Richardson 1
Fall 08
Cloning of DMC1from Tetrahymena
Spencer Richardson and Dillon Gray
Dr. Smith
Fall 08
Abstract
DMC1 is a meiosis specific RAD51 homolog required for recombination repair of meiotic
double strand breaks.1 The widely conserved DMC1 has a critical role in meiosis in most sexual
organisms, but what its molecular functions are and how and why it differs from its cousin
RAD51 are not well understood.2 The goal of our experiment is to discover genes in
Tetrahymena that contain homologs of another disease causing gene that has been found in other
organisms. In the experiment, we will be using different techniques to achieve our final goal of
the plasmid. By putting our gene, DMC1 on a plasmid, will allow us to store the plasmid for late
use by other scientist around the world. By, storing DMC1 on a plasmid it will allow further
study of the role of the gene and better understand what the DMC1 does in the cell and in the
body. The long term goal of this project is to see how DMC1 actually affects the cell and to
confirm its role in meiosis.
Introduction
Our experiment is a 7 week long study where we will try to clone a gene from the ciliate
Tetrahymena into a plasmid that will then have the ability to be used by other researchers around
the world in their research. We are first looking for homologs in Tetrahymena of the gene Mus
musculis DMC1. Once found we then isolated the Tetrahymena genomic DNA, to get it ready for
Richardson 2
Fall 08
PCR. “Polymerase chain reaction (PCR) enables researchers to produce millions of copies of a
specific DNA sequence in approximately two hours. This automated process bypasses the need
to use bacteria for amplifying DNA.”3 DMC1 is a necessary part of meiosis-specific
recombination and is a paralog of RAD51. Like RAD51 recombinant human DMC1 protein forms
octameric rings that are capable of binding DNA and forming helical nucleoprotein filaments
that catalyze strand exchange.4 DMC1 has a critical role in meiosis in most sexual organisms,
but how and why it differs from its cousin RAD51 are not well understood.2 DMC1 exchange
uses a special pathway of homologous recombination that repairs DNA double-strand breaks,
basically, the cell deliberately damages its own DNA and then uses the repair process to lock
homologous chromosomes together.2 We are going to continue to work with DMC1 and get a
better understanding of how it is related to RAD51.
Methods and Procedure
Bioinformatics: Molecular Computational Tools
We started out locating the amino acid sequence of Mus musculis DMC1 at
www.ncbi.nlm.nih.gov/. We then used the sequence that best described our protein and entered it
in to the Tetrahymena Genome Database at www.ciliate.org/. After finding the homolog’s we
used the Tetrahymena Genome database again to find the protein sequence. We also located the
NST and ESTs. After determining all the information we determined if out proteins stop and start
introns were predicted. Finally we compared our protein sequence to our homolog. Complete
protocol can be found in BMS 110 Honors Lab 3, fall 2008.
Tetrahymena Genomic DNA Isolation
Richardson 3
Fall 08
First we started off the procedure by pipeting about 1.4mL of Tetrahymena culture into a
micro centrifuge tube. After swirling we collected the cells by centrifugation for 1 minute at
10,000rpms. We quickly poured off the supernatant, which is the clear liquid that lies above a
sediment or precipitate5, then proceeded by adding 700µl of lysis buffer and pipeted up and
down to mix and re-suspend the cells. After we phenol-extracted the lysate, by adding 600µL of
a 1:1 phenol: choloroform mix. We then gently shook the tube to mix the phenol through entire
tube. We then centrifuged the mixture for 5 minutes at maximum speed. After the centrifuging
process we transferred the top layer to a new tube using a pipette. We then repeated the phenol
extraction one more time to fully make sure we did everything correct. After words we added
150µl of 5M NaCl to the extracted lysate, and then precipitated the DNA by adding an equal
volume of isopropyl alcohol to the lysate, inverting the lysate-alcohol mixture 10 times, and
allowing the mixture to stand for 10 minutes. We then centrifuged the mixture on maximum
speed for 5 minutes before decanting the supernatant into a collection beaker and adding 500µL
of 70% ethanol. We then centrifuged the precipitate for 3 minutes at maximum speed removing
the supernatant once complete. Once dry we then added 50µL of Tris-EDTA buffer, and gently
pipetting up and down to re-suspend the pellet and then proceeded to put the sample on ice.
Finally we added 1µL of RNase a (10mg/mL stock) and incubated at 37ᵒC for 10 minutes. We
then prepared dilutions of DNA. I made the 1:200 dilution using 1µL of DNA and 199µL H20,
while Dillon prepared the 1:100 dilution. We then put our dilutions into the spectrometer and got
the readings for A260 and A280. We used the A260 to find our concentration of our original stock
DNA solution. Full protocol can be found in BMS 110 Honors Lab 4, fall 2008.
Polymerase Chain Reaction (PCR)
Richardson 4
Fall 08
We set up 4 reactions, using a master mix allowing for one extra reaction in case of error while
pipeting. We pipeted 1.8µL of genomic DNA, 1.25µL of TF primer and TR primer, .5µL
phusion polymerase, 10µL HF buffer, 1µL of .2mM dNTPs, and 35.82µL of sterile distilled
water into each tube or 50µL of the master mix for the reaction. Then I put two genomic DNA
templates into 58.4ᵒC bath and a 50.0ᵒC baths in the thermo cycler for 34 cycles. Dillon put his
two genomic templates in the baths at 59.55ᵒC and 60.7ᵒC. The Tf Primer was
5’- CAC CCT CGA GAA CGA TTG TTA CTC TGA TAA AGA AG- 3’. The TR primer was
5’-CCT AGG TCA ACC AGT AGA AGG CTT TTT ATC -3’. Complete protocol can be found
in BMS 110 Honors Lab 5, fall 2008.
Agarose Gel Electrophoresis
Our lab instructor had our agarose gels prepared for us when we got to class. After the gel was
set, we took the casting tray out from pouring position and placed so the wells are oriented so the
PCR samples run down the gel. We then covered the gel with 1X TAE until it just covered the
gel and there was no longer a glare coming off the gel. After, we removed the comb from the gel
to begin the process of loading the gel. For loading the gel we first added 1µL of 10X sample
dye onto a piece of parafilm for each PCR tube, and then we loaded 5µL of 1 kb ladder to the
first lane. We then pippeted 10µL of our sample on to the dot of 10X dye. We then loaded it on
the gel in the lanes next to the ladder. After the samples where in the gel, we setup the power
supply to run at 90 volts for just under 1 hour and 15 minutes. We then took the gel to the UV
light box and took pictures of the gel. Complete protocol can be found in BMS110 Honors lab 6,
fall 2008.
PCR Product Cleanup and Cloning
Richardson 5
Fall 08
We started by using Dr. Smiths PCR reaction because ours did not produce product. We then
pipette 320µl of distilled water into the sample reservoir, before adding 40µL of each of Dr.
Smiths PCR reactions 1 and 2. We then centrifuged the Montage PCR for 15 minutes and then
placed the reservoir in a clean vial, to add 20µL of distilled water. We then inverted the reservoir
into another clean vial and centrifuged for 2 minutes. We then made a 1:50 dilution and ran them
through the spectrophotometer at A260 and A 280 to determine the DNA concentration. After
determining our concentration we created new solutions adding components to Dr. Smith’s two
PCR reactions and also created a negative control. The first solution we used 1.4µL PCR
product, 1.0µL salt solution, 2.6µL sterile water and 1.0µL TOPO vector. The second solution
was created by taking .5µL PCR, 1.0µL salt solution, 2.5µL sterile water, and 1.0µL TOPO
vector. The negative solution was made by not adding any PCR, 1.0µL salt solution, 4.0µL
sterile water, and 1.0µL TOPO vector. We mixed the reactions by gently pipeting then
incubating for at least ten minutes at room temperature. We then took thawed E. Coli vials, and
added 2µL of the TOPO cloning reaction, and incubated for 10 minutes. After incubating we
used heat shock for 30 seconds, and immediately put them back on ice. We then added 250µL of
SOC medium, and transfer the tube to the shaking incubator set at 37ᵒC for 1 hour, laying them
horizontally. After taking the tubes out of the incubator we spread 200µL to a plate containing
50µg/mL kanamycin, then incubating overnight at 37ᵒC. Full protocol can be found in BMS 110
lab 7, Fall 2008.
Construction of Plasmid Map
We first started off the lab by selecting the sequence from the PCR reaction including the primer
sequence, and entered it into the TOPO-D plasmid using Gene Construction Kit 3.0. We first
started by deleting the junction markers, and then changed the colors of our gene sequence and
Richardson 6
Fall 08
introns. Later we marked all the restriction sites that correspond to a list of commonly used
restriction enzymes in lab. We entered in all the restriction enzymes and then determined that
BGLII would be the best enzyme digest, to confirm we have our gene in the plasmid. We then
changed the view to determine how many bands our gene should produce. Full protocol can be
found in BMS 110 Honors lab 8, Fall 2008.
Plasmid Purification
The day before the lab we prepared by adding 6ml of LB with 50µg/ml Kanamycin in three glass
tubes, one for each colony. We then took a new LB/KAN plate and gridded it and numbered it 16. We then took a 6-inch sterilized wooden stick and picked up a colony from our cloning
transformation plate and placing it on the corresponding number on the grid. After transferring
swirled the stick around in liquid LB/KAN, and then put our test tubes in 37ᵒ C shaking incubator
overnight. After a night of incubation we labeled 3 tubes for each culture ex. 1a, 1b, 1c, 2a… 9
totals. We then started pipeting around 1.4mL culture into each of the three tubes with the
corresponding numbers. Once all 9 tubes are full we centrifuged for 3 minutes. We then poured
off supernatant and then added 250µL Buffer P1 into the 1a, 2a and 3a tubes. For each culture
we re-suspended the pellet by pipetting up and down slowly, then transferring it into the second
tube to re-suspend, and transferring to third tube to completely re-suspend. We then added
250µL Buffer P2 and inverted the tubes to make them blue making sure there was no white
precipitate. Soon after it turns completely blue we added 350µL Buffer N3 to turn the solution
back to a clear liquid, followed by centrifuging from 10 minutes. We then put the supernatant
into a QIAprep spin column, and centrifuged for 1 minute then discarding the flow through. We
then added 500µL Buffer PB to the column and centrifuged for 1 minute, discarding the flow
through. We then added 750µL Buffer PE and centrifuged for 1 minute discarding the flow
Richardson 7
Fall 08
through and centrifuged an additional 1 minute. We then placed the column in a new 1.5 mL
tube and added 50 µL Elution Buffer and let stand for 2 minutes before centrifuging for 1
minute, followed by discarding the column. We then placed the tubes on ice and stored them at
-20ᵒC. We then determined our restriction buffer and made a cocktail for digest using 2 µL of
10X buffer 0.5 µL BAGLII and 15.5 µL water. We made then multiplied the cocktail 7 times to
give us our desired amount. We proceeded by putting 18µL of the cocktail in tubes, followed by
adding 2 µL of each plasmid to its appropriate tube and mixed by pipetting. We then incubated
for 37ᵒ C for 1 hour. Complete protocol can be found in BMS 110 lab 9, Fall 2008.
Results
T.t. DMC1 Genomic = 1366 bp & cDNA = 1163 or 1084 bp
CACCCTCGAGAACGATTGTTACTCTGATAAAGAAGATAATGAAGAATAAAACTAAATTGCTCAAGAAGAG
ATCTTTTTAGTAGAAATGCTTGCAACTGAGGGAGTTAACAATAATGAAATACAAAAGCTTAAAAAGGTAT
GTAGTTGTTATATTAATTCACAATAAGACAATATCATTGATTATATAAAAATAAATATAAAGAATGGAAT
CCTTTCACTCAAATCTTTAGTTATGAACACAAAGAGGGATCTTGTTAATATCTATGGAATTCCTGATAAT
AAAGCTGATTCATATGTCAAAAAAGCTTCAGAAATATTAGCTCGATCTGAAAACAGCAGGTTATTCAGCA
GTGAGTTTGTTCTCGGTACTACTGTACTATAAAGAAGGAGTTAAATAAGAAGAATATCAACAGGATCCAA
GGCTTTAGATGATATATTGAATGGGGGAATAGAGTCTCAAAGCATAACAGAATTTTATGGAGAATATCGT
TCAGGCAAAACATAAATAGCTCATACTGCATGCGTTCTGGCTCAATCTTAAGATCATTGCTAAAGTAAAA
CAAGCATAAGAAATTTTAACTGGTTTTAAATAAATTATTCTGCTTAAATATAGCCATTTAAATAAAAAAA
TAGGTCCAGGAAAAGTTTTATACATTGATACTGAAGGAACCTTCAGACCTGAAAGAATATGCTAAATAGC
TTCGCACTACGGAATGGAGGGTGAATATGCCCTAAGTAATATAATTTATGGGAGAGCCTATAACGTAGAT
TAATAAAACACATTGCTTATTAAAGGAGCCCAATTAATGGTAGAGGAAAATTGTTTTGCTCTACTAGTTG
TTGATTCAATAATGGCTAATTTTAGATGCGATTTTTCTGGAAGAGGAGATCTCTCTGAAAGACAATAAGC
ACTTGGCAAGTTTATGAGCAGATTATAAAGAATGGCTGCTGAATTTAATATCGCAGTGGTAAATAAATAC
ATTCTTTATTTTATCAACACCTTTCTGCTTTTATACGATTCTTATTCTTAAAATTAACAAACAGATTATA
ACAAACTAAGTTATGGCTGATCCAAGTGGAGCCATGACTGGAGGCGCTATACCCTAGCCCAAGCCAATTG
GAGGCCATATTTTAGCCCATGCATCGACATAGCGCTTATTCATGAAGAAGAAAACTGATAACATCCGTAA
AGTAAAGTAAAACAAAACAAAACTTCTTAAATCACAAATAAAAAATTTTTCTTTCACTTAATTAAAGGCT
GGTTGATTCACCTTATTTGTAAGATAAAGAAGTTGATATTATGGTTAGCGACAGAGGAGTAGGAGATGTT
GAATGTGATAAAAAGCCTTCTACTGGTTGACCTAGG
Richardson 8
Fall 08
Figure 1. . Shows the genomic DNA sequence of Tetrahymena DMC1. The Red indicates the sequence
that is present in the mature RNA and the black is the sequence removed (introns). The yellow shaded
sequence corresponds to the sequence of the primers used to amplify the gene using PCR and the
underlined portion corresponds to EST’s delteted.
Mus muscalus DMC1
340
TTHERM_00142330
(6.2E-76)
RAD51
TTHERM_00459230
(5.2E-57)
DMC1
Table 1. Shows our Gene DMC1and the amount of amino acids in our protein alone with the two strongest
homolog’s
Figure1 and Table 1 were done in order to discover the homolog of MUS DMC1. We will now use this information
to determine which sequence we need to isolate. Without finding the homolog we would not be able to even start our
experiment.
A260
A280
1.112
.549
. Table 2. Shows our results from the spectrometer, at wave lengths of 260 and 280.
DNA Concentration 5.56µg/µL
DNA purity 2.0255µg/µL
Table 3. Shows the DNA concentration and Purity by using the information from table 2.
After finding the gene homolog, we isolated the DNA to find the wave lengths, concentration and purity. The purity
of the DNA looks pretty pure, which will hopefully give us good PCR product.
Richardson 9
Fall 08
Ladder 1
2
3
4
Figure 2 .1% Agarose Gel. Lane 1 had an annealing temperature of 59.55 ᵒC. Lane 2 had an annealing temperature of
60.7ᵒC. Lane 3 had annealing temperature of 58.4 ᵒC. Lane 4 had an annealing temperature of 50.0ᵒC. We received no
product in our experiment.
After running the gel (figure 2) we found little to no results in the gel. We will use this information to clean up the
PCR product, from Dr. Smith in hopes of getting better results and allow us to produce a plasmid that other scientist
can use.
A260
.028
A280
.018
Table 4. Shows the results of the clean PCR reaction in the spectrometer.
Clean PCR concentration= .07µg/µL
Clean PCR purity = 1.55
Table 5. Shows the results of the clean PCR’s concentration and purity. Found using data in table 4.
Richardson 10
Fall 08
After cleaning up the PCR our purity decreased to 1.55 which is not as high as our initial purity but closer to the
desired purity level of 1.7 to 2. We will continue through the experiment using the newly cleaned up PCR product
with the purity sitting at 1.55
We had 26 colonies on our 200µl #1 plate
Negative control plate had 16 colonies
Table 6 gives our results on our plates after cleaning up the PCR product.
Figure 3. Is a plasmid map showing all of the restriction enzymes. We used BglII as our restriction enzyme.
The plasmid map in figure 3 shows our sequence along with introns. The map is used to determine which restriction
enzyme is needed to complete our experiment. This map will helps us find the best enzyme.
Richardson 11
Fall 08
Table 7 Shows the band size that Lab 7 predicted would come out of the Gene sequence when using BglII restriction
enzyme.
Buffer:3
BSA: none
Restriction Enzyme: BglII
Incubation Temp.: 37ᵒC
Predicted Band Size on Gel: 3124 & 818
Table 8 shows the measures taken before we ran the restriction enzyme digest gel.
Figure 4 shows the bands of our gene sequence with the restriction enzyme BglII in a 1% agarose gel.
Richardson 12
Fall 08
Table 7 and figure 4 Table 7 shows the predicted base pairs for BglII in our gene. Our predicted band sizes were
3124 and 818. Our gel shows most wells had a band around 3124 but zero bands at 818. It actually appears there are
bands higher than 3124, which is not supposed to happen. With these results, we will have to look back in the
experiment to change it and improve our results.
Discussion
Through the experiment we learned a lot about ourselves and DMC1. I felt bio-formatics was the
most important part of the experiment, because if we messed up and didn’t find the correct
homolog or made an error when determining the introns, it could have messed our experiment up
before we really even started. Lab 4 was useful in being able to isolate the DNA and allow it to
be used later. I believe that the polymerase chain reaction lab is where our troubles first came up.
What actually happened is unknown right now. Up until lab 5 everything was running good, or
so we thought. We actually found out we had a problem when we ran our first agarose gel. The
gel showed that our PCR produced very few, if any base pairs in the UV picture. We are unsure
of why this happened, either error by one of us, or a weak primer sent to us by IDT. Using Dr.
Smith’s PCR gave us a little more evidence that it was IDT’s fault by giving us weak primers,
but it does not completely rule out contamination earlier on in the experiment or other error. In
hopes of returning better results we cleaned up the PCR products and cloned our PCR. The
cleaning of the PCR product did not show any more favorable results. Using the plasmid map
and mock gel allowed us to check the accuracy of our experiment by giving us the base pairs that
should be shown. Purifying the plasmid was supposed to give us the results that the plasmid map
said we should get. Unfortunately the purification process did not work exactly like we wanted.
Getting very little bands showed that our experiment encountered problems throughout the way.
In future experiments, maybe a stronger primer would help the experiment get better results.
Richardson 13
Fall 08
Some of the procedure might need a little re-working also, to see what works better. Changes
that need to be made to the overall experiment would be more careful technique when pipetting,
a better environmentally controlled location, and more time to fully focus on the lab instead of
trying to rush through. Overall the experiment was a great learning tool, and experience. I have a
better understanding of techniques used to clone Tetrahymena genes. We also learned the
complicated process of getting genomic material and putting it into a plasmid for use by later
scientist. DMC1 needs to continue to be worked on to fully understand the function it has in
meiosis.
Richardson 14
Fall 08
References
1.Bannister, Laura A., Roberto J. Pezza, Janet R. Donaldson, Dirk G. De Rooij, Kerry J.
Schimenti, R. Daniel Camerini-Otero, and John C. Schimenti. "A Dominant, RecombinationDefective Allele of DMC1 Causing Male-Specific Sterility." Plos Biology may 5 (2007): 1016025.
2. Neale, Matthew J., and Scott Keeney. "Clarifying the mechanics of DNA strand exchange in
meiotic recombination." Nature July 442 (2006): 153-58.
3."Polymerase Chain Reaction." Gene Almanac. Dolan DNA Learning Center. 10 Oct. 2008
<http://http://www.dnalc.org/ddnalc/resources/pcr.html>
4. Thorslund, Tina, Fumiko Esashi, and Stephen C. West. "Interactions between human BRCA2
protein and the meiosis-specific remobinase DMC1." The EMBO Journal 26 (2007): 2915-922.
5."Supernatant." Dictionary.com. Dictionary.com. 10 Oct. 2008
http://http://dictionary.reference.com/browse/supernatant
6. BMS 110 Honors Lab, fall 2008, Missouri State University, Springfield, MO