polynucleotide kinase.
- Cut the vector of EcoRV and the dephosphorylate with shimp alkaline phosphatase.
- Ligate the vector + insert with T4 DNA ligase & transform E. coli
- Check the orientation of recombinant plasmids by cutting with BamHI which essentially
linearizes the DNA when in the correct orientation but excises the insert when placed in the
opposite orientation
2. (6 pts)
i) From the lecture notes on the cutting of superhelical DNA and NEB catalog. You have
only one unit of restriction enzyme, one microgram of supercoiled plasmid DNA isolated from
E. coli, and one hour to complete the enzymatic reaction. Which of the following enzymes will
be your first choice to achieve 100% cleavage? AseI – cuts most efficiently supercoiled DNA,
see NEB page 310
ii) From the lecture notes on the use of exonuclease III and NEB catalog Cleavage by which
of the following enzymes produce efficient substrates for exonuclease III? B) EcoRI, C) SmaI,
(circle all correct answers) The other enzymes leave 3’ extensions.
iii) C From the lecture notes on the cleavage patterns of restriction endonucleases and the
use of the singles strand specific mung bean nuclease. Cleavage by which of the following
enzymes produce efficient substrates for mung bean nuclease? A) KpnI, B) EcoRI, D) PstI, or
E) ApaI (circle all correct answers)
CLOSED BOOK
BIO 510 Mid-year Exam 2012 NAME (Please Print)___________________________
1. (2 pts) Radiation safety lecture. Which of the following would likely increase your yearly
radiation exposure (circle all that apply):
a) frequent transcontinental air airline flights,
2. (10 pts) Lab exercises and lecture notes; similar to question 3 from last year’s exam.
Which of the following would be useful for (put letter alongside protein or process): 1)
purification of DNA A 2) creation of unidirectional DNA deletions with Exonuclease III D, 3)
use of EcoRI methylase C, 4) suppressing background in your northern blot hybridization, B 5)
use of E. coli DNA ligase E
A)
B)
C)
D)
1)
2)
3)
4)
E.
3. (4 pts) From lab demonstration, assigned reading and discussions. We did an in-class
comparison of linear and supercoiled DNA resolved under different salt conditions. We found
that ds linear DNA rather (slower) in 1/3 X TAE compared with 3X TAE (that is, low salt
compare to high salt). Supercoiled DNA behaved differently than the linear DNA in this assay.
Describe how the relative mobility of supercoiled DNA vs linear DNA changed when the
samples were resolved in 1/3 X TAE vs 3X TAE. In 3X TAE the supercoiled ran
disproportionately faster than the linear DNA.
4. (10 pts) From lab exercises, assigned reading and lecture discussions; similar to question
5 in last year’s exam. Describe in detail the substrate and reaction products of each enzyme:
a. McrA nuclease CpG methylated DNA is cleaved into DNA fragments
b. T4 DNA ligase – double stranded DNA (or RNA) with directly abutting 5’ phosphate
& 3’ hydroxyl (either blunt ended or with compatible sticky ends); seals the
phosphodiester bond using ATP co-factor
c. DNA gyrase – Uses ATP to introduce negative supercoils to counteract the positive
supercoils generated during replication (for example)
d. DICER nuclease –Cleaves long double stranded RNAs into ~22-24 bp dsRNA
fragments one strand of which is subsequently loaded into the RISC complex
e. RNase H substrate RNA/DNA hybrid; cleaves RNA and to leave intact ssDNA +
ssRNA fragments
f. β - lactamase – substrate is ampicillin; cleaves β-lactam ring to inactivate the
antibiotic
g. β-galactosidase – natural substrate is lactose which is cleaved to glucose + galactose;
we used X-gal which, when cleaved & oxidized, forms a blue precipitate
h. Terminal deoxynucleotide transferase – adds non-encoded nucleotides to the 3’ end
of ss or ds DNA
i. Bal31 nuclease ds exonuclease which leaves a mixture of blunt and staggered ends;
also can act as a single stranded endonuclease on DNA and RNA
j. M13K07-encoded DNA polymerase binds the ds replicative form of its own virion or
a plasmid bearing a compatible viral DNA replication origin to produce ssDNA.
5. (5 pts) From lab exercises and recommend reading. Outline all steps needed to
successfully complete a plasmid shuffle experiment in yeast to score for gene function. Be sure
to describe any genetic mutations and marker genes necessary for the experiment. You can use
the BIO 510 lab to illustrate this. Here we used a yeast host with 1) null chromosomal alleles of
ura3, trp1 and prp43; a plasmid version of wildtype PRP43 (marked with a functional URA3
gene), a second plasmid bearing a point mutant of prp43 to be tested for function (we used
H218A) and containing a second marker gene (we used TRP1). The double transformants are
first selected on medium lacking uracil and tryptophan (selection based on plasmid-encoded
URA3 and TRP1). Next the cultures are streaked on 5-FOA medium to score for growth of cells
that have spontaneously lost the functional URA3 gene (and with it, the wildtype PRP43 gene).
If colonies form on the 5-FOA medium (which kills any cells that contain URA3), the
prp43H218A mutant must be functional since it is the only source of Prp43 protein in these
cells. If no colonies form on the 5-FOA medium, the prp43H218A mutant is lethal.
6. (12 pts) From lab cloning exercise; similar to question 7 in last year’s exam. Given the
following hybridization data, determine the location and direction of transcription for each RNA
transcript. GIVEN: Assume that no more than one transcript is present in any interval defined
by two adjacent restriction sites (that is, HindIII to EcoRI, RcoRI to BamHI, BamHI to PstI and
PstI to KpnI) and that no transcripts extend into an adjacent fragment. Put an arrow head at the
3’ end of the transcript (5’ -> 3’) and be sure to indicate clearly by a solid line labeled with a
transcript length where each transcript resides and its size.
Single stranded Probe (5’->3’) Hybridizing Bands on Blot (all in kb)
EcoRI –> HindIII
1.2 kb
KpnI ->EcoRI
0.79 kb
KpnI ->PstI
0
BamHI->PstI
0
PstI->HindIII
0.79 kb, 1.2 kb
PstI->BamHI
0
BamHI - >KpnI
1.4 kb
HindIII 1.2 kbEcoRI 0.79 kbBamHI ---- PstI  1.4 kb KpnI
7. (2 pts) From lab exercises; similar to question 8 from last year’s exam. Which of the
following steps is expected to increase the number of E. coli transformants of your properly
ligated recombinant pTZ19u DNA? (circle all that apply)
a) incubation of the transformed cells in 2X-YT for an hour prior to plating,
8. (2 pts) From lab exercises; similar to question 9 from last year’s exam. Which of the
following steps is expected to increase the number of yeast transformants of YCplac33? (circle
all that apply)
d) addition of PEG to the DNA + cells transformation mix, e) heat shock the transformed
cells at 42C for 15 minutes prior to plating
9. From lab exercises, lectures and aside reading; a and b are identical to question 11 in last
year’s exam. When using C. elegans in an RNAi experiment, we simply added E. coli to the
nematode.
a. (5 pts) How did the E. coli addition direct degradation of specific target mRNAs (e.g.,
CLF1, DPY-1 etc) within the animal? We used a bacterial strain that contain an IPTG
inducible T7 RNA polymerase. This bacterial host was transformed with a L4440
plasmid bearing one of the genes of interest flanked by dual T7 promoter sequences.
The result is the production of dsRNA within the bacterial host when IPTG is added.
C. elegans ate these bacteria and the dsRNA released from the bacteria was taken up
by the cells of C. elegans where the bacterial produced dsRNA was processed by the
endogenous DICER and RISC activities to generate the RNAi knockdown of the C.
elegans target mRNAs.
b. (3 pts) From lab exercises, lectures and aside reading. Unlike most RNAi
approaches, the RNAi affect is passed on through generations of animal. That is, the
offspring of treated animals still show knockdown of the targeted transcript. An
RNA-dependent RNA polymerase is specifically responsible for this persistence
across generations. Discuss how this might occur. C. elegans has a robust RNAdependent RNA polymerase that uses the products of DISCER to prime RNA
production of anti-sense RNA. Since the sense strands are naturally produced by C.
elegans as mRNA, the parallel synthesis of the anti-sense strand by the RNAdependent RNA polymerase amplifies and perpetuates the signal originating from the
bacterial produced dsRNA (and continues even when all of the original dsRNA from
E. coli is gone). Some of this dsRNA is present in the eggs produced by the adult C.
elegans, continuing the RNAi response in the offspring.
c. (2 pts) From lab exercises, lectures. In addition to its authentic RNA-dependent
RNA polymerases, the C. elegans genome encodes a protein called RRF-3 that
resembles an RNA-dependent RNA polymerase but lacks catalytic activity. A
mutation in the rrf-3 gene was included in our nematode host background to enhance
(that is, make stronger) the RNAi phenotype. Speculate why mutation in rrf-3 might
enhance the RNAi phenotype while mutation of the authentic RNA-dependent RNA
polymerase weakens this phenotype. The authentic RNA-dependent RNA
polymerase propagates the RNAi response by RNA synthesis. The RRF-3 protein
cannot synthesize RNA but likely binds RNA and co-factors required for RNA
synthesis to compete with the legitimate RNA-dependent RNA polymerase enzymes.
By removing this competitive inhibitor by rrf-3 mutation, you strengthen the RNAi
response.
10. (3 pts) From lab exercises and suggested reading. Discuss the principles that allow one to
separate nucleic acids by size using P6 chromatography. This is size-exclusion chromatography.
The P6 chromatography resin (which is acrylamide although similar agarose/sepharose columns
exist), can be thought of as empty spheres with holes of defined size on the surface. The size of
the holes dictates how large of a molecule can enter the bead. Once a molecule enters the bead,
it is trapped until it randomly collides with an “exit” hole. Large molecules such as the RNA we
synthesized are too large to enter the holes and pass rapidly through the column sliding over the
surfaces of the beads. Small molecules such as the unincorporated NTPs enter the beads and
flow through the column much more slowly due to this trapping.
11. a. (2 pts) From homework. You calculated the change in Gibbs free energy value ΔG
associated with the folded structure of a natural tRNA and one that you arbitrarily altered by
nucleotide substitution. You found that the ΔG value (increased) after nucleotide substitution
indicating that the “mutated” version was (less) stable.
b. (4 pts) Define each of the terms (that is, what do they mean) in the following equation
for the Gibbs free energy calculation:
ΔG (change in Gibbs free energy) = ΔH (change in enthalpy, i.e., heat released) T (temperature) ΔS (change in system entropy; i.e., disorder)
c. (2 pts) How is the likelihood that a reaction precedes spontaneously predicted by the
ΔG value? That is, in conditions of equilibrium between a unfolded -> folded state of an RNA,
what values of ΔG i) favor spontaneous formation of the folded state, ii) equal likelihood of
either state, or iii) the unlikely formation of the folded state? ΔG <0 likely to occur
spontaneously; ΔG=0 equal chance; ΔG>0 unlikely to form spontaneously
12. (6 pts) Mark each of the following genes/reagents used in lab as best described as most
useful in a A) selection procedure or B) screening procedure
i. addition of IPTG & X-gal to bacterial plates_____B___________
ii addition of kanamycin sulfate to the M13KO7 infected cultures ____A___________
iii use of the GFP/RFP dual reporter in the Asd-1 RNAi knockdown ___B__________
iv use of yeast medium lacking uracil in our transformation _____A_________
v addition of 5FOA to our yeast medium ____A__________
vi addition of ampicillin to our bacterial plates ____A_______