Supplementary information
Methods
Biofilm quantitation
Overnight planktonic cultures of S. epidermidis 1457 were diluted 1:50 in sterile TSB then
100 µL of cell suspension was placed into wells of a 96-well polystyrene plate with low
evaporation lids. Cultures were incubated for up to 48 hours at 37oC. At 2, 4, 6, 8, 12, 24,
and 48 hours, plates were removed from the incubator and gently rinsed with phosphate
buffered saline three times, then heat fixed in a 60oC oven for one hour. A 0.1% solution of
crystal violet in distilled de-ionized water was then added to the wells and incubated for 15
minutes. The wells were again gently rinsed three times with PBS then 95% ethanol was
added to solubilize the biofilm-bound crystal violet dye in order to provide a uniform
measurement throughout the wells. After 30 minutes, the sample absorbance at 570 nm was
determined on a Safire II plate reader (Tecan, Männedorf, Switzerland). All experiments
were performed in triplicate.
Genomic DNA extraction
Genomic DNA (gDNA) was extracted from planktonic and adherent cells using a QIAgen
(Valencia, CA) DNeasy Blood and Tissue Kit. Following lysis, the S. epidermidis cell lysate
was processed on the DNeasy spin column with the following alterations to the
manufacturer’s protocol. Six hundred fifty (650) L of QIAgen Buffer AW1 was used
instead of the 500 L stated and 50 L of RNase-free, DNase-free water was directly pipetted
onto the column, rather than 200 L of Buffer AE, in order to elute more concentrated DNA
and prevent interference from Buffer AE components in downstream reactions.
cDNA synthesis for standard PCR
QIAgen’s OmniscriptTM RT Kit was used for synthesis of cDNA from recovered mRNA for
standard PCR folowing the manufacturer’s protocol. cDNA synthesis was performed on an
MJ MiniTM Thermocycler (Bio-Rad) by incubating at 37oC for one hour followed by 90oC for
ten minutes and a 4oC hold. cDNA was stored until use at -20oC.
1
Standard PCR
Standard PCR was performed using Taq DNA polymerase (New England Biosciences,
Ipswich, MA) according to the manufacturer’s protocol. PCR primers were designed using
Primer3 software and were purchased from Integrated DNA Technologies (IDT, Coralville,
IA). Error! Reference source not found.1 describes primers used in standard and
quantitative RT-PCR.
embp S. epidermidis 1457 mutation
Creation of an embp deletion mutant (Δembp) was attempted using four separate methods.
Homologous recombination using the pKOR1 shuttle vector was first attempted to remove
the entire embp gene. Insertional inactivation was performed to interrupt the expression of
embp by replacing the first 1000 bp with an antibiotic cassette. A suicide vector (pCIV2) was
used to prevent transmission of non-recombined plasmid to daughter cells. Finally, a
temperature sensitive vector (pBT2) containing erythromycin resistance was used to prevent
embp expression.
Homologous recombination
Homologous recombination was carried out to create an embp from the S. epidermidis
1457chromosome. Sequences were made to facilitate Gateway cloning with shuttle plasmid
pKOR1 containing attB1 (ggggacaagtttgtacaaaaaagcaggcc) and attB2
(ggggaccactttgtacaagaaagctgggt) primer sites. SacII restriction sites were chosen to allow for
efficient directional cloning between the two flanking regions in order to make one construct
on ligation to be cloned into pKOR1. The left flanking region contained an attB1 site on the
5’ forward primer, while the 5’ reverse primer had a SacII restriction sequence (underlined)
to facilitate restriction digest (gtttcaccgcgg). The right flanking region contained attB2 on the
5’ reverse primer and SacII restriction sequence (underlined) on the 5’ forward primer
(aggtcccgccg). Each flanking region of gene had a distinct attB site so that it could integrate
with the corresponding attP site on the pKOR1 plasmid. Standard PCR was performed on the
gDNA using these primers and PCR products were run on a 0.8% agarose gel and visualized
with ethidium bromide. The entire ~1000 kilo-basepair band was excised from the gel and
PCR products were purified using Invitrogen’s PureLink Gel Extraction kit (Carlsbad, CA)
according to the manufacturer’s protocol. The restriction endonuclease SacII (New England
BioLabs, Ipswich, MA) was used to digest PCR products prior to ligating the together and
2
cloning them into the pKOR1 shuttle vector using BP Clonase II Enzyme Mix (Invitrogen,
Carlsbad, CA) according to the manufacturer’s instructions. Then, plasmids were
transformed into E. coli JM109 (Promega, Madison, WI) via heat shock transfection.
Plasmid DNA was purified from the E. coli cells via a QIAprep Mini-kit following the
manufacturer’s instructions, transfection confirmed and then pDNA transformed into S.
epidermidis 1457 via electroporation.
Insertional inactivation
Insertional inactivation was performed to prevent the expression of the entire embp gene by
recombining a portion of the gene with additional components, such as an antibiotic
resistance cassette or an entire plasmid, which interrupt gene expression. However, due to
the extreme antibiotic resistance and efficient adaptation to antibiotics leading to further
resistance, it was not possible to generate a purely antibiotic resistant mutant in either S.
epidermidis in strain RP62A or 1457. Two further attempts were made at inserting an entire
plasmid into the 5’ end of the embp gene.
Suicide vector pCIV2 transformation
A suicide vector transformation of S. epidermidis using the pCIV2 plasmid vector containing
kanamycin resistance was performed with the goal that non-recombined plasmids would not
be passed to daughter cells and only those cells in which recombination of the plasmid had
occurred would be viable on the selecting antibiotic. Phusion polymerase (New England
Biosciences, Ipswitch MA) was used to amplify the first 1000 basepairs of embp and inserted
into the vector. The plasmid was first transformed into S. aureus RN4220 before S.
epidermidis 1457 in order to methylate the plasmid to protect against digestion of
unmethylated DNA by S. epidermidis (a restriction positive bacteria). While the initial
transformation into S. aureus was successful, the plasmid cannot replicate in staphylococci,
and it was not possible to obtain sufficient amounts to transform from S. aureus RN4220 into
S. epidermidis.
Temperature sensitive pBT2 transformation
The last method attempted, used the temperature sensitive vector, pBT2, as described by
Brickner et al. to create an embp::erm by adding two 1000 bp regions of homology to the 5’
end of embp that were separated by an erythromycin (erm) antibiotic cassette [1]. This
strategy requires a double-recombination event to take place leading to interruption of the
3
gene and resistance to the selecting antibiotic, erythromycin. A planktonic culture of S.
epidermidis 1457 was grown at 30oC allowing for plasmid growth and the first recombination
event to take place. The growth temperature was then increased to the normal 37oC, at which
the plasmid can no longer replicate and further recombination into the chromosomal DNA
was expected to take place. However, it was found that while this process conferred
erythromycin resistance to the S. epidermidis cells, embp was still intact, most likely due to
single recombination events that failed to resolve properly.
qRT-PCR conditions
Rotor-Gene 3000TM Real Time Thermal Cycler (Corbett Research/QIAgen) using the
following conditions: samples were denatured for 15 minutes at 95oC followed by 40 cycles
at 94oC for 15 seconds, 52oC for 25 seconds, and 72oC for 20 seconds
qRT-PCR analysis – relative expression method
The control gene (gmk) was normalized to the initial time or condition according to Equation
1:
Normcontrol gene (1) = #control gene (1)/#control gene (0)
(1)
The relative copy number of the genes of interest at various times/conditions was then
determined by dividing gene copy number of interest by the normalized control gene, as per
Equation 2:
Relative copy Number = #interest gene (1)/Normcontrol gene (1)
(2)
Rotor-Gene 3000TM Real Time Thermal Cycler (Corbett Research/QIAgen) using the
following conditions: samples were denatured for 15 minutes at 95oC followed by 40 cycles
at 94oC for 15 seconds, 52oC for 25 seconds, and 72oC for 20 seconds.
Results
Cell growth and biofilm formation
To assess optimal sampling times for further comparisons of early exponential and late
stationary phase growth, we grew cells in planktonic and biofilm cultures for up to 36 hours.
4
The optical density of biofilm cultures grown under static fluid conditions was consistently
lower than planktonic cultures at all time points (Fig S1). Cell growth in both cultures
occurred exponentially and then plateaued at 12 hours. At 24 hours, cells in planktonic
cultures had entered post stationary phase and the number of cells in the culture declined
dramatically between 24 and 36 hours. Cell numbers in static adherent cultures remained
more constant between 12 and 36 hours. We further quantified biofilm production at
numerous time points during growth with Crystal violet assays. Crystal violet based assays
measure the overall biofilm material (cells and biofilm matrix) formed on the surface and do
not provide estimates of the adherent cell concentrations per area. Biofilm amount (as
measured by crystal violet assay) does not begin to increase until between 8 and 12 hours,
versus adherent cell numbers (measured by Live/Dead staining) that have reached peak cell
concentration and remain steady between 12 and 24 hours.
The entire embp gene is expressed throughout growth
The embp gene of S. epidermidis (SERP1011 in the genome mapped strain RP62A)
comprises a single reading frame consisting of nearly 1% of the S. epidermidis genome.
However, prior to the current study, expression of the entire embp gene had not previously
been examined. Standard RT-PCR shows that four separate PCR amplicons spaced
throughout the embp gene were always expressed together, suggesting that the entire >30,000
base pair sequence of embp was expressed by S. epidermidis cells during exponential growth
in planktonic culture (
5
Fig S2 S. epidermidis 1457 embp gene expression in planktonic cultures.
(a) Standard RT-PCR amplification of segments surrounding the 1k, 10k, 20k,
30k bps of the embp gene from 4 hour cultures in lanes 1 through 4,
respectively.
gmk expression used as housekeeping gene, lane 5. (b)
Standard PCR amplification of embp at 0.5, 1, 3, 5, 7, and 16 hours of
growth in lanes 1 through 7, respectively
A) and during 16 hours of biofilm growth (
6
Fig S2 S. epidermidis 1457 embp gene expression in planktonic cultures.
(a) Standard RT-PCR amplification of segments surrounding the 1k, 10k, 20k,
30k bps of the embp gene from 4 hour cultures in lanes 1 through 4,
respectively.
gmk expression used as housekeeping gene, lane 5. (b)
Standard PCR amplification of embp at 0.5, 1, 3, 5, 7, and 16 hours of
growth in lanes 1 through 7, respectively
B). These results are supported by NCBI sequences in which Embp is the only protein
encoded for in the region extending from nucleotides 1023531 to 1054142 in the
chromosome of the Staphylococcis epidermidis RP62A genome
(http://www.ncbi.nlm.nih.gov/nuccore/57865352). According to NCBI’s open reading frame
finder, the region including Embp, as well as the the 1000 nucleiotides on either side of this
gene, contain only one open reading frame (orf) that is greater than 800 basepairs in length.
This orf codes for the embp gene, the 31,000bp sequence encoding Embp. Within the embp
orf, no additional orfs exist that could encode for proteins larger than 92bps.
Cell growth and biofilm formation
To assess optimal sampling times for further comparisons of early exponential and late
stationary phase growth, we grew cells in planktonic and biofilm cultures for up to 36 hours.
Fig S2 A displays S. epidermidis 1457 growth in TSB in planktonic and static biofilm
conditions as measured by optical density. The optical density of biofilm cultures grown
under static fluid conditions is consistently lower than planktonic cultures at all time points.
Cell growth in both cultures occurs exponentially and then plateaus at 12 hours. At 24 hours,
cells in planktonic cultures have entered post stationary phase and the number of cells in the
culture declines dramatically between 24 and 36 hours. Cell numbers in static adherent
cultures remain more constant between 12 and 36 hours. We further characterized biofilm
production at numerous time points during growth with Crystal violet assays. Crystal violet
based assays measure the overall biofilm material (cells and biofilm matrix) formed on the
surface and do not provide estimates of the adherent cell concentrations per area. As shown in
Fig S2 B, biofilm amount (as measured by crystal violet assay) does not begin to increase
until between 8 and 12 hours, versus adherent cell numbers (measured by Live/Dead staining)
that have reached peak cell concentration and remain steady between 12 and 24 hours.
7
embp S. epidermidis 1457 mutation attempts
The preferred negative control to determine effects caused by Embp would be a deletion
mutant that does not express the protein. While Christner et al. have utilized an S.
epidermidis variant that overexpressed a portion of Embp, no true Δembp negative mutant
exists [2]. Thus, we attempted four different recombination approaches to create an embp
negative S. epidermidis strain. Details of these four methods and their negative results are
summarized in the Supplementary Methods. All approaches failed to generate a ∆embp
mutant in any S.s epidermidis strain. Consequently, we choose to compare embp expression
to icaA, a gene known to play a major role in biofilm formation and maintenance. icaA was
used as a positive control while gmk, was used as the regulatory housekeeping gene. Data
related to these attempts to prevent expression of embp are available upon request.
Supplementary References
1. Bruckner R (1997) Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS
Microbiol Lett 151 (1):1-8. doi:S0378-1097(97)00116-X [pii]
2. Christner M, Franke GC, Schommer NN, Wendt U, Wegert K, Pehle P, Kroll G, Schulze C, Buck F, Mack D,
Aepfelbacher M, Rohde H (2010) The giant extracellular matrix-binding protein of Staphylococcus epidermidis
mediates biofilm accumulation and attachment to fibronectin. Molecular microbiology 75 (1):187-207.
doi:MMI6981 [pii]
Supplementary Figures
Fig S1 S. epidermidis 1457 cell growth and biofilm formation. (a) Cell concentration by optical density for
planktonic and adherent cultures. (b) Biofilm formation determined by crystal violet staining and cell numbers
determined by optical density. Error bars = standard deviations of three separate cultures
8
9
Fig S2 S. epidermidis 1457 embp gene expression in planktonic cultures. (a) Standard RT-PCR amplification of
segments surrounding the 1k, 10k, 20k, 30k bps of the embp gene from 4 hour cultures in lanes 1 through 4,
respectively. gmk expression used as housekeeping gene, lane 5. (b) Standard PCR amplification of embp at
0.5, 1, 3, 5, 7, and 16 hours of growth in lanes 1 through 7, respectively
10