1. DNA structure is in the form of:
5. In humans, the gene for black hair (B) is
dominant over the gene for red hair (b).
the genotype of a person with red hair
would be
a) Single Helix
b) Double Helix
2. The process if cell division that produces
the gametes in sex organs is:
a) BB
b) bb
6. The alternative forms of each gene are
called
a) Mitosis
b) Meiosis
3. If two parents have 5 children and three
are boys and two are girls what is the
chance of the sixth child being a girl?
a) 50%
b) 100%
a) Alleles
b) Gamete
7. Which of the following is possible if two
parents with black hair produced a child
with red hair?
a) Only the father has the allele for red
hair
b) Both parents have the heterozygous
genotype
4. On a Pedigree what does this symbol
mean?
a) Affected Male
b) Affected Female
Question 1
Using the pedigree above, to answer the following questions?
Page 1 of 3
a) Can you explain why all of Molly and Arthur’s children have red hair, but not all of their
grandchildren do? Use The words dominant and recessive to assist you.
(2 marks)
Molly and Arthur have red hair which means they must have homozygous recessive genotypes (bb).
This means all their children also have this genotype. However, their grandchildren may not have the
red hair phenotype because they have inherited a dominant blond or black hair gene.
b) Is there any chance of Rose inheriting any genetic information from Harry’s mother Lilly?
Rose and Harry’s mother Lily are not genetically linked but are related
(1 mark)
Question 2
(Use the diagram below to answer the following Questions)
a) What process does this diagram represent? Circle the correct response.
Mitosis
Meiosis
b) What is the purpose of this process in cells?
Reproduction
(1 mark)
Growth and repair
Page 2 of 3
(1 mark)
Question 4
Use the following DNA sequence to answer the following question.
ATGTACTCTGGGCTTATGATC
a) This DNA strand is copied to form mRNA, write out the mRNA stand that this sequence would create.
Remember that in RNA the T changes to a U
TACATGAGTCCCGAATACTAG
(1 mark)
Question 5
Brown eyes in humans is caused the dominant allele B. Blue eyes in humans is shown by the
recessive allele b.
a) If one parent has the alleles Bb what colour eyes will they have? (1 mark)
Brown
__________________________________________________________________________________
b) Complete the Punnett square (1 marks)
Male Gametes
Female
Gametes
B
b
B
BB
Bb
b
Bb
bb
c) What is the possibility of the parents from the Punnett square having a child with brown eyes?
(1 mark)
___________________75 %__________________________________________
d) What is the possibility of the parents from the Punnett square having a child with blue eyes?
(1 mark)
_____________________25%_______________________________________________________
Page 3 of 3