DNA replication
Name ___________________________
DNA is the process by which DNA copies itself. Due to specific base pairing, each strand contains the necessary information
to reconstruct the other strand. When a cell copies a molecule of DNA, the strands separate and each strand reconstructs the
other. The result is two new identical strands of dsDNA. Each new daughter molecule is an exact replica of the parent
molecule and contains one strand from the parent and one newly synthesized strand.
Step 1: Fill in the missing nucleotides for the following DNA molecule.
ACCGTAACGCGGTATATCGCATATGCATGCGATGCTATCGCT
Step 2: Strands separate
In the large space below, rewrite the bottom
strand, completely separated from the top.
ACCGTAACGCGGTATATCGCATATGCATGCGATGCTATCGCT
Step 3: New nucleotides are added to each strand
Highlight or circle the parent strands in each new double-stranded DNA molecule.
Example 2
Step 1: Fill in the missing nucleotides for the following DNA molecule.
ATGCTAGCTGATCGATGCAAGGGCTATTAGCGCGATTCGATG
Step 2: Strands separate
In the large space below, rewrite the bottom
strand, completely separated from the top.
ATGCTAGCTGATCGATGCAAGGGCTATTAGCGCGATTCGATG
Step 3: New nucleotides are added to each strand
Highlight or circle the parent strands in each new double-stranded DNA molecule.
Example 3
Step 1: Fill in the missing nucleotides for the following DNA molecule.
TGATCGAATTACGATGTGCTAGCTGGCGCGATTCAAGGGCTA
Step 2: Strands separate
In the large space below, rewrite the bottom
strand, completely separated from the top.
TGATCGAATTACGATGTGCTAGCTGGCGCGATTCAAGGGCTA
Step 3: New nucleotides are added to each strand
Highlight or circle the parent strands in each new double-stranded DNA molecule.
Questions
1. Why is it so easy to reconstruct the opposite strand of a DNA molecule?
2. What percentage of a parent DNA molecule will be present in one daughter DNA molecule?
3. If a DNA molecule is 28% Adenine, what percentages of the other three nucleotides occur in this
DNA molecule?
4. If a DNA molecule is 16% Cytosine, what percentages of the other three nucleotides occur in this
DNA molecule?