Mrs. Carrick 2013/14
Science Focus 9 - Biological Diversity Review ANSWERS
Topic 1 - Biological Diversity and Survival
1. What does the term biological diversity refer to? It refers to the number and variety of organisms
found within a specified geographic region
2. What is the difference between abiotic and biotic? ** Please refer to your notes and/or textbook for
this answer
3. Explain the difference between structural and behavioral adaptations with examples of each.
Structural adaptations refer to a physical structure that allows the organism a better chance of
survival. Example: Spikes, scales, fur, etc.
Behavioral adaptations refer to a behavior that allows the organism a better chance of survival.
Example: Migration, hibernation, etc.
4. What is the value of variation? Variation is the key to genetic diversity which helps contribute to the
survival of living things by producing populations that have a lot of variation.
5. Example: If there was a particularly long cold winter, perhaps only those grizzlies with especially thick
coats would survive the winter, but those with thinner coats might not. So the grizzly population’s
variation (genetic diversity) would allow at least some of the individuals of the grizzly population to
survive changing environmental conditions.
6. Explain the arrangement of species. (Individual, Population, Community, Ecosystem) ** Please refer
to your notes and/or textbook for this answer
7. Explain the difference between variation in a species and variation between species. Variability in a
species describes the differences among various individuals of the same species (i.e Freckles, brown
hair, birth marks). Variability between species describes the differences between individuals of
different species (i.e Lions vs. Horses).
8. What is the 7 Level Classification System used by scientists? (name each of the 7 levels) ** Please
refer to your notes and/or textbook for this answer
9. What makes a “species” unique? The ability to reproduce only with other members of that same
species; sharing similar appearances/traits.
10. What is Speciation? ** Please refer to your notes and/or textbook for this answer
Topic 2 - Habitat and Lifestyle
1. Explain what is included in an organism’s niche. ** Please refer to your notes and/or textbook for
this answer
2. Why is there little diversity and larger populations in Northern Canada, and high diversity with
smaller populations in Central and South America? ** Please refer to your notes and/or textbook for
this answer
Mrs. Carrick 2013/14
3. Explain the difference between the type of niche specialists and generalists have.
Organisms that can survive in various conditions and locations have broad niches and are called
Generalists. They must also be able to eat a variety of plants or other animals. Organisms that survive in
a very small location that require very consistent conditions are called Specialists. These organisms have
adaptations directed towards competing for one dependable food source, one type of soil, or one level of
light.
4. Give an example of each type of symbiotic relationship.

Commensalism: benefits one organism and has no apparent effect on the other organism. For
example, a bird will build a nest in a tree.

Mutualism benefits both living things. For example, in lichen, the algae produce food and the
fungus protects the algae from dehydration.

Parasitism benefits only one organism. For example, a tapeworm robs its host of nutrients.
What is “Interspecies competition?” Interspecies competition: When two or more species need the
same resource and neither benefit. This limits the sizes of the populations of the competing species.
For example. If there are two different species (Lion vs. Hyena) competing for the same food source,
there is less for each species.
5. Explain how different species can survive in each of the extreme environment samples below.
Answers will vary – you are brainstorming your own answers 
Ocean Floor ________________________________________________________
High Arctic _________________________________________________________
Desert _____________________________________________________________
6. What is resource partitioning? Resource partitioning occurs when similar species share different
parts of a resource.
Topic 3 - Passing It On
1. Briefly describe the difference reproductive processes that can occur asexually:
a. Binary Fission
 Involves a one celled organism.
 1 parent cell = 2 new cells.
 The cells become an exact replication of each other.
b. Spore Production
 Spores (single celled structures) a very similar to seeds, but they contain genetically identical
material to that of their parent.
 Examples: bread mold, mushrooms, mosses and ferns.
c. Cuttings
 Cutting from a parent stem (of a plant) may be used to produce new plants that clones
(creates an exact copies) if that stem is planted.
Mrs. Carrick 2013/14
d. Budding
 Parent produces a small, attached version of itself.
 The offspring can stay connected or detached
 Examples: Coral, yeast, hydra
2. In what other ways can asexual reproduction occur? (hint – think of flowers)
Self-fertilization
3. Explain the process of sexual reproduction in plants and label the parts of the flower below.
** Please refer to your notes and/or textbook for this answer
4. Explain the process of sexual reproduction in animals.
sperm cells
fertilization
zygote
Cell
division
(cleavage)
embryo
egg cells
(oocyte/ova)
5. Explain the process of conjugation in bacteria.
The process in bacterial cells in which two bacterial cells come together in a temporary fusion to
transfer genetic material
6. Some organisms can reproduce sexually and asexually. Explain the advantages and disadvantages of
each process ** Please refer to your notes and/or textbook for this answer
Topic 4 - Wearing Your Genes
1. Explain the difference between the 2 different kinds of inherited variation (continuous and discrete)
Mrs. Carrick 2013/14


2 examples of Continuous variations = 1 Weight, 2 Height
2 examples of Discrete variations = 1 Attached/unattached earlobes, 2 Blood Type
2. Give 2 examples of dominant traits and 2 examples of recessive traits.
DOMINANT TRAITS
RECESSIVE TRAITS
____Straight Thumb__________ __________Bent (hitch-hikers) Thumb________
____Un-attached Earlobes________ __________Attached Earlobes___________
3. Certain characteristics are non-inherited and depend on factors other than genetics. Explain how
these characteristics can be identified in a particular population of organisms living in the same
environment.
** Please refer to your notes and/or textbook for this answer
4. Explain what a mutation is factors that can change genetic information?
5. What are Mutagens, and 3 examples of them?
 1 UV LIGHT
 2 CHEMICALS
 3 CHECK YOUR NOTES
6. Some mutations can cause a very serious disease called ___CANCER_______, which promote rapid
cell division and impair full normal cell development. The cancerous cells can interfere with other cells
and prevent certain processes from occurring as they should.
7. If mutations occur in the DNA of reproductive cells, the changes can be passed on from the
___MOTHER_______ to the _______CHILD___________
Topic 5 - When Plans Change
1. Who discovered DNA?
2. In 1953, James Watson and Francis Crick established the structure of DNA
3. Illustrate the chemical structure of DNA that was modeled by James Watson and Francis Crick
below:
Mrs. Carrick 2013/14
4. What is the genetic code? The nucleotide (bases) of DNA molecules that carry genetic
information in living cells.
5. What enables DNA to have so many variations with only 4 chemicals? There are so many
combinations of DNA possible, even with only 4 chemicals (ACTG)
6. Explain how biotechnology can increase or decrease variation.
** Please refer to your notes and/or textbook for this answer
7. Describe some of the positive effects of biotechnology.
One of the great effects of biotechnology is the availability of food. Biotechnology began about ten
thousand years ago when people domesticated crops and farm animals. This was the beginning of
agriculture and the beginning of bioengineering through selective breeding.
Another great effect of biotechnology is the large array of medicines available.
A third effect is the large number of people on the planet because they can be fed using agriculture.
8. Describe some of the negative consequences of biotechnology.
Loss of biodiversity; Natural selection cannot work in this circumstance
9. Be able to define the following:
a. Allele: One of two or more alternative forms of a gene that are found at the same place on a
chromosome. One allele is from the Mother, one allele is from the Father.
Example: T (allele from Father) + t (allele from Mother) = Tt (a gene for tallness)
b. Gene: A hereditary unit consisting of a sequence of DNA that occupies a specific location on a
chromosome and determines a particular characteristic in an organism. (ex: blue eyes)
c. Genetics: The study of heredity and the variation of inherited characteristics.
10. DNA is the shortened form of this:__Deoxyribonucleic Acid
What is this structure called?
___CHROMOSOME____
11. Chromosomes are made of what? ______DNA_________
12. The sides of the DNA ladder (backbone) are made of alternating __SUGARS___ and
___PHOSPHATE_____ molecules.
13. The bases in DNA are known by these letters: ACGT
Mrs. Carrick 2013/14
14. These bases always bond in a certain way. Adenine will only bond to ** Please refer to your
notes and/or textbook for this answer
15. Guanine will only bond with** Please refer to your notes and/or textbook for this answer
16. Write the complimentary DNA sequence:
ATGCACATAGTCAATCGGCTAA
TACGTGTATCAGTTAGC CGATT
STAGES OF MITOSIS ** check out the links put up in the Grade 9 section of Mrs. Carrick’s Wiki
17. What is a GAMETE? specialized sex cells  eggs and sperm
18. Are Gametes created through Mitosis or Meiosis? MEIOSIS
19. What is a SOMATIC CELL? Any cell of a living organism other than the reproductive cells.
20. Are Somatic Cells created through Mitosis or Meiosis? MITOSIS
21. If a somatic cell typically has 44 chromosomes in it, how many chromosomes would be found in
the gamete cells of the same species? 22
Topic 6 - The Best Selection
1. Explain the drawbacks of the process of Artificial Selection. ** Please refer to your notes and/or
textbook for this answer
2. Explain what occurs during the process of each type of artificial selection technique below.
o Cloning Make an identical copy of.
o
artificial insemination The injection of semen into the uterus other than by sexual intercourse.
o
Ex: Farmers will use this method to produce pigs and cows
o
in vitro fertilization
o
Genetic engineering (Genetically Modified Organisms)
A process by which egg cells are fertilized by sperm outside the womb
the deliberate modification of the
characteristics of an organism by manipulating its genetic material.
3. Darwin explained his theory of natural selection, which could be summed up in four statements:
Mrs. Carrick 2013/14
1. Variation. Organisms (within populations) exhibit individual variation in
appearance and behavior. These variations may involve body size, hair color,
facial markings, voice properties, or number of offspring. On the other hand,
some traits show little to no variation among individuals—for example, number of
eyes in vertebrates.
2. Inheritance. Some traits are consistently passed on from parent to offspring.
Such traits are heritable, whereas other traits are strongly influenced by
environmental conditions and show weak heritability.
3. High rate of population growth. Most populations have more offspring each year
than local resources can support leading to a struggle for resources. Each
generation experiences substantial mortality.
4. Differential survival and reproduction. Individuals possessing traits well suited for
the struggle for local resources will contribute more offspring to the next
generation.
4. Why do scientists use Punnett Squares to predict heredity?
They want to know the different combinations of genotypes that one of their offspring might
have. So, we draw a Punnett square
5. In hamsters, black coat color (B) is dominant to white coat color (b). A homozygous black
hamster (BB) is mated with a heterozygous black (Bb)hamster. What will be the genotype and
phenotype percentages be of their offspring?
B
b
B
BB
Bb
B
BB
Bb
GENOTYPE: 50% BB, 50% Bb
PHENOTYPE: 100% Black coat offspring
6. In humans, brown eyes (B) are dominant over blue (b)*. A brown-eyed man marries a blue-eyed
woman and they have three children, two of whom are brown-eyed and one of whom is blueeyed. Draw the Punnett square that illustrates this marriage. What is the man’s genotype? What
are the genotypes of the children?
** Please refer to your notes and/or textbook for this answer
Topic 7 - The Sixth Extinction
1. Identify different ways that natural extinction can occur and give examples of species lost as a
result.
Loss of habitat due to humans (i.e. building of cities, creation of agricultural land) can be so drastic
that a species can lose all its sources of food. If there is no food to eat, the species will starve and
become extinct.
2. How does overspecialization cause extinction? ** Please refer to your notes and/or textbook for this
answer
Mrs. Carrick 2013/14
3. Explain the difference between extinction and extirpation. Extinction is when a species is
completely gone from everywhere on Earth. Extirpation is when a species is completely gone from
one area, but still exists in other parts of the world.
4. What human activities can have an impact on species populations? ** Please refer to your notes
and/or textbook for this answer
5. How do zoos preserve biodiversity? ** Please refer to your notes and/or textbook for this answer
6. What are some organizations doing to preserve plant species and avoid species extinction?
Organizations such as the Calgary Zoological Society have been protecting and attempting to breed
some species that are facing extinction. By offering a safe place to live, a stable food source, and the
ability of mates, this might allow the species to build in numbers and not become extinct.
7. Explain the difference between ex-situ and in-situ conservation programs to preserve biological
diversity around the world. (Give examples)
In situ is protecting an endangered species within its own habitat (ex: Banff National Park), ex situ is
when an endangered species is moved out of its habitat and is being conserved and protected (like in
a zoo or seed bank).
8. What strategies are used to preserve biological diversity in Canada? ** Please refer to your notes
and/or textbook for this answer
9. What is the difference between in-situ conservation and ex-situ conservation? Please refer to
question # 7 in this section.