Name: ____________________ Date: ________ Period: ___ CHAPTER 7 STUDY GUIDE Directions: Answer each question in complete sentences. Some questions are fill in the blank bubble maps so make sure to write down answers in bubble. 1. What is a restriction enzyme? What does it do? 2. What would be the complimentary strand if a DNA strand was ACTTACATCCGGGA? 3. What are the four nitrogenous bases in DNA? 4. What enzyme is responsible for transcription? 5. Describe the process of transcription? 6. What nitrogenous base in RNA takes the place of thymine? 7. What does PCR stand for? What is the purpose of PCR? 8. What is mRNA? What does it do? 9. What are the bonds between amino acids called? Name: ____________________ Date: ________ Period: ___ 10. Transcribe the following DNA strand? GGCCATGACTACCTTTCGAAGGGGC 11. According to this chart, which codon(s) will produce Alanine? U A C G U Phenylalanine Phenylalanine Leucine Leucine Isoleucine Isoleucine Isoleucine Methionine Leucine Leucine Leucine Leucine Valine Valine Valine Valine A Tyrosine STOP Tyrosine STOP Asparagine Lysine Asparagine Lysine Histidine Glutamine Histidine Glutamine Aspartic acid Glutamic acid Aspartic acid Glutamic acid C Serine Serine Serine Serine Threonine Threonine Threonine Threonine Proline Proline Proline Proline Alanine Alanine Alanine Alanine 12. Which enzymes cut DNA? 13. What is gel electrophoresis and why is it important? 14. What is recombinant DNA? What is its significance? 15. What types of RNA molecules are transcribed from DNA? G Cysteine STOP Cysteine Tryptophan Serine Arginine Serine Arginine Arginine Arginine Arginine Arginine Glycine Glycine Glycine Glycine U A C G U A C G U A C G U A C G Name: ____________________ Date: ________ Period: ___ 16. What are histones? What purpose do they serve?