Supplementary Material Effect of concentrated polymer brushes on

advertisement
Supplementary Material
Effect of concentrated polymer brushes on the expression of inflammatory and angiogeneic
genes in human umbilical vein endothelial cells
Chiaki Yoshikawa,1* Yoshihisa Shimizu,1 Junji Suzuki,1 Jun Qiu,2 Edith van den Bosch3*
1World
Premier International Research Center for Materials Nanoarchitectonics, National Institute for Materials
Science (NIMS), Tsukuba, Ibaraki 305-0047, Japan
2DSM
Ahead, P.O. Box 18, 6160 MD Geleen, The Netherlands
3DSM
Biomedical, P.O. Box 18, 6160 MD Geleen, The Netherlands
Materials
2-Hydroxyethyl acrylate (HEMA) (99%, Wako Pure Chemical, Osaka, Japan) was purified as
previously reported [1]. Poly(ethylene glycol) methyl ether mehtacrylate (average Mn ~475)
(PEGMA) (Aldrich) was purified by passing through neutral alumina. Cu(I)Br (99.9%, Wako
Pure Chemical, Japan), ethyl 2-bromoisobutylate (EBIB) (99%, Wako), 2, 2’-bipyridine (bpy)
(99%, NacalaiTesque, Japan), methanol (99%, Nacalai), anisol (99%, Wako), Lipopolysaccharide
(LPS) from E. coli O127 Phenol extraction (Wako) were used as received. (2-bromo-2isobutyloxy)propyltriethoxysilane (MUBIB) was synthesized according to the literature [2].
Preparation of the patterned CPB surfaces.
A patterned gold silicon wafers were immersed in an ethanol solution of MUBIB (4 wt%) for 48
h at room temperature and washed several times with ethanol. Using the patterned substrate, CPBs
of PPEGMA and PHEMA were prepared by SI-ATRP as our previous report [1, 3]. As an example,
SI-ATRP of PPEGMA was shown as follows: The MUBIB immobilized substrates were
immersed in an Ar purged methanol solution of PPEGMA (0.96 M), Cu(I)Br (4.8 mM),
bipyrydine (9.6 mM), and the free initiator EBIB (4.8 mM) and the solution was kept at 30 oC for
3h. After the polymerization, the solution was diluted with eluent and analyzed by the GPC. The
PPEGMA grafted substrates were also washed with methanol.
HUVEC culture.
Human umbilical vein endothelial cells (HUVEC) (Lonza, Basel, Switzerland) were cultured in
endothelial basal medium 2 (Lonza) supplemented with EGM-2 SingleQuots (Lonza) (2% FBS)
at 37 oC in a humidified atmosphere of air containing 5% CO2. At subconfluence, the cells were
removed from the tissue culture plate polystyrene by trypsin treatment. The concentration of the
HUVECs was adjusted to 3.0104 cells/cm2 and the cells were seeded on samples and cultured
for 24 h at 37 oC in a humidified atmosphere of air containing 5 % CO2. For LPS treatment,
cultured medium on substrate was exchanged LPS (1 µg/ml) containing medium after 22 h from
start of cell culturing. The cells were cultured for additional 2 h. After culturing for 24 h, the
substrates were rinsed three times with fresh PBS and stored at -80 ˚C until RNA extraction.
Visualization of adhered cells.
Following cell culture, the cells on the test substrates were washed three times with PBS and fixed
with 4% paraformaldehyde in PBS for 20 min at room temperature. The samples were
permeabilized with 0.1% Triton X-100 in PBS, and incubated with Phalloidin-Alexa546
(Invitrogen, MA, USA) to visualize F-actin. The stained cells were further washed and mounted
with ProLong Gold antifade reagent with DAPI (Invitrogen). The adherent cells were observed
by a fluorescence microscope.
RNA isolation and first strand cDNA synthesis
Total RNA was extracted from the HUVEC using NucleoSpin RNA II (MACHEREY-NAGEL,
Düren, Germany), according to manufacturer’s protocol. The genomic DNA were removed with
digestion by DNase on the column. The RNA contents were quantified by measuring the
absorbance at 260 nm using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies,
Inc., Wilmington, DE). All RNA samples had a 260/280 ratio greater than 2.0. First strand cDNAs
were synthesized from each 1 µg of total RNA, with using ReverTra Ace® qPCR RT Kit
(TOYOBO, Japan) according to manufacturer’s protocol.
Quantitative real-time PCR.
Gene-specific
primer
sequences
were
selected
from
Primerbank
(http://pga.mgh.harvard.edu/primerbank/) (Table S1). All primer pairs were analyzed by Blast to
ensure specificity for the intended target gene within the human genome.
Quantitative real-time PCR (qPCR) reactions were carried out in a LightCycler® ST300 (Roche,
Basel, Switzerland) using the following thermal profile: 95 ˚C for 10 minutes, 45 cycles at 95 ˚C
for 10 seconds, 55 ˚C for 20 seconds, and 72°C for 20 seconds. PCR amplification using a
LightCycler instrument was performed in 15 μL of reaction mixture consisting of a master mixture
containing FastStarttaq DNA polymerase, a dNTP mixture, buffer (LightCycler DNA Master
SYBR Green I, Roche), 2.0 mM of MgCl2, 0.5 μM of each primer, and 15 ng of template DNA in
a LightCycler Capillary. A dissociation curve was generated for each plate following the
amplification cycles by slowly cooling from 95 oC at a 2% ramp rate. PCR reactions occurred in
a final volume of 10 µL, containing 5 µL of SYBR GreenMaster Mix (Applied Biosystems), 1
µL of each 10 µM of forward and reverse primers, and 10 ng of cDNA template in 4 µl of
RNase/DNase free water.
The qPCR data analysis was performed as described in the literature [4]. Briefly, individual
crossing point (Cp) values and mean amplicon efficiencies were estimated using LinRegPCR
(Version 11.0, download: http://LinRegPCR.HFRC.nl).
The relative quantity (RQ) of each template was normalized to the RQ of the
endogenous control, GAPD or β-actin, for each sample to give the normalized relative quantity
(NRQ) for every gene of interest (GOI). The relative expression ratio (R) was calculated as the
ratio of the mean NRQ(treated) to the mean NRQ(control).
Results were expressed as the mean relative expression ratio ± standard error (n = 3).
Statistical analysis of differences in the number of successful PCR amplifications was performed
by Student’s t-tests. Values with P < 0.05 were considered significant.
References
[1] Yoshikawa C, Goto A, Tsujii Y, Fukuda T, Yamamoto K, Kimura T, Kishida A.
Macromolecules 2006;39:2284.
[2] Jones D. M, Brown A. A, Huck W. T. S Langmuir 2002, 18: 1265.
[3]Yoshikawa C, Hashimoto Y, Hattori S, Honda T, Zhang K, Terada D, Kishida A, Tsujii Y,
Kobayashi H. Chem. Letters2010;39:142.
[4] Rieu I, Powers S. J The Plant Cell, 2009, 21: 1031.
Supplementary Table 1. Gene-specific primer sequences.
Gene
Sequence
IL-6 for
AATTCGGTACATCCTCGACGG
IL-6 rev
TTGGAAGGTTCAGGTTGTTTTCT
VEGF for
CGCAGCTACTGCCATCCAAT
VEGF rev
GTGAGGTTTGATCCGCATAATCT
IL-8 for
ACTGAGAGTGATTGAGAGTGGAC
IL-8 rev
AACCCTCTGCACCCAGTTTTC
GAPD for
AAGGTGAAGGTCGGAGTCAAC
GAPD rev
GGGGTCATTGATGGCAACAATA
-actin for
CATGTACGTTGCTATCCAGGC
-actin rev
CTCCTTAATGTCACGCACGAT
Supplementary Scheme 1. Schematic illustration of the preparation of patterned CPBs.
Supplementary Fig. 1. qPCR analysis of IL-6, IL-8 and VEGF expression of HUVECs cultured for 24h
on
micro-patterned PPEGMA-CPBs. The copy number of genes was normalized with -actin. Y-axis
was normalized with the values obtained on silicon wafers. Values are mean ± SEM (n = 3). *P < 0.05.
Supplementary Fig. 2. qPCR analysis of IL-6, IL-8 and VEGF expression of HUVECs cultured for 24h
on
micro-patterned PHEMA-CPBs. The copy number of genes was normalized with -actin. Y-axis
was normalized with the values obtained on silicon wafers. Values are mean ± SEM (n = 3). *P < 0.05.
Download