Supplementary Material
Methods for RNA extraction and quantitative real-time polymerase chain
reaction
Samples of the right ventricle and the lungs were immediately snap-frozen on dry ice.
For RNA extraction, tissue was in liquid nitrogen, reduced into small pieces, given to
900 µl Trizol (Invitrogen, Darmstadt, Germany) and further crushed using Fast
Prep®. After that chloroform (200 µl) was added, samples were homogenized and
centrifuged. The upper phase was given to 500 µl isopropanol, homogenized and
centrifuged again. The supernatant was discarded and the pellet was washed twice
with ethanol (80 %). The anhydrous pellets were dissolved in an adequate volume of
RNAase and DNAase free water.
The integrity of the RNA obtained was checked by microchannel-based
electrophoresis on a Bioanalyzer (Agilent). For reverse transcription, 1 μg of total
RNA was first digested with RNase-free DNase I (Gibco) for 15 minutes at room
temperature and then reverse-transcribed using ImProm-II Reverse Transcription
System (Promega, Madison, WI, USA) in a total reaction volume of 40 μL in
accordance with the manufacturer’s instructions. After inactivation of the enzyme by
heating to 65°C for 15 minutes, the cDNA obtained was diluted to a final volume of
150 μL with double-distilled water, and 4 μL aliquots were used per PCR in a final
volume reaction volume of 20 μL using TaqMan Universal Master Mix (2 x) under
standard thermal cycler conditions (see TaqMan User Guide, Applied Biosytems for
details) and the ABI PRISM 9600 sequence detection system. DNA sequences of the
PCR primers and FAM (carboxyfluorescein)-labelled probes were designed using
Primer Express 1.5 software (Applied Biosystems) and are summarized in Table 1.
Concentrations were 300 nM and 150 nM for primers and labelled probes,
respectively. Similar amplification efficiencies for all primer/probe sets were checked
by standard dilution curves. Expression was calculated using the ddCt method, as
described by Livak and Schmittgen,1 with the exception that the normalized
expression level of each mRNA was calculated individually using the formula:
Expression = 2(15–dCt), where dCt is the difference in cycle threshold (Ct) value
between the gene of interest and the reference gene.2 This method allows the
calculation of a standard deviation for the control samples instead of defining
expression levels to be equal to 1. Furthermore, the absolute expression level given
in arbitrary units between different transcripts can be compared directly if the same
formula is used for the calculation. Ct values were corrected for the expression levels
of ribosomal protein L32, β-2 microglobulin and β- actin mRNA levels to exclude
different starting amounts of total RNA. We observed that the calculated expression
level was independent of the housekeeping gene used, indicating that the mRNA
expression level of ribosomal protein L32, β-2 microglobulin and β-actin was not
different between the different right ventricle myocardial samples. Therefore, we
decided to normalize all mRNA expression data to that of ribosomal protein L32. The
resulting expression level shows the mean of three independent experiments ±
standard deviation (SD) and is given in arbitrary units.
Supplemental Table 1: Primer and probe sequences for real-time PCR analysis of rat atrial natriuretic peptide (ANP), rat brain natriuretic
peptide (BNP), rat procollagen-I-alpha-2 (COL1A2), connective tissue growth factor (CTGF), rat tissue inhibitor of metalloproteinase 1 (TIMP1)
and rat fibronectin.
Symbol
Forward primer (5'–3')
Reverse primer (5'–3')
Probe (5'-FAM–3'-TAMRA)
Atrial natriuretic peptide
ANP
CCTCTTCCTGGCCTTTTGG
TGTGTTGGACACCGCACTGT
TCCCAGGCCATATTGGAGCAAATCC
Brain natriuretic peptide
BNP
GCTGCAGACTCCGGCTTCT
ATCACTTGAGAGGTGGTCCCA
ACTCTGCCTGCGGCTCTTCTTTCCC
Collagen, type I, alpha-2
COL1A2
CCCAGCCAAGAATGCATACA
TCAAACTGGCTGCCACCAT
TGCCCAGGCCAACAAGCATGTCT
Tissue inhibitor of
TIMP1
CCGCAGCGAGGAGTTTCTC
GGCAGTGATGTGCAAATTTCC
TCGCGGGCCGTTTAAGGAA
B2M
GCTCGCTCGGTGACCG
GTTTTCTGAATGGCAAGCACG
TTTCTGGTGCTTGTCTCTCTGGCCG
metalloproteinase 1
β-2 microglobulin
Coagulation Factor II
ACGAGATACAGCCCAGCGTC CCTTGCACACTGGTCGCTC
TGCAGGTGGTGAACCTGCCCATT
CCACCTTTCTCGGCTTCCTT
TCCTTCAGGTGGCCGTTGGTGC
(Prothrombin)
Tissue factor (Factor III)
TF
CTTTCCCTGGAGGAGTGCC
FAM, carboxyfluorescein; TAMRA, carboxytetramethylrhodamine.
Supplemental Figure 1: Treatment with rivaroxaban starting 4 hours before MCT injection and continued for 4 days does not inhibit
development of RV hypertrophy (daily dose 10–30 mg/kg). Data are mean ± SEM (n = 9–10 per group).
RV, right ventricular; MCT, monocrotaline.
References
1. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods
2001;25:402-408.
2. Ellinghaus P, Scheubel RJ, Dobrev D, Ravens U, Holtz J, Huetter J et al.
Comparing the global mRNA expression profile of human atrial and ventricular
myocardium with high-density oligonucleotide arrays. J Thorac Cardiovasc Surg
2005;129:1383-1390.