Name: _______________________________
Period: _____
8th Grade Heredity Study Guide
1. What is asexual reproduction? (Also include # of parents & compare DNA of offspring to
parents.)
2. What is sexual reproduction? (Also include # of parents & compare DNA of offspring to
parents.)
3. List 2 organisms that reproduce asexually:
4. List 2 organisms that reproduce sexually:
5. What molecule makes up the genes of an organism and is responsible for inheritance?
6. What does DNA stand for?
7. What is the basic structure of DNA molecule? (Use the two letter word.)
8. Draw a basic DNA molecule.
9. In a DNA molecule there are 4 kinds of ___________. List these four.
10. What is the correct paring of these 4 from number 1?
11. If the sequence is TCCATGGA what would be the complementary strand?
12. Explain how your DNA controls everything about you.
Use the DNA Code Chart on the back to determine which amino acids will be formed for the
following sequences.
13. GCC
TCC TAC
CGG
14. GAC CGT CAT TGA
15. The DNA code for a particular amino acid sequence contains ____
nucleotides.
16. How many amino acids would be coded for by the following DNA sequence?
ATGGCCCAGCAACCCCCTATG
16. What is a “mutation”?
17. Name the 3 types of mutation. Illustrate how an example of each.
18. Are most mutations “good” or “bad”?
19. What are the effects of a “bad” mutation on an organism?
21. The genetic make up of an organism is called _____________________. Give an example.
22. The physical expression of a trait is called ______________________. Give an example.
23. What is the “dominant allele”?
24. What is the “recessive allele”?
25. What does heterozygous mean? What is the heterozygous genotype?
26. What does homozygous mean? What is the homozygous recessive genotype? What is the
homozygous dominant genotype?
27. What is the purpose of a Punnett square?
28. Complete a Punnett square for: Tt x tt
29. Using the Punnett square from the previous question, give the phenotype & genotype and
the % probability for each.
30. Black fur in dogs in dominant and brown is recessive. If a brown dog is crossed with a
homozygous black dog, what percentage of the offspring will be expected to be brown?
31. What is selective breeding? Give an example.
32. Which of these is an advantage of selective breeding?
A. We can make corn that can grow in hot environments.
B. We can make corn that will attract more bugs.
C. We can make tomatoes that are small and green.
D. We can make pigs that have tough meat.
33. What is genetic engineering? Give an example.
34. Which of the following is not an advantage of genetic engineering?
A. We can make corn that produces its own pesticide.
B. We can make tomatoes that can cause allergic reactions in people.
C. We can make a plant that attracts pests.
D. We can give desirable to traits to organisms by giving them a gene from another species for
that trait.
35. What can a DNA fingerprint be used for?
36. Why does comparing DNA fingerprints work?
37. When comparing two DNA fingerprints, what does a scientist look for?
38. List the characteristics of life.
39. Define Homeostasis. Give some examples of an organism maintaining homeostasis.
40. A person takes a job outside on a hot summer day and begins sweating, this would most
likely be an example of what characteristic of life?