Name:______________________________ Date:_______________ Period:___
MRSA
YOUR WORST ENEMY
–
KNOW YOUR ENEMY AND YOU CAN CONQUER1
As a beginning for your search to know your enemy check out the following website and
links at the bottom of the page to answer the questions that follow:
Sacramento County Department of Health Services
(http://www.sacdhhs.com/article.asp?ContentID=1778)
1) What does MRSA stand for?
2) Where does the organism usually live and what does it commonly cause?
3) What is the full scientific name (genus species) for the organism (look at the fact sheet
link)?
4) Can you die from an MRSA infection?
5) What are the two kinds of MRSA infections?
6) What are the symptoms of an MRSA infection?
7) How is the infection spread? List at least six ways.
(http://www.fairview.org/healthlibrary/content/aha_mrstaphi_crs.htm)
According to news reports a student and a teacher both showed signs of the infection.
The teacher had lots of extra expenses and was working a second job as a triage nurse at
Rideout Hospital in Yuba City California. The student was an athlete at Yuba College, but
did not have a class with the teacher that became infected.
1
Developed by Denise Poteat and Mary Elizabeth
8) Hypothesize how the teacher became infected.
9) Hypothesize how the student became infected.
So you are starting to get to know the MRSA organism – how does a Staphylococcus aureus
organism become resistant to multiple antibiotics (hint review the link to the Mayo Clinic)
and find the three causes of antibiotic resistance:
8) Common causes of antibiotic resistance.
a)
b)
c)
How many can you personally control?
10) MRSA organism are resistant to which antibiotics? Name four antibiotics that the
MRSA organism is resistant to. Go to bnet.com and search under articles (at the top)
for the antibiotics
Now you are becoming more and more familiar with the nasty bug Staphylococcus aureus,
well how many different strains of Staphylococcus aureus are there? To find the answer,
go to National Center for Biotechnology Information (NCBI) website
http://www.ncbi.nlm.nih.gov. Notice on the left side bar the link to genomes called
Genomic Biology and click there. This will take you to the Genome Biology page. On the
right hand side bar notice the link to Microbial under Genome Project Database. Click the
microbial link and scroll down until you find the Staphylococcus aureus list of strains.
11) How many different strains of Staphylococcus aureus are there that have complete
genome sequences?
12) Click on the first strain of Staphylococcus aureus and a separate window will open that
presents all the genomic information for this species and its strains and answer the
following questions.
a) Which Staphylococcus aureus did you click on?
b) What is its genome length in millions of base (Mbp)
c) The genome codes for how many proteins?
d) What is the characteristic shape and growth pattern of the organism?
e) List some information about the genus Staphylococci
f) List some information about the species Staphylococci aureas
g) List some information about the subspecies you are researching.
13) Click the back to the microbial link and scroll down until you find the Staphylococcus
aureus list of strains. Find the 16313 Staphylococcus aureus subsp. aureus USA300
which has been implicated with disease outbreaks in communities and hospitals. Click on
the link for this subspecies of staph. The sequence was determined by researchers at
the University of California, San Francisco. Use the information on this page to
answer the following questions.
a) What is the accession number (NC……….) for Staphylococcus aureus subsp. aureus
USA300 chromosome?
b) How big is the chromosome (bp)?
c) How many proteins are coded for on the bacterial chromosome?
d) How many plasmids are present in this strain?
e) List each plasmid, their reference accession numbers, their size and number of
proteins below.
Plasmid ID Ref Seq Accession Number
2
Genome Size (kb2) Number of Proteins
Note 1-kilobase pair sequence = 1-1,000 base sequence = 0.001 mega base pair sequence. Recall that a mega is a million.
Comparing the Staphlococcus aureus strain you first investigated (Question 12) and the
Staphylococcus aureus subsp. aureus USA300 you just investigated (Question 13), were
there significant differences between the genome size and number of coded proteins?
You have already discovered that one of the antibiotics that Staphylococcus aureus is
resistant to is penicillin. Penicillin works by preventing a VERY important part of a
bacterial cell from forming - the cell wall. Bacterial cell walls are not made of cellulose like
plant cell walls, or chitin like fungal cells walls, instead bacterial cell walls are made of
peptiogylcan which is a carbohydrate/protein molecule.
Well, what is it that Staphylococcus aureus has that makes it resistant to penicillin?
Researchers have found what causes resistance. Gram positive bacteria like
Staphylococcus aureus can either 1) cleave the β lactam ring of penicillin outside of the cell
or 2) have a binding protein that inactivates the penicillin molecule once inside the
peptiogylcan layer of the cell allowing the bacterium to survive.
You think that if you know the genomic location of the gene(s) that allows the communitybased MRSA, Staphylococcus aureus subsp. aureus USA300, to resist penicillin you will be
able to determine if it was a community-based MRSA or a hospital based MRSA that
caused the infections in Yuba County.
14) In order to search the genome to see what and where resistance resides you can search
on the accession number: NC_007793). Once you have the genome up, you end up with a
really long page with lots of information about the genome. Click on the Genes link in the
table as shown below.
a) How many genes are there?
The Entrez gene page comes up:
You will do two searches by adding 1) and lactamase, and 2) and penicillin binding protein,
behind the NC# in the search window.
Complete the following table for the 1) lactamase ID: SAUSA300_2386 then click on the
YP_495021.1 to find out the specifics. Next complete the table for 2) the penicillin binding
protein ID: pbp2, then click on YP_494038.1 to find out the specifics.
Penicillin Resistance Protein Table
Name
Accession Number
Amino Acid (aa) Number
Molecular Weight (MW)
Beta-lactamase
Penicillin binding protein
Which resistance protein is larger and therefore would require more energy to synthesize?
Good News, after investigating the relationship between genomes and coded proteins, Dr.
Denneal Jamison-McClung and Dr. Kelly McDonald have discussed your research progress and
decided that you are ready to move on to the next step. You are handed a DNA
electropherogram for you to determine the DNA sequence and possible source of the Yuba
infection.
15) The key to decipher the electropherogram is the following:
Red: (T) thymine; Black: (G) guanine; Green: (A) adenine; and Blue: (C) cytosine
List the nucleotide sequence below:
16) Now this section of DNA electropherogram was determined after amplification of samples
obtained from the Yuba student. Using this FASTA file run a BLAST Analysis to identify the
strain.
>CGATTAAAGATAGAAATACACGATGCGAGCAATCAAATTTCATAACATCACCATGAGTTTGGTCCGAAGC
ATGAGTGTTTACAATGTTTGAATACCTTATACAGTTCTTATACATACTTTATAAATTATTTCCCAAGCTG
TTTTGATACACTCACTAACAGATATTCTATAGAAGGAAAAGTTATCCACTTATGCACATTTATAGTTTTC
AGAATTGTGGATAATTAGAAATTACACACAAAGTTATACTATTTTTAGCAACATATTCACAGGTATTTGA
CATATAGAGAACTGAAAAAGTATAATTGTGTGGATAAGTCGTCCAACTCATGATTTTATAAGGATTTATT
TATTGATATTTACATAAAAATACTGTGCATAACTAATAAGCAGGATAAAGTTATCCACCGATTGTTATTA
ACTTGTGGATAATTATTAACATGGTGTGTTTAGAAGTTATCCACGGCTGTTATTTTTGTGTATAACTTAA
AAATTTAAGAAAGATGGAGTAAATTTATGTCGGAAAAAGAAATTTGGGAAAAAGTGCTTGAAATTGCTCA
AGAAAAATTATCAGCTGTAAGTTACTCAACTTTCCTAAAAGATACTGAGCTTTACACGATTAAAGATGGT
GAAGCTATCGTATTATCGAGTATTCCTTTTAATGCAAATTGGTTAAATCAACAATATGCTGAAATTATCC
AAGCAATCTTATTTGATGTTGTAGGCTATGAAGTTAAACCTCACTTTATTACTACTGAAGAATTAGCAAA
To begin the BLAST Analysis go to the Home page NCBI (http://www.ncbi.nlm.nih.gov/), then
click on BLAST, click on nucleotide blast. You will then open your FASTA file to cut and paste
the FASTA text file to BLAST. Make sure you click other to choose the search set Database.
Scroll down to the bottom of the page, then click BLAST.
17) What is the number 1 implicated organism? Write out the full species and subspecies
name.
What is the accession number for this organism?
18) Click on the accession number to learn more about the organism. Notice, the first
PubMed link 9400512 and identify where this strain was located.
In conclusion, now revisit your hypothesis about the sources of infection for the teacher and
the student and comment on your findings.