Supplementary Material - Page
Supplementary Material
Glucocorticoid Therapy Increases Cox-2 Gene Expression in
Nasal Polyps in vivo
(ERJ-00174-2008_R1)
Authors:
Laura Pujols, PhD1,2
Pedro Benitez, MD, PhD3
Isam Alobid, MD, PhD1,2,3
Asumpció Martinez-Antón, MS1,2
Jordi Roca-Ferrer, PhD1,2
Joaquim Mullol, MD, PhD 1,2,3 *
Cèsar Picado, MD, PhD 1,2,4 *
1
Supplementary Material - Page
2
SUBJECTS AND METHODS
Diagnostic criteria. The diagnosis of severe nasal polyposis was based on criteria
described in the EP3OS document (1), i.e., nasal symptoms, nasal endoscopic
examination and CT scan of paranasal sinus, as reported elsewhere (2). The diagnosis of
asthma was established on the basis of the clinical history and the demonstration of a
reversible bronchial obstruction, as previously reported (3). Diagnosis of aspirin
intolerance was made on the basis of a clear-cut history of asthma attacks precipitated
by non-steroidal anti-inflammatory drugs (NSAID), and confirmed by aspirin nasal
challenge in patients with an isolated episode of NSAID-induced asthma exacerbation,
according to a method previously reported (4).
Reverse transcription and real-time PCR. Total RNA from the nasal tissue
specimens was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany)
following the manufacturer’s instructions. Total RNA was reverse transcribed to cDNA
using random hexanucleotide primers and SuperScript II RNase H- reverse
transcriptase, as previously reported (5,6). Quantification of Cox-1 and Cox-2
transcripts was achieved by extrapolation to a plasmid double-stranded DNA external
standard curve added in each PCR run. We provide here the detailed protocol and
validation of the real-time PCR assays for Cox-1 and Cox-2, already reported in a
previous study from our group (6).
Primer design. Cox-1 and Cox-2 primers were designed to span introns. Their sequence
was as follows: 5’ TGCCCAGCTCCTGGCCCGCCGCTT 3’ (Cox-1 sense,
nucleotides: 516-539), 5’ GTGCATCAACACAGGCGCCTCTTC 3’ (Cox-1 antisense,
nucleotides: 796-819), 5’ TTCAAATGAGATTGTGGGAAAATTGCT 3’ (Cox-2
sense, nucleotides: 574-600), 5’ AGATCATCTCTGCCTGAGTATCTT 3’ (Cox-2
Supplementary Material - Page
3
antisense, nucleotides: 855-878). The resulting PCR products were of 304 bp (Cox-1)
and 305 bp (Cox-2).
Generation of DNA external standards. After electrophoresis of Cox-1 and Cox-2 PCR
products on a 2% agarose gel, the Cox-1 and Cox-2 bands were excised from the gel
and were purified using the QIAquick Gel Extraction kit (Qiagen). The Cox-1 and Cox2 purified PCR products were immediately cloned into the pCR2.1 vector and
transformed into competent Escherichia coli INVF’ cells (Invitrogen, Paisley, United
Kingdom). Minipreparations of plasmid DNA (Qiagen) were performed for the selected
colonies. To confirm the presence of insert, the isolated plasmids were digested with
EcoRI and Hind III, and the digested products were resolved on an agarose gel. One
clone containing either the Cox-1 or Cox-2 recombinant plasmid was selected and
quantified through espectrophotometry. Dilutions of these plasmids were used as
standards in each PCR run.
Real-time PCR. A master-mix of the following reaction components (Roche
Diagnostics, Mannheim, Germany) was prepared to the indicated end-concentration: 3
mM MgCl2, forward and reverse primers (0.5 M for Cox-1, 1 M for Cox-2), 2 l of
LightCycler Fast Start DNA Master SYBR Green I®, 1 unit of heat-labile Uracil-DNA
Glycosylase (UNG), and water up to 18 l. Eighteen l of master-mix were filled in the
glass capillaries and 2 l of reverse transcribed total RNA (10 ng) or standard (plasmid
dsDNA), were added as PCR template. Capillaries were closed, centrifuged, and
incubated at room temperature for 5 min to activate UNG. UNG eliminates PCR “carry
over” contaminations from previous DNA synthesis reactions. To improve SYBR Green
I quantification, a high temperature fluorescence measurement point was performed at
each cycle (Table SI, amplification program: segment IV). Such high temperature melts
Supplementary Material - Page
4
the unspecific PCR products, e.g., primer dimers, eliminates the non-specific
fluorescence signal and ensures an accurate quantification of the desired product.
The following real-time PCR protocol was used: 1) a denaturation program (95ºC for 10
min), which inactivates UNG and activates Fast Start DNA polymerase, 2) a foursegment amplification and quantification program repeated 40 times, with a single
fluorescence measurement at each cycle (Table SI), 3) a melting curve program (6595ºC), with a heating rate of 0.05ºC/s and continuous fluorescence measurements, and
4) a cooling program down to 40ºC.
Validation of the real-time PCR assay. Specificity of the Cox-1 and Cox-2 product was
checked through gel electrophoresis and through melting curve analysis. The melting
temperature was 86ºC for Cox-1 products and 84ºC for Cox-2, and primer-dimer
formation was below 80ºC (Figure S1).
The characteristics and validation of the real-time PCR assay are summarized in Table
SII. The sensitivity of the quantification, evaluated using different starting amounts of
the standard, was very high for both Cox-1 and Cox-2 PCR assays. Amplification
efficiencies of target cDNAs differed from the standard in ≤ 0.05. The assay precision
was examined by analyzing three repeats of a given sample in the same run. The lower
was the starting amount of target mRNA, the higher was the intra-assay variation. Interassay variation was analyzed by examining the same sample in three separate runs.
Figure S2 shows a representative plot of logarithmic fluorescence versus cycle number
for the Cox-2 real-time PCR analysis provided by the LightCycler quantification
software.
Western blot of Cox-2.
Western blot analysis of Cox-1, Cox-2 and beta-actin in the whole protein extract were
carried out using methods previously described (7). Equal amounts of proteins (50 g)
Supplementary Material - Page
5
were added to 10 l of loading buffer (NuPAGE LDS sample buffer) and spun down.
Samples were heated in a thermocycler to 70ºC for 10 min. Rainbow molecular weight
marker (15 l, Amersham) or samples were loaded in 7% TRIS-acetate gels and ran
(125 V, 90 min) in a Novex XCell II Mini-Cell (San Diego, CA, USA). Following
electrophoresis, proteins were transferred (20 V, 2 h.) to a 0.45-m pore size
nitrocellulose membrane using a Novex XCell II Blot Module. Membrane nonspecific
binding sites were blocked using blocking buffer (5% nonfat dry milk, 0.1 % Tween 20,
in 10 nM PBS), for 1 hour at room temperature in an orbital shaker. Membranes were
then incubated with the primary antibody in blocking buffer (1:1,000), washed four
times in 0.5 % Tween 20 in 10 nM PBS, and incubated with peroxidase-conjugated
secondary antibody in blocking buffer (1:3,000). After a new series of washes,
immunoreactive bands were visualized using a light-emitting chemoluminiscent method
(Supersignal West Pico Chemiluminescent Substrate) and the light emissions were
detected by the CCD Camera System LAS 3000 (Fujifilm).
Cox-2 ELISA.
The Cox-2 present in the whole protein extract was measured using a commercially
available enzyme-linked immunosorbent sandwich assay for quantitative detection of
human Cox-2 in cell lysates (Zymed laboratories, San Francisco, CA). All assays were
performed in duplicate and the assay range was from 2.15 to 275 ng/ml. The levels of
Cox-2 were determined according to the manufacturer’s instructions. Briefly, 100 l of
standard or samples were added to the appropriate wells. The plate was incubated 1
hour at 37ºC, washed for 3 times, and incubated with the HRP-conjugated rabbit antihuman Cox-2 secondary antibody. The plate was incubated 30 minutes at 4ºC, and the
TMB substrate was added. After 30 minutes, the colorimetric reaction was stopped and
the optical density was measured at 450 nm in a spectrophotometer.
Supplementary Material - Page
6
REFERENCES
1. Fokkens WJ, Lund V, Mullol J, Bachert C, Cohen N, Cobo R, et al. EP3OS 2007:
European position paper on rhinosinusitis and nasal polyps 2007. Rhinology
2007;Suppl 20:1-136.
2. Benítez P, Alobid I, de Haro J, Berenguer J, Bernal-Sprekelsen M, Pujols L, et al.. A
short course of oral prednisone followed by intranasal budesonide is an effective
treatment of severe nasal polyps. Laryngoscope 2006;116:770-775
3. Torrego A, Pujols L, Roca-Ferer J, Mullol J, Xaubet A, Picado C. Glucocorticoid
receptor isoforms alpha and beta in in vitro cytokine-induced glucocorticoid
insensitivity. Am J Respir Crit Care Med 2004;170:420-425.
4. Casadevall J, Ventura PJ, Mullol J, Picado C. Intranasal challenge with aspirin in the
diagnosis of aspirin intolerant asthma: evaluation of nasal response by acoustic
rhinometry. Thorax 2000; 55:921-924.
5. Picado C, Fernandez-Morata JC, Juan M, Roca-Ferrer J, Mullol J. Cyclooxygenase2 mRNA is downexpressed in nasal polyps from aspirin-sensitive asthmatics. Am
Rev Respir Crit Care Med 1999;160:291-6.
6. Pujols L, Mullol J, Alobid I, Roca-Ferrer J, Xaubet A, Picado C. Dynamics of COX2 in nasal mucosa and nasal polyps from aspirin-tolerant and aspirin-intolerant
patients with asthma. J Allergy Clin Immunol 2004;114:814-9.
7. Roca-Ferrer J, Pujols L, Gartner S, Moreno A, Pumarola F, Mullol J, et al.
Upregulation of COX-1 and COX-2 in nasal polyps in cystic fibrosis. Thorax
2006;61:592-6.
Supplementary Material - Page
7
FIGURE LEGENDS
Figure S1. Melting curve analysis of Cox-2 PCR products. The melting curves for the
standard, sample cDNA and primer-dimers (water) are shown.
Figure S2. Quantification plot of Cox-2 PCR. Serial dilutions of the standard and two
replicates (dotted lines) of three different samples (1, 2, 3) are plotted.
Supplementary Material - Page
8
TABLES
Table SI. Real-time PCR cycling conditions of the amplification program.
Assay steps (segments)
Duration (seconds)
Temperature (ºC)
Cox-1/ Cox-2
Cox-1
I. Denaturation
10
95
95
II. Primer annealing
6
60
57
III. Elongation
40
72
72
IV. Fluorescence acquisition
5
84
82
Cox-2
Table SII. Characteristics and validation of the real-time PCR assay.
Parameter
Cox-1
Cox-2
PCR product size (bp)
304
305
Limit of detection (molecules)
4
16
Quantification rang (molecules)
12 – 4 x 105
48 – 1.6 x 106
Linearity (r)
0.99-1
0.99-1
PCR efficiency (E = 10[-1/slope])
1.8-2.1
1.8-2.1
Intra-assay variation (%*; n= 3)
3 – 10
3 – 10
Inter-assay variation (%*; n= 3)
8.9
7.3
*
Expressed as variation of the number of molecules from the molecule number mean
value (standard deviation / mean).
Supplementary Material - Page
FIGURES
Figure S1
standard
cDNA
water
Figure S2
1
2
3
9