SUPPORTING INFORMATION TABLE S1. Geographic locations of 11 sampled study populations. Pop. Region Locality N Sampling dates mASL Habitat type ERP Guanacaste Rincon de la Vieja 6 July, 2009 975 Primary forest MIR Guanacaste Miravalles 11 February, 2010 892 Pasture UMV N. Tilarán Monteverde 11 July, 2009 1233 Roadside N. Tilarán Monteverde 16 July, 2009; 1350 Pasture EMV July, 2011 ETT N. Tilarán Monteverde 6 July, 2009 1412 Roadside ALO N. Tilarán San Luis 16 July, 2009; 1071 Pasture 1096 Pasture 1069 Pasture July, 2011 CAB N. Tilarán San Luis 10 January, 2009; July, 2009; July, 2011 EFR N. Tilarán San Luis 11 July, 2009; July, 2011 ECE S. Tilarán Cedral 13 March, 2010 1312 Roadside ESR S. Tilarán San Ramon 7 March, 2011 1123 Roadside ECH Talamanca Chirropó 12 July, 2010 1503 Roadside Note: N = the number of plants yielding at least one fungal sequence; mASL = elevation in meters above sea level. APPENDIX S1. Assessing sampling sufficiency. We bootstrapped sequences from the best sampled populations with contrasting levels of diversity in each group (Tulasnellaceae = ALO, MIR; Sebacinales = ALO, EFR). We resampled populations two to the maximum number of sequences/population, 1000 times without replacement, in order to estimate standard error π at each sample size with pegas (Paradis 2010) in R v.2.15.1 (R Core Development Team 2010). We also produced sample based rarefaction curves for haplotype and phylogenetic richness per population with picante (Kembel et al. 2010) in R (R Core Development Team 2010). Because some haplotypes that were distinguishable across ITS were indistinguishable across 5.8S, phylogenetic diversity analyses only considered phylogenetically distinguishable haplotypes. The curves show that mycorrhizal diversity within the best sampled populations asymptotes rapidly and that phylogenetic richness asymptotes much more rapidly than haplotype richness (Figure S1). Populations with ≥ 5 sequences should provide robust estimates of mycorrhizal diversity for both taxa. We might find more haplotypes within each of these groups by sampling more populations, but new haplotypes are unlikely to add substantial phylogenetic diversity. Thus, we adequately sampled most populations. a. b. 15 Phylogenetically distinguishable haplotype richness Phylogenetic richness Richness 10 5 0 1 2 3 4 5 6 7 8 9 10 11 Sites c. d. 0.25 ALO EFR Nucleotide Diversity 0.20 0.15 0.10 0.05 0.00 -0.05 0 2 4 6 8 10 12 14 Number Samples FIGURE S1. Assessing sampling sufficiency with resampling procedures. Curves are shown for Tulasnellaceae (a-b) and Sebacinales (c-d). These curves show resampling of ITS nucleotide diversity (π) in the two best sampled populations (a,c) and the haplotype and phylogenetic richness across populations (b,d). APPENDIX S2. Detailed Summary of Fungal Identification. Here, we detail the total taxonomic diversity of fungi associating with the roots of Epidendrum firmum, including taxa that are not known to form mycorrhizal symbioses with orchids. Where possible, we assess taxonomic congruence between the ITS and mtLSU loci. The top BLAST match to the GenBank database was recorded for each sequence (Table S2). Searches for additional matches were performed in cases where the top match did not provide a clear indication of taxonomy. We identified 25 basidiomycete MOTUs from 260 sequences spanning the 5.8S region and at least five additional MOTUs from 43 mtLSU sequences (Figure 2). Orchid-mycorrhizal taxa include Cantharellales (Tulasnellaceae and Ceratobasidiaceae), Sebacinales, Thelephorales, Russulales and Boletales. The mtLSU confirmed the symbioses with Tulasnellaceae, including 30 plants (six in addition to ITS sequences; Figure 2) in nine populations, where one plant associated with >1 mtLSU MOTU. Most plants for which both Tulasnellaceae ITS and mtLSU sequences are available (22/24 plants; 92%) yielded matching MOTUs for both loci. Although we did not obtain mtLSU sequences from plants yielding ITS MOTU A or B, these MOTUs are well-supported by 5.8S (Figure S2). We did not obtain mtLSU sequences for Sebacinales, possibly due to primer inefficiency. Other basidiomycetes are unlikely to form mycorrhizas, but two Trechisporales MOTUs were sampled from five sites may frequently form an unknown symbiotic association (Figure 2). We identified 20 MOTUs from 62 ascomycete sequences (Figure 2). Potential orchid mycorrhizal ascomycetes include the Helotiales, but the relationship with most ascomycetes is unclear as they could be generalist pathogens or saprotrophs that opportunistically invade the root velamen without forming mycorrhizas (Herrera et al. 2010). Many of the ascomycetes are similar to endophytes of Bletilla spp. in southwest China (Tao et al. 2008) and orchids of La Reunion Island (Martos et al. 2012). Relatively frequent associates include the Hypocreales, Capnodiales and Pleosporales (Figure 2). Fusarium spp. (Hypocreales) can induce germination in Cypripedium spp. seeds (Vujanovic et al. 2000). One plant associated with four Capnodiales MOTUs and another associated with two (Figure 2), suggesting this is a non-specific and opportunistic association. A single MOTU similar to Nigrospora sp. (Trichosphaeriales) occurred in seven plants from five sites and may represent a specialized parasite (Figure 2). Multiclavula vernalis - U66439 Multiclavula corynoides - U66440 Uncultured Tulasnellaceae from Cypripedium parviflorum (Orchidaceae) - DQ925545 Uncultured Tulasnellaceae from Cypripedium japonicum (Orchidaceae) - DQ925645 Epulorhiza sp. from Pe-QS-0-1 (Orchidaceae) - GU166408 Uncultured Tulasnellaceae from Cypripedium debile (Orchidaceae) - DQ925509 Uncultured Tulasnellaceae from Cypripedium montanum (Orchidaceae) - DQ925513 1000 Uncultured Tulasnellaceae fromCypripedium macranthon var. rebunense(Orchidaceae) - DQ925528 Uncultured Tulasnellaceae fromCypripedium macranthon var. rebunense(Orchidaceae) - DQ925527 Uncultured Tulasnellaceae from Cypripedium reginae (Orchidaceae) - DQ925524 Uncultured Cantharellales from Riccardia sp. (Aneuraceae) - DQ368717 Uncultured Tulasnellaceae fromCypripedium macranthon var. rebunense(Orchidaceae) - DQ925603 Uncultured Tulasnellaceae from Cypripedium montanum (Orchidaceae) - DQ925572 509 Uncultured Tulasnellaceae from Cypripedium guttatum (Orchidaceae) - DQ925577 Uncultured Tulasnellaceae from Cypripedium reginae (Orchidaceae) - DQ925590 Uncultured Tulasnellaceae from Cypripedium montanum (Orchidaceae) - DQ925601 Uncultured Tulasnellaceae from Cypripedium montanum (Orchidaceae) - DQ925602 Uncultured Tulasnellaceae from Cypripedium parviflorum (Orchidaceae) - DQ925550 924 Uncultured Tulasnellaceae fromCypripedium macranthon var. rebunense(Orchidaceae) - DQ925549 Uncultured Tulasnellaceae from Cypripedium fasciculatum (Orchidaceae) - DQ925610 848 Uncultured Tulasnellaceae from Cypripedium fasciculatum (Orchidaceae) - DQ925637 656Uncultured Tulasnellaceae from Cypripedium fasciculatum (Orchidaceae) - DQ925638 Uncultured Tulasnellaceae from Cypripedium fasciculatum (Orchidaceae) - DQ925620 Uncultured Tulasnellaceae from Cypripedium californicum (Orchidaceae) - DQ925636 Uncultured Tulasnellaceae from Cypripedium reginae (Orchidaceae) - DQ925615 Uncultured Tulasnellaceae from Cypripedium fasciculatum (Orchidaceae) - DQ925625 Uncultured Tulasnellaceae from Cypripedium reginae (Orchidaceae) - DQ925640 Uncultured Tulasnellaceae from Cypripedium debile (Orchidaceae) - DQ925505 912Uncultured Tulasnellaceae from Cypripedium debile (Orchidaceae) - DQ925506 729 Symbiont of E. firmum - Talamanca - ECH - OTU6 - JX998961 Uncultured Tulasnellaceae from Orchidaceae - JF69150 3 Uncultured Cantharellales from Orchidaceae - HM451571 1000 675 Uncultured Cantharellales from Orchidaceae - HM451854 668 730 Uncultured Tulasnella from Stelis hallii (Orchidaceae) - DQ178118 Uncultured Tulasnellaceae from Orchidaceae - JF69099 4 551 Uncultured Tulasnellaceae from Orchidaceae - JF69125 9 540 Tulasnella tomaculum - AY373296 Tulasnella violea - AY373293 Uncultured Cantharellales from Orchidaceae - HM451713 Uncultured Cantharellales from Orchidaceae - HM451605 Tulasnella violea - DQ520097 593 Symbiont of E. firmum - Tilaran - ETT - OTU1 - JX998860 573 981Symbiont of E. firmum - Tilaran - ETT - OTU1 - JX998892 709 Symbiont of E. firmum - Tilaran - EFR - OTU1 - JX998908 990 Symbiont of E. firmum - Tilaran - ECE - OTU0 - JX998872 754 Symbiont of E. firmum - Tilaran - ECE - OTU0 - KC440181 633 Symbiont of E. firmum - Talamanca - ECH - OTU0 - JX998888 Symbiont of E. firmum - Guanacaste - MIR - OTU0 - JX998901 Symbiont of E. firmum - Tilaran - EFR - OTU0 - JX998907 Symbiont of E. firmum - Talamanca - ECH - OTU0 - JX998864 Symbiont of E. firmum - Talamanca - ECH - OTU0 - JX998882 Symbiont of E. firmum - Talamanca - ECH - OTU0 - JX998878 Symbiont of E. firmum - Guanacaste - MIR - OTU0 - JX998904 Symbiont of E. firmum - Guanacaste - MIR - OTU0 - JX998900 Symbiont of E. firmum - Talamanca - ECH - OTU0 - JX998960 862 Tulasnella sp. from Tipularia discolor (Orchidaceae) - AY373316 Uncultured Tulasnellaceae from Orchidaceae - JF69104 5 998 Tulasnella sp. from CI-QS (Orchidaceae) - GU166416 518Uncultured Tulasnellaceae from Orchidaceae - JF69110 3 Uncultured Tulasnellaceae from Orchidaceae - JF69151 1 Uncultured Tulasnellaceae from Orchidaceae - JF69137 1 Uncultured Tulasnellaceae from Cypripedium californicum (Orchidaceae) - DQ925493 Uncultured Tulasnellaceae from Cypripedium californicum (Orchidaceae) - DQ925499 691 Uncultured Tulasnellaceae fromCypripedium californicum (Orchidaceae) - DQ925498 670 Uncultured Tulasnellaceae from Cypripedium californicum (Orchidaceae) - DQ925497 Uncultured Cantharellales from Orchidaceae - HM451639 635 Uncultured Cantharellales from Orchidaceae - HM451638 999 Uncultured Cantharellales from Orchidaceae - HM451577 779 Uncultured Cantharellales from Orchidaceae - HM451649 Uncultured Cantharellales from Orchidaceae - HM451789 Uncultured Cantharellales from Orchidaceae - HM451651 650 Uncultured Cantharellales from Orchidaceae - HM451648 Uncultured Cantharellales from Orchidaceae - HM451755 Uncultured Tulasnellaceae from Orchidaceae - JF69104 0 Uncultured Cantharellales from Orchidaceae - HM451552 673 Uncultured Cantharellales from Orchidaceae - HM451644 Tulasnella sp. from Tipularia discolor (Orchidaceae) - AY373300 Uncultured Tulasnellaceae from Orchidaceae - JF69136 8 992 Tulasnella sp. from Tipularia discolor (Orchidaceae) - AY373304 Uncultured Cantharellales from Orchidaceae - HM451733 Tulasnella sp. from Tipularia discolor (Orchidaceae) - AY373315 Uncultured Tulasnellaceae from Orchidaceae - JF69104 7 813 Uncultured Cantharellales from Orchidaceae - HM451505 730 Uncultured Cantharellales from Orchidaceae - HM451538 630 Uncultured Cantharellales from Orchidaceae - HM451504 Uncultured Cantharellales from Orchidaceae - HM451518 Uncultured Cantharellales from Orchidaceae - HM451740 Uncultured Cantharellales from Orchidaceae - HM451688 Tulasnella violea - AY373303 Tulasnella albida - AY373294 Tulasnella pruinosa - AY373295 Uncultured Cantharellales from Orchidaceae - HM451507 Uncultured Tulasnellaceae from Orchidaceae - JF69150 5 Tulasnella asymmetrica from Thelymitra luteocilium (Orchidaceae) - DQ388046 Tulasnella asymmetrica from Thelymitra luteocilium (Orchidaceae) - DQ388047 Tulasnella sp. from Pv-QS-0-2 (Orchidaceae) - GU166405 Uncultured Tulasnellaceae from Orchidaceae - JF69099 7 Tulasnella sp. from CI-QS (Orchidaceae) - GU166417 Uncultured Tulasnellaceae from Orchidaceae - JF69131 7 Uncultured Cantharellales from Orchidaceae - HM451566 Uncultured Tulasnella from Stelis superbiens (Orchidaceae) - DQ178074 Symbiont of E. firmum - Guanacaste - MIR - OTU2 - JX998966 Symbiont of E. firmum - Guanacaste - MIR - OTU2 - JX998898 Uncultured Tulasnellaceae from Orchidaceae - JF69103 0 Symbiont of E. firmum - Guanacaste - MIR - OTU2 - JX998997 Uncultured Cantharellales from Orchidaceae - HM451877 639 Uncultured Cantharellales from Orchidaceae - HM451879 Uncultured Cantharellales from Orchidaceae - HM451739 Uncultured Cantharellales from Orchidaceae - HM451878 Symbiont of E. firmum - Guanacaste - MIR - OTU2 - JX998895 Uncultured Tulasnella sp. From Cryptothallus mirabilis (Aneuraceae) - AY192472 635 Uncultured Tulasnellaceae from Orchidaceae - JF69133 7 995 Tulasnella irregularis from C3-DT-TC-2 (Orchidaceae) - GU166423 Uncultured Cantharellales from Orchidaceae - HM451508 Uncultured Cantharellales from Orchidaceae - HM451716 509 Uncultured Tulasnellaceae from Orchidaceae - JF69113 2 618 Uncultured Tulasnellaceae from Orchidaceae - JF69140 4 Symbiont of E. firmum - Tilaran - UMV - OTU3 - JX998928 953 Symbiont of E. firmum - Tilaran - ALO - OTU3 - JX998849 Symbiont of E. firmum - Tilaran - ECE - OTU3 - JX998876 Uncultured Tulasnellaceae from Orchidaceae - JF69106 0 Uncultured Cantharellales from Orchidaceae - HM451584 Uncultured Tulasnellaceae from Orchidaceae - JF69151 7 Uncultured Tulasnellaceae from Orchidaceae - JF69127 0 Uncultured Cantharellales from Orchidaceae - HM451512 Tulasnella calospora from Dcr-QS-02 (Orchidaceae) -GU166412 Symbiont of E. firmum - Guanacaste - ERP - OTU4 - JX998857 Symbiont of E. firmum - Guanacaste - ERP - OTU4 - JX998947 Symbiont of E. firmum - Tilaran - ECE - OTU4 - JX998929 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX998999 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX998989 Symbiont of E. firmum - Guanacaste - ERP - OTU4 - JX998858 Symbiont of E. firmum - Tilaran - ETT - OTU4 - JX998861 Symbiont of E. firmum - Tilaran - CAB - OTU4 - JX998943 Symbiont of E. firmum - Tilaran - CAB - OTU4 - JX998910 Symbiont of E. firmum - Tilaran - ECE - OTU4 - JX998956 Symbiont of E. firmum - Tilaran - ECE - OTU4 - JX998953 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX998976 Tulasnella danica - AY373297 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX998998 Uncultured Tulasnellaceae from Orchidaceae - JF69144 0 Tulasnella calospora from Pch-SM-TC-1 (Orchidaceae) - GU166404 Tulasnella calospora from Acianthus exsertus (Orchidaceae) - DQ388041 Uncultured Tulasnellaceae from Orchidaceae - JF69128 0 Uncultured Tulasnellaceae from Orchidaceae - JF69111 5 Symbiont of E. firmum - Tilaran - ESR - OTU4 - JX998994 Symbiont of E. firmum - Tilaran - ESR - OTU4 - JX998965 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX999000 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX999002 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX999003 Symbiont of E. firmum - Guanacaste - MIR - OTU4 - JX998967 Symbiont of E. firmum - Tilaran - UMV - OTU4 - JX998919 Symbiont of E. firmum - Guanacaste - ERP - OTU4 - JX998948 Symbiont of E. firmum - Tilaran - UMV - OTU4 - JX998916 Symbiont of E. firmum - Tilaran - EFR - OTU4 - JX998934 Symbiont of E. firmum - Tilaran - UMV - OTU4 - JX998921 Symbiont of E. firmum - Tilaran - ESR - OTU4 - JX998931 Symbiont of E. firmum - Tilaran - ESR - OTU4 - JX998930 Symbiont of E. firmum - Tilaran - ESR - OTU4 - JX998995 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX998992 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX998991 Symbiont of E. firmum - Tilaran - ECE - OTU4 - JX998870 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX998936 Symbiont of E. firmum - Tilaran - ETT - OTU4 - JX998894 Symbiont of E. firmum - Tilaran - ECE - OTU4 - JX998868 Tulasnella calospora from DCr-QS-01 (Orchidaceae) - GU166419 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX99898 0 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX99897 8 Symbiont of E. firmum - Tilaran - CAB - OTU4 - JX998970 Tulasnella sp. from Goodyera pubescens (Orchidaceae) - AY373275 Tulasnella sp. from Goodyera pubescens (Orchidaceae) - AY373270 Symbiont of E. firmum - Talamanca - ECH - OTU4 - JX998879 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX998985 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX998852 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX998853 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX998975 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX998937 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX998935 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX998942 Symbiont of E. firmum - Tilaran - EMV - OTU4 - JX998939 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX998983 Symbiont of E. firmum - Tilaran - ALO - OTU4 - JX998941 Tulasnella calospora from Paphiopedilum barbatum (Orchidaceae) - HM450046 Tulasnella bifrons - AY373290 Tulasnella calospora from PS-AT-0-1 (Orchidaceae) - GU166422 Tulasnella calospora from PS-AT-0-2 (Orchidaceae) - GU166429 717 Uncultured Cantharellales from Orchidaceae - HM451500 933 Tulasnella calospora - FJ755217 Uncultured Tulasnella from Andean forest - GU732322 Uncultured Cantharellales from Orchidaceae - HM451766 Uncultured Cantharellales from Orchidaceae - HM451522 Tulasnella calosporafrom Cymbidium sinense (Orchidaceae) - EF393622 Tulasnella calospora - AY373298 Tulasnella diliquescens - AY373291 Uncultured Cantharellales from Orchidaceae - HM451723 Uncultured Tulasnella from Stelis superbiens (Orchidaceae) - DQ178101 Uncultured Tulasnella from Stelis superbiens (Orchidaceae) - DQ178105 MOTU A MOTU B MOTU C MOTU D MOTU E MOTU F Samples from Guanacaste Tilarán Talamanca 0.2 FIGURE S2. Phylogeny of Tulasnellaceae based on 5.8S. Values at nodes represent ≥50% bootstrap support out of 1000 iterations. Epidendrum firmum symbionts are listed by mountain range, population, MOTU and GenBank accession number. Shaded bars represent samples from each mountain range. Auricularia auricula-judae - FJ462752 Auricularia auricula-judae - EU520237 Auricularia polytricha - FJ792587 Sebacina calcea - AJ427408 577 882 Sebacina sp. from Quercus douglasii (Fagaceae) - DQ974769 Symbiont of E. firmum - Tilaran - EFR - OTU19 - JX998775 Sebacina mycorrhiza from Neottia nidus-avis (Orchidaceae) - AF440658 700 Sebacina epigaea - EU819537 958 Sebacina incrustans - EU819442 Uncultured Sebacinaceae from Pleurothallis lilijae (Orchidaceae) - EU107987 Uncultured Sebacinales from Pinus sylvestris forest soil - FJ475810 Uncultured Sebacinales from Cavendishia bracteata (Ericaceae) - HM230851 Uncultured Sebacinales from Orchidaceae - JF691281 Uncultured Sebacinaceae fromStelis superbiens (Orchidaceae) - EU107986 670 Symbiont of E. firmum - Tilaran - ALO - OTU13 - JX998829 825 Symbiont of E. firmum - Guanacaste - MIR - OTU13 - JX998836 983 Uncultured Sebacina mycobiont of Phleum pratense (Poaceae) - EU910901 993fungal sp. from Dactylorhiza incarnata (Orchidaceae) - AM697891 MOTU G MOTU H Uncultured mycorrhizal fungus of Dactylorhiza incarnata (Orchidaceae) - AJ549120 Uncultured Sebacinales Ceratandra grandiflora(Orchidaceae) - FJ788822 Sebacina vermifera (Oberw.) P. Roberts isolate K228 - EU625993 Sebacina vermifera (Oberw.) P. Roberts isolate K224 - EU625991 502 Sebacina vermifera from Eriochilus scaber (Ericaceae) - FN663136 Epacris pulchella (Ericaceae) root associated fungus - AY627837 Uncultured Sebacinales from Orchidaceae - HM451799 Uncultured Sebacina from Veratrum album (Melanthiaceae) - HQ154305 683 Uncultured Sebacinales from Pterygodium catholicum (Orchidaceae) - FJ788816 Uncultured Sebacina mycobiont of Riccardia palmata (Aneuraceae) - EU909229 648Uncultured Sebacina from Thuidium tamariscinum (Thuidiaceae) - HQ154340 Uncultured Sebacinales from Hieracium murorum (Asteraceae) - FJ556816 Uncultured Sebacinales from Orchidaceae - HM451829 Uncultured Sebacina from Pseudotsuga menziesii forest soil - HM488520 Uncultured Sebacinales from Orchidaceae - JF691443 Uncultured Sebacinales from Orchidaceae - HM451823 Uncultured Sebacinales from Orchidaceae - HM451794 Uncultured Sebacinales from Orchidaceae - HM451817 Uncultured Sebacinales from Cavendishia bracteata (Ericaceae) - HM230849 Uncultured fungus from peatlands - AM260833 Uncultured fungus from peatlands - AM260832 Uncultured Sebacinales from Disterigma sp. (Ericaceae) - FN663809 Uncultured mycorrhiza from Disterigma microphyllum (Ericaceae) - EU625929 Uncultured Sebacinales from Gaultheria erecta (Ericaceae) - HM230858 501Uncultured mycorrhiza from Disterigma alaternoides (Ericaceae) - EU625982 Uncultured mycorrhiza from Disterigma alaternoides (Ericaceae) - EU625983 Uncultured mycorrhiza from Disterigma microphyllum (Ericaceae) - EU625936 Uncultured Sebacinales from Vaccinium poasanum (Ericaceae) - FN663820 Uncultured Sebacinales from Vaccinium poasanum (Ericaceae) - FN663801 654 Uncultured Sebacinales from Cavendishia nobilis (Ericaceae) - FN663693 Uncultured mycorrhiza from Ceratostema oellgaardii (Ericaceae) - EU625950 Uncultured Sebacinales from Ceratostema reginaldii (Ericaceae) - FN663631 Uncultured Sebacinales from Disterigma alaternoides (Ericaceae) - FN663645 Uncultured fungus from peatlands - AM260834 Uncultured Sebacinales from Orchidaceae - HM451820 Uncultured Sebacinaceae from Pleurothallis lilijae (Orchidaceae) - EU107991 Uncultured Sebacinaceae from Epipactis palustris (Orchidaceae) - AY634132 Sebacina vermifera mycorrhiza from Caladenia tesselata (Orchidaceae) - DQ983816 527 Uncultured Sebacinaceae from Caladenia formosa (Orchidaceae) - AY330695 Uncultured Sebacinales from Orchidaceae - HM451809 665 Uncultured Sebacinales from Orchidaceae - HM451811 826 Uncultured Sebacinales from Pterygodium catholicum (Orchidaceae) - FJ788824 Uncultured Sebacinales from Orchidaceae - JF691222 Uncultured Sebacinales of Pterygodium acutifolium (Orchidaceae) - FJ788825 Uncultured Sebacinales of Pterygodium acutifolium (Orchidaceae) - FJ788826 Uncultured Sebacinales from Orchidaceae - HM451801 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998815 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998844 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998831 Symbiont of E. firmum - Talamanca - ECH - OTU17 - JX998777 Symbiont of E. firmum - Tilaran - EFR - OTU17 - KC140566 Symbiont of E. firmum - Tilaran - CAB - OTU17 - JX998779 Symbiont of E. firmum - Guanacaste - MIR - OTU17 - JX998801 Symbiont of E. firmum - Tilaran - EMV - OTU17 - JX998819 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998840 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998813 Symbiont of E. firmum - Tilaran - CAB - OTU17 - JX998781 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998842 Symbiont of E. firmum - Tilaran - UMV - OTU17 - JX998825 Symbiont of E. firmum - Guanacaste - MIR - OTU14 - JX998837 Symbiont of E. firmum - Talamanca - ECH - OTU14 - JX998834 Symbiont of E. firmum - Tilaran - UMV - OTU16 - JX998828 Symbiont of E. firmum - Tilaran - ETT - OTU16 - KC140565 Symbiont of E. firmum - Guanacaste - MIR - OTU16 - JX998798 Symbiont of E. firmum - Talamanca - ECH - OTU16 - JX998789 Symbiont of E. firmum - Tilaran - CAB - OTU16 - JX998778 Symbiont of E. firmum - Talamanca - ECH - OTU16 - JX998774 Symbiont of E. firmum - Tilaran - ECE - OTU16 - JX998782 Symbiont of E. firmum - Talamanca - ECH - OTU16 - JX998833 Symbiont of E. firmum - Tilaran - UMV - OTU17 - JX998827 Symbiont of E. firmum - Guanacaste - MIR - OTU17 - JX998797 Symbiont of E. firmum - Tilaran - EMV - OTU17 - JX998816 Symbiont of E. firmum - Tilaran - EFR - OTU17 - JX998839 Symbiont of E. firmum - Tilaran - UMV - OTU17 - JX998826 Symbiont of E. firmum - Tilaran - ETT - OTU17 - JX998795 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998814 Symbiont of E. firmum - Tilaran - UMV - OTU17 - JX998848 Symbiont of E. firmum - Guanacaste - ERP - OTU17 - JX998824 Symbiont of E. firmum - Tilaran - ETT - OTU17 - JX998793 Symbiont of E. firmum - Tilaran - CAB - OTU17 - JX998812 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998843 Symbiont of E. firmum - Guanacaste - ERP - OTU17 - JX998823 Symbiont of E. firmum - Tilaran - ETT - OTU17 - JX998792 Symbiont of E. firmum - Tilaran - EFR - OTU17 - JX998805 Symbiont of E. firmum - Tilaran - EFR - OTU17 - JX998838 Symbiont of E. firmum - Tilaran - EFR - OTU17 - JX998810 Symbiont of E. firmum - Tilaran - EMV - OTU17 - JX998822 Symbiont of E. firmum - Tilaran - ECE - OTU17 - JX998784 Symbiont of E. firmum - Tilaran - EMV - OTU17 - JX998820 Symbiont of E. firmum - Tilaran - ETT - OTU17 - JX998796 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998776 Symbiont of E. firmum - Tilaran - ECE - OTU17 - JX998788 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998830 Symbiont of E. firmum - Tilaran - EMV - OTU17 - JX998818 Symbiont of E. firmum - Tilaran - ECE - OTU17 - JX998787 Symbiont of E. firmum - Guanacaste - MIR - OTU17 - JX998800 Symbiont of E. firmum - Tilaran - UMV - OTU17 - JX998847 Symbiont of E. firmum - Tilaran - EMV - OTU17 - JX998817 Symbiont of E. firmum - Tilaran - ECE - OTU17 - JX998785 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998845 Symbiont of E. firmum - Tilaran - EMV - OTU17 - JX998791 Symbiont of E. firmum - Tilaran - EMV - OTU15 - JX998835 Symbiont of E. firmum - Tilaran - EFR - OTU17 - JX998809 Symbiont of E. firmum - Tilaran - CAB - OTU17 - JX998780 Symbiont of E. firmum - Tilaran - CAB - OTU17 - JX998832 Symbiont of E. firmum - Tilaran - ALO - OTU17 - JX998841 Symbiont of E. firmum - Tilaran - EFR - OTU17 - JX998804 621 Symbiont of E. firmum - Talamanca - ECH - OTU17 - JX998790 Symbiont of E. firmum - Tilaran - EFR - OTU17 - JX998808 Symbiont of E. firmum - Guanacaste - MIR - OTU17 - JX998803 Symbiont of E. firmum - Tilaran - ECE - OTU17 - JX998783 Symbiont of E. firmum - Tilaran - ECE - OTU17 - JX998786 Symbiont of E. firmum - Guanacaste - MIR - OTU17 - JX998799 Symbiont of E. firmum - Tilaran - UMV - OTU17 - JX998846 MOTU J Samples from Guanacaste Tilarán Talamanca MOTU I MOTU K MOTU L 0.09 FIGURE S3. Phylogeny of Sebacinales based on 5.8S. Values at nodes represent ≥50% bootstrap support out of 1000 iterations. Epidendrum firmum symbionts are listed by mountain range, population, MOTU and GenBank accession number. Shaded bars represent samples from each mountain range. Sistotrema sp. - AF345558 Ceratobasidium goodyerae-repentis - AF345556 Ceratobasidium sp. - AY293252 857 830 884 1000Tulasnella deliquescens - AY382798 Uncultured Tulasnellaceae of Cypripedium reginae (Orchidaceae) - EF370068 Uncultured Tulasnellaceae of Cypripedium californicum (Orchidaceae) -EF370080 Tulasnellaceae of Cypripedium calceolus (Orchidaceae) - AY578249 526Uncultured Uncultured Tulasnellaceae of Cypripedium calceolus (Orchidaceae) - EF370071 Uncultured Tulasnellaceae of Cypripedium montanum (Orchidaceae) - AY578247 Uncultured Tulasnellaceae of Cypripedium macranthon var. rebunense (Orchidaceae) - EF370075 Uncultured Tulasnellaceae of Cypripedium fasciculatum (Orchidaceae) - AY578241 667Uncultured Tulasnellaceae of Cypripedium reginae (Orchidaceae) - EF370069 Tulasnella cystidiophora - AY856080 Mycorrhiza of Neuwiedia veratrifolia (Orchidaceae) - AF490613 543 Uncultured Tulasnellaceae of Cypripedium candidum (Orchidaceae) - AY578251 963Uncultured Tulasenllaceae of Cypripedium macranthon var. rebunense (Orchidaceae) - EF370077 Tulasnella violea - AY382814 885 Epulorhiza albertensis of Dactylorhiza majalis (Orchidaceae) - AF345563 Tulasnella tomaculum - AY382812 608Tulasnella violea - AY382813 581Tulasnella eichleriana - AY382799 Symbiont of E. firmum - Guanacaste - MIR - OTU30 - JX999019 598Tulasnella pruinosa - AF518724 965 Tulasnella pruinosa from Dactylorhiza majalis (Orchidaceae) - AF345561 Symbiont of E. firmum - Tilarán - CAB - OTU30 - JX999017 irregularis - AF345560 957Tulasnella Tulasnella irregularis - AD001656 Tulasnella albida - AY382804 764 Symbiont of E. firmum - Guanacaste - MIR - OTU30 - JX999020 Tulasnella violea - AY382815 Symbiont of E. firmum - Guanacaste - MIR - OTU30 - JX999018 Symbiont of E. firmum - Tilarán - EMV - OTU28 - JX999012 Symbiont of E. firmum - Tilarán - UMV -OTU29 - JX999013 945 Symbiont of E. firmum - Tilarán - ALO - OTU29 - JX999015 977Symbiont of E. firmum - Tilarán - UMV -OTU29 - JX999014 Symbiont of E. firmum - Tilarán - ESR - OTU31 - JX999039 Symbiont of E. firmum - Guanacaste - RIN - OTU31 - JX999035 Symbiont of E. firmum - Tilarán - ESR - OTU31 - JX999042 Symbiont of E. firmum - Tilarán - ALO - OTU31 - JX999045 Symbiont of E. firmum - Tilarán - ALO - OTU31 - JX999044 Symbiont of E. firmum - Guanacaste - RIN - OTU31 - JX999036 Mycorrhiza of Neuwiedia veratrifolia (Orchidaceae) - AF490609 Symbiont of E. firmum - Tilarán - ESR - OTU31 - JX999041 Symbiont of E. firmum - Guanacaste - RIN - OTU31 - JX999034 Symbiont of E. firmum - Tilarán - ECE - OTU31 - JX999026 Symbiont of E. firmum - Tilarán - ETT - OTU31 - JX999043 Symbiont of E. firmum - Talamanca - ECH - OTU31 - JX999037 Symbiont of E. firmum - Tilarán - ETT - OTU31 - JX999030 Symbiont of E. firmum - Tilarán - CAB - OTU31 - JX999025 Symbiont of E. firmum - Tilarán - UMV -OTU31 - JX999028 Symbiont of E. firmum - Tilarán - UMV -OTU31 - JX999027 Uncultured Tulasnella of Paphiopedilum armeniacum (Orchidaceae) - FJ786686 Symbiont of E. firmum - Tilarán - ESR - OTU31 - JX999040 Symbiont of E. firmum - Guanacaste - RIN - OTU31 - JX999032 Symbiont of E. firmum - Tilarán - ETT - OTU31 - JX999029 Symbiont of E. firmum - Tilarán - ECE - OTU31 - JX999023 Symbiont of E. firmum - Talamanca - ECH - OTU31 - JX999038 Mycorrhiza of Neuwiedia veratrifolia (Orchidaceae) - AF490612 Tulasnella danica - AY382805 Symbiont of E. firmum - Tilarán - ECE - OTU31 -T014ECE20R1 Tulasnella calospora - AY382801 Symbiont of E. firmum - Tilarán - ECE - OTU31 - JX999022 MOTU C & D Unmatched (E) MOTU E MOTU F (some C) Samples from Guanacaste Tilarán Talamanca 0.1 FIGURE S4. Phylogeny showing Tulasnellaceae based on mtLSU. Values at nodes represent ≥50% bootstrap support out of 1000 iterations. Tip labels include mountain range, population, mtLSU MOTU and GenBank accession number. Bars show corresponding MOTU labels from ITS. Sequences from plants yielding ITS MOTUs C and D were not clearly differentiated by mtLSU. One mtLSU sequence was obtained from a plant for which no ITS sequence was be obtained, but this sequence is similar MOTU E. Plants yielding the most common ITS MOTU, F, also yielded the most common mtLSU MOTU. This large clade also contained one sequence from a plant that only yielded MOTU C in ITS analysis. This plant probably was colonized by multiple mycorrhizal taxa. Sample T014ECE20R1 yielded a sequence that was too short for a GenBank accession number, but is listed here: TATATTAATGGCATTGGGCAAAATTCGCTTTCTATACAAAGATATTATTCGTCGCAG AAAGCTGTGTTTTAAGTAAACAGTCGGGGCCTCCGATTCTGTGCCACCACTTTATAT TATAAATAATATTCAGTGGTTCTTCATATCGTCTAACTTATGAGGATAATTTGCCGAG A TABLE S3. The diversity of Tulasnellaceae and Sebacinales based on ITS. N = the number of sequences in the analysis (number of plants contributing sequences, if different), π = rarefied nucleotide diversity, NH = the number of haplotypes (number of phylogenetically distinguishable haplotypes, if different) and SESMPD = the standardized effect size of mean phylogenetic distance, where negative values indicate phylogenetic clustering and positive values indicate phylogenetic evenness (* indicates P > 0.05 based on 999 random draws from the sample pool). NA indicates no analysis was possible (e.g. a single phylogenetically distinguishable taxon was present and SESMPD meaningless). Sebacinales sequences were not detected in ESR and the association between one plant and Sebacinales subgroup A in EFR was excluded from analysis. Tulasnellaceae N π ERP 4 MIR Sebacinales SESMPD N π 0.033 2 -1.278 2 0.004 2 (1) NA 8 (6) 0.228 6 (4) -0.326 8 (6) 0.041 7 (5) 0.956 Mean 6 (5) 0.131 4 (3) -0.802 5 (4) 0.023 4.5 (3) NA Total 12 (10) 0.263 8 (5) -0.693 10 (8) 0.034 7 (5) 1.001 NH NH SESMPD Guanacaste Northern Tilarán UMV 4 0.057 2 -1.236 7 (6) 0.007 3 (2) -0.654 EMV 12 0.064 4 (3) -1.815* 8 (5) 0.013 6 (4) -0.868 ETT 5 0.195 3 0.037 5 (4) 0.006 4 (2) -0.788* ALO 11 0.074 4 -2.321* 13 (10) 0.039 8 (4) 1.397 CAB 3 0.044 2 -1.367 6 (5) 0.006 4 (3) -0.914* EFR 3 0.203 3 -0.045 8 0.005 2 (1) NA Mean 6.3 0.106 3 (2.8) -1.125 7.8 (6.3) 0.013 4.5 (2.7) -0.365 Total 38 0.132 13 (7) -1.404 47 (38) 0.016 10 (16) 0.148 Southern Tilarán ECE 8 0.172 6 (4) -0.881 7 (5) 0.010 7 (2) -0.571 ESR 5 0.030 2 (1) NA - - - - Mean 6.5 0.101 4 (2.5) NA - - - - Total 13 0.145 8 (4) -0.784 - - - - Tilarán mean 6.4 0.105 3.3 (2.7) -1.090 7.7 (6.1) 0.013 5 (2.4) -0.400 Tilarán total 51 0.141 15 (7) -1.427 54 (43) 0.017 18 0.156 7 (6) 0.173 4 (3) 1.511 6 (5) 0.009 5 (4) -0.633 Talamanca ECH Species Level Mean 6.4 (6.1) 0.116 3.5(2.9) -0.702 7.0 (5.6) 0.014 4.9 (2.9) -0.180 Total 70 (67) NA 70 (56) 0.202 21 (10) 0.018 23 (14) NA