Biol . Chem ., Vol . 379, pp . 579 -582, April/ May 1998 . Copyright @ by Walter de Gruyter & Co -Berlin • New York
Short Communication
Design of a Novel Regulatory Circuit for Expression. of
Restriction Endonucleases
Siddamadappa Chandrashekharan'' 2,
Bindu Diana Paul' and Valakunja Nagaraja''*
1 Department of Microbiology and Cell Biology, Indian
Institute of Science, Bangalore 560012, India
2 Bangalore Genei Pvt Ltd, Peenya, Bangalore 560058,
India
* Corresponding author
We have developed a new strategy with a very tight
control for the expression of cloned genes . The system employed here is the T7 promoter-based expression system in which transcription activator protein C
of bacteriophage Mu (Mu C) has been cloned to serve
as a repressor in the regulatory circuit . The system
also includes pLysE, which encodes T7 lysozyme, an
inhibitor of T7 RNA polymerase . This ensures tight
regulation of cloned genes in the uninduced state .
Upon induction, the expressed Mu C protein binds to
its cognate site thereby repressing lys transcription
driven by the tet promoter . In order to evaluate the tight
control achieved in the system, and to check leaky expression, if any, we have cloned the gene for the Smal
restriction endonuclease without its cognate methylase. For this purpose, a dicistronic unit was constructed by cloning the smalR gene downstream of the Mu
C gene . Smal expression was observed only in the induced cell extracts, demonstrating a tight control . The
system could be used to express the genes of other
cloned restriction enzymes and has the potential for
general applications .
Keywords : Artificial operon / Mu C protein/
Smal endonuclease /T7 lysozyme /Transcription
terminator/ T7 RNA polymerase .
Restriction endonucleases are invaluable tools in recombinant DNA technology and in the study of protein-DNA interactions by virtue of their exquisite specificity . Restriction endonucleases are usually accompanied by cognate
methylases . Genes encoding components of a restriction
modification system are usually located in close proximity
to each other. About 80 R-M systems have been cloned so
far (Bickle and Kruger, 1993 ; Roberts and Halford, 1993) .
The cloning of a majority of restriction endonucleases
has involved the cloning of the cognate methylase first
by the `Hungarian trick' or the methylase selection method
(Mann et aI .,1978 ; Szomolanyi et al ., 1980 ; Kiss et al .,
1985 ; Morgan etal .,1996) in order to protect the host DNA
from cleavage by the endonuclease . Cloning R-M systems has also been achieved by using a screen involving
methyl-directed restriction systems or production of DNA
damage on unmethylated DNA by expression of thermostable endonucleases (Piekarowicz et al ., 1991 ; Fomenkov et al ., 1994) and methods involving phage restriction
(Walderetal .,1981). In all these methods, prior expression
of the cognate methylase is necessary for the stable, functional expression of the endonuclease .
We have now developed a new strategy applicable for
the expression of cloned restriction endonuclease genes
without involving the cognate methylases . For this purpose, a tightly controlled regulatory circuit has been constructed . A T7 promoter-based expression system comprising two components has been used here . The first
component of this system is a T7 expression vector,
pET1 1 d (Studier et al ., 1990) . The second component is
the vector pLysE, which harbors the T7 lysozyme gene in
the expressed orientation . T7 lysozyme is a natural inhibitor of T7 RNA polymerase and inhibits transcription by direct interaction with the polymerase (Zhang and Studier,
1997) . This property has been harnessed in controlling
leaky expression by T7 RNA polymerase in the system
(Studier,1991) . The overall control circuit for the regulated
expression used for the expression of restriction endonucleases is depicted in Figure 1 . As a part of the scheme,
the gene for the bacteriophage Mu transcription activator
C was cloned in pET1 1 d and its cognate sites in pLysE .
Thus, when the Mu C protein is produced, it binds to its
sites with a very high affinity (Ramesh et al., 1994) and
downregulates lys transcription directed by tet promoter
(data not shown) . This leads to a decrease in the levels of
T7 lysozyme, which would otherwise reduce the expression of cloned genes in the induced state (Zhang and
Studier, 1995) . The vector pLysE was used in our method
as it yields high levels of T7 lysozyme resulting in a tight
control of leaky expression from the T7 promoter in the uninduced state .
The test for the efficacy of the system would be the expression of any restriction endonuclease that cannot be
Table l
Primer 1 .
Primer2 .
Primer 3 .
Primer 4 .
Primers Used in the Study.
5'
5'
5'
5'
GCTAGCCATGGACTTATTCGAACACGATCC 3'
CGGGATCCAAAATAACCGGCAGGA3'
CCGGGATCCTAACAAGGCAGGGTT 3'
GCGGATCCTCTTGCCAAAGAGAGAATAT 3'
580
S. Chandrashekharan etal .
PIocUV5
PIocUV5
T7RNAP
G
4~-Ia
Y
•
4
T7RNAP
at
(p
•
0
O 0
fI D
41
O
00
0
C binding
sites
,yg
C binding
sites
bta
UNINDUCED
INDUCED
Fig. 1
Control Circuit for Expression of Restriction Endonucleases .
The T7 lysozyme (solid circles) produced from the vector pNC1 binds to T7 RNA polymerase (open squares) in the uninduced state and
prevents transcription . In the induced state, T7 RNA polymerase directs transcription from the 4)10 promoter. The C protein (open circles)
and the Smal restriction endonuclease (open ellipses) are produced . C binds to its cognate sites and represses lys transcription . The levels of T7 lysozyme drop, resulting in increased availability of T7 RNA polymerase for transcription . The dicistronic unit of Mu C and smalR
(pCBN31 1) was constructed as follows . The Mu C gene was amplified from the plasmid pVR7 (Ramesh etal., 1994) by 30 cycles of polymerase chain reaction (PCR) with Taq DNA polymerase, using primers 1 and 2 (Table 1) . Primer 2 includes a p-independent transcription
terminator. The PCR product was cloned into the Ncol and BamHI sites of pET1 1 d to generate pBN31 . The sma/R gene was also amplified by PCR using primers 3 and 4 (Table 1) from the genomic DNA of Serratia marcescens . The fragment was cloned in the BamHl site of
pBN31 downstream of the Mu C gene to generate pCBN31 1 . The sequences of the cloned PCR products were confirmed by sequencing .
T7 transcription
`/ terminator
E .coli RNA Ptranscription
T7 010 promoter
SD1
C
AAGGAG-ATG-1F
terminator
TAA
SD2
SmaIR
AGGGTT-ATG---1/
TAA-
Fig .2 Organization of the Operon Encoding Mu C and the Smal Restriction Endonuclease in the Plasmid pCBN31 1 .
The Shine-Dalgarno sequences (SD1 for the Mu C gene and SD2 for smalR gene) and the start and stop codons of the two genes are indicated . The T7 promoter, T7 transcription terminator and the EE coli p-independent terminators are depicted .
otherwise expressed in the absence of its cognate methylase . We have chosen the Smal endonuclease of Serratia
marcescens for this purpose . In the genomic context,
Smal R-M genes are transcribed from convergent promoters (Heidman etal .,1989) . In addition, there is a small
open reading frame that encodes Smal C, which is involved in the regulation of the Smal restriction endonuclease
gene (Ives et al ., 1995 ; Tao et al ., 1991) . We have cloned
the gene for the Smal endonuclease alone in our system
without the Smal C ORF or the Smal methylase gene . The
regulatory scheme is depicted in Figure 1 . A pentamer of
the Mu C-binding site was cloned in pLysE to generate
pNC1 . Presence of multiple high-affinity binding sites
would ensure efficient repression of the lys gene. In our
earlier studies we had used a single site to repress lys transcription from pLysS, where lower amounts of lysozyme is
produced (Paul et al., 1997) . The details of the dicistronic
expression unit having the proximal Mu C gene and the
distal sma!R gene is described in the legends to Figure 1 .
The Mu C gene was cloned in the vector pET1 1 d to generate pBN31, following which a promoterless fragment amplified from the Serratia marcescens genome bearing the
smaIR gene was cloned downstream of the Mu C gene to
generate pCBN311 (Figure 1) . The overall organization of
the regulatory elements in this artificial operon is depicted
in Figure 2 . The T7 RNA polymerase-specific promoter
Rio directs the transcription of both the genes . A p-independent transcription terminator was introduced between the two cistrons as an additional, yet important, regulatory measure. The transcription terminator prevents
any leaky expression originating from weak promoters located either within the Mu C gene or elsewhere in the vector. The presence of the second stronger T7-specific terminator at the end of the sma!R gene brings about efficient
recycling of T7 RNA polymerase . The construct harboring
the artificial operon, pCBN311, was transformed into
Escherichia coli BL26(DE3) alone . No transformants were
obtained in this case, reflecting the toxicity of this gene
product . This indicates a requirement for either a tight
repression of the system or the cognate methylase . In
contrast, a large number of colonies were obtained in E.
coli BL26(DE3) harboring either pNC1 or pACMSma, a
pACYC184 derivative harboring the Smal methylase
gene, smalM . Cells harboring these constructs were
grown to an optical density of 0 .6 (600 nm) and induced
with 0 .3 mm isopropyl (3-D-galactopyranoside (IPTG) for
2 h . Cell extracts from the various cultures were assayed
for Smal endonuclease activity (Figure 3) . Smal restriction
Recombinant Expression of Smal Endonuclease 581
1 2 3 4 5 6 7 8 9
Fig . 3 Activity Assay with Cell Extracts of Cultures Harboring
pCBN31 1 .
Escherichia coli BL26(DE3) cells harboring pNC1 were transformed with pCBN311 and transformants were grown in 6 ml LB at
37 °C until an optical density of 0 .6 (600 nm) . The culture was split
into two, and one-half was induced with 0 .3 mm IPTG for 2 h . Cells
were harvested and sonicated after suspending in 0 .5 ml buffer
consisting of 10 mm potassium phosphate, pH 7 .4, 0 .1 mm Ethylenediaminetetra acetic acid (EDTA) ; 7 mm (3-mercaptoethanol
and 1 mm Phenylmethylsulfonyl fluoride (PMSF) . 5 µl of the
uninduced and induced cell extracts were incubated with 1 µg of
lambda DNA and incubated at 25 °C for 1 hour and then electrophoresed on a 1 % agarose gel (lanes 5 and 6) . Lane 1 is uncut
DNA. Assays were also performed with induced host cell extracts
(lane 2), host harboring either pNC1 or pNC1 and pBN31 (lanes 3
and 4 respectively), and with uninduced and induced cell extracts
of host harboring pACMSma and pCBN311 (lanes 7 and 8 respectively). Lane 9 shows activity with commercially available
Smal restriction enzyme (New England Biolabs) .
endonuclease activity was seen in both the uninduced as
well as induced state of Ecoli BL26(DE3) cells harboring
pACMSma, whereas cell extracts from cultures harboring
pNC1 exhibited activity only in the induced state. The level
of expression of the Smal restriction endonuclease was
estimated by determining the total activity. The value of
2 x 104 U/I reflects low-level expression . Thus, while the
system meets the criteria for expression of a restriction
endonuclease without having the corresponding methylase, engineering overexpression would involve additional
manipulation (see later section) . Thus, the regulatory system ensures tight control of leaky expression . Even very
low level expression of an endonuclease could prove detrimental to cell survival as demonstrated earlier for the
EcoRl restriction endonuclease (Heitman et al., 1989) .
Cloning of certain R-M systems has posed problems even
when the methylase gene was cloned first . Deletions
spanning the gene for restriction endonucleases have
been encountered in spite of the fact that the R and M genes were contained on a single DNA fragment (Hammond
et al., 1990) . This necessitated prior modification of the
host genome before the introduction of the R-M system .
Such multi-step procedures have been resorted to in the
case of BamHl (Brooks et al., 1989), Ddel ( Howard et al.,
1986) and Bsp6l (Lubys and Janulaitis, 1995) . Thus, the
regulatory circuit described here offers an attractive alternative for the expression of restriction endonucleases in
the absence of their cognate methylases . Moreover, the
presence of a strong p-independent terminator facilitates
initial screening for recombinants without involving the
cognate methylase in a strain that does not harbor the
gene for T7 RNA polymerase . The successful expression
of the Smal restriction endonuclease demonstrates that it
should be possible to functionally maintain and stably ex-
press genes whose products affect cell survival . With the
present approach, the levels of expression of the second
gene, sma1R, were not high . This could be due to the poor
Shine-Dalgarno sequence of the sma1R gene . Additionally, the E. coli terminator might be strong enough to terminate T7 RNA polymerase-directed transcription at the
end of the Mu C gene . There have been reports discussing
the ability of certain E. coli terminators to function as T7
transcription terminators (Christiansen, 1988 ; Jeng et al .,
1990 ; Macdonald et al ., 1993 ; Lyakho et al., 1997) . It
should be noted here that the present study was directed
at regulated expression without bringing in the cognate
methylase and not designed for overexpression . The system could be engineered for high-level expression with
appropriate alterations in the regulatory system . One approach is to introduce a strong Shine- Dalgarno sequence
for the R gene at an optimal distance from the start codon .
Tinkering with the structure of the p-independent transcription terminator to ensure efficient transcription of the
second gene of the operon would be another strategy .
Several other strategies have been developed to provide very tight control . These include the use of antisense
RNA complementary to the mRNA of the gene of interest
(O'Connor and Timmis, 1987), use of the antitermination
function of the phage h-derived nutL/N protein (Mertens
et al ., 1995) or promoter inversion mediated by recombination (Hasan and Szybalski, 1987) . While these methods have their own merits and have been designed for a
specific purpose, the novel feature of our method is the
construction of an artificial operon for regulated expression . The components (Mu C protein on one plasmid and
its binding sites on another plasmid) could be used for the
expression of other restriction endonucleases . The system can prove especially useful where the methylase is
poorly expressed or has not been identified .
Acknowledgements
We thank the anonymous referees for their valuable comments to
improve the manuscript . Thanks are due to D .R . Radha for technical assistance and other members of the group for discussions .
B .D .P
. is supported by a senior research fellowship of the Council
of Scientific and Industrial Research, Govt . of India . S.C is supported by a grant from Technology Development Mission . The
work is supported by a grant from the Department of Science and
Technology, Govt . of India and Technology Development Mission .
References
Bickle, TA ., and Kruger, D .H . (1993) . Biology of DNA restriction .
Microbiol . Rev. 57,434-450 .
Brooks, J .E ., Benner, J .S ., Heiter, D .F., Silber, K .R., Sznyter, L.A .,
Jager-Quinton, T., Moran, L .S ., Slatko, B .E ., Wilson, G .G ., and
Nwankwo, D .O . (1989) . Cloning the BamHl restriction-modification system . Nucleic Acids Res . 17, 979-997 .
Christiansen, J . (1988) . The 9S RNA precursor of Escherichia coli
5S RNA has three structural domains : implications for processing . Nucleic Acids Res . 16,7457-7476 .
582
S . Chandrashekharan et al .
Fomenkov, A ., Xiao, J .P, Dila, D ., Raleigh, E ., and Xu, S .Y. (1994) .
The 'endo-blue method' for direct cloning of restriction endonuclease genes in E. coli . Nucleic Acids Res . 22,2399-2403 .
Hammond, A .W., Gerard, G .F, and Chatterjee, D .K. (1990) .
Cloning the Kpnl restriction-modification system in Escherichia coli . Gene 97, 97-102 .
Hasan, N ., and Szybalski, W . (1987) . Control of cloned gene expression by promoter inversion in vivo : construction of improved vectors with a multiple cloning site and the p t ., promoter.
Gene56, 145-151 .
Heidmann, S ., Seifert, W ., Kessler, C ., and Domdey, H . (1989) .
Cloning, characterization and heterologous expression of the
Smal restriction-modification system . Nucleic Acids Res. 17,
9783-9796 .
Heitman, J ., Zinder, N .D ., and Model, P. (1989) . Repair of the
Escherichia coli chromosome after in vivo scission by the
EcoRl endonuclease . Proc . Natl . Acad . Sci . USA . 86, 2281 2285 .
Howard, K .A., Card, C ., Benner, J .S ., Callahan, H .L ., Maunus, R .,
Silber, K ., Wilson, G ., and Brooks, J .E . (1986) . Cloning the Ddel
restriction-modification system using a two-step method .
Nucleic Acid Res . 14,7939-7951 .
Ives, C.L ., Sohail, A ., and Brooks, J .E . (1995) . The regulatory C
proteins from different restriction modification systems can
cross-complement . J . Bacteriol . 177, 6313-6315 .
Jeng, S .T, Gardner, J .F., and Gumport, R .I . (1990) . Transcription
termination by bacteriophage T7 RNA polymerase at rho-independent terminators . J . Biol . Chem . 265, 3823-3830.
Kiss, A., Posfai, G ., Keller, C .C ., Venetianer, P, and Roberts, R .J .
(1985) . Nucleotide sequence of the BsuRl restriction-modification system . Nucleic Acids Res . 13,6403-6421 .
Lubys, A ., and Janulaitis, A . (1995) . Cloning and analysis of the
plasmid-borne genes encoding the Bsp6l restriction and modification enzymes . Gene 157,25-29 .
Lyakhov, D .L., Biao, H ., Zhang, X., Studier, F.W., Dunn, J .J ., and
McAllister, W .T. (1997) . Mutant bacteriophage T7 RNA polymerases with altered termination properties . J . Mol . Biol . 269,
28-40 .
Macdonald, L .E ., Zhou, Y., and McAllister, W.T (1993) . Termination and slippage by bacteriophage T7 RNA polymerase . J .
Mol . Biol . 232,1030-1047 .
Mann, M .B ., Rao, R .N ., and Smith, H .O . (1978) . Cloning of restriction and modification genes in E. coli : The Hhall system from
Haemophilushaemolyticus . Gene 3, 97-112 .
Mertens, N ., Remaut, E ., and Fiers, W . (1995) . Tight transcriptional control mechanism ensures stable high-level expression
from T7 promoter-based expression plasmids . Bio/Technology
13,175-179 .
Morgan, R .D ., Camp, R .R ., Wilson, G .G ., and Xu, S. (1996).
Molecular cloning and expression of Nlalll restriction- modification system in E. coli . Gene 183,215-218 .
O'Connor, C .D ., and Timmis, K.N . (1987). Highly repressible expression system for cloning genes that specify potentially toxic
proteins. J . Bacteriol . 169,4457-4462 .
Paul, B .D ., Ramesh,V., and Nagaraja,V (1997) . An artificial regulatory circuit for stable expression of DNA binding proteins in aT7
based expression system . Gene 190,11-15 .
Piekarowicz, A., Yuan, R ., and Stein, D .C . (1991) . A new method
for the rapid identification of genes encoding restriction and
modification enzymes . Nucleic Acids Res . 19,1831 -1835 .
Ramesh, V., De, A., and Nagaraja, V. (1994) . Engineering hyperexpression of bacteriophage Mu C protein by removal of secondary structure atthe translation initiation region . Protein Eng.
7,1053-1057 .
Roberts, R .J ., and Halford, S .E . (1993) . Typell restriction endonucleases. In : Nucleases, S .M . Linn, R .S . Lloyd and R .J .
Roberts, eds . (Cold Spring Harbor, New York : Cold Spring
Harbor Laboratory Press), pp . 35-88 .
Studier, F.W. (1991) . Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system . J . Mol . Biol . 219,
37-44 .
Studier, FW., Rosenberg, A .H ., Dunn, J .J ., and Dubendorff, J .W .
(1990) . Use of T7 RNA polymerase to direct expression of cloned genes . Methods Enzymol . 185,60-89.
Szomolanyi, E ., Kiss, A., and Venetianer, R (1980) . Cloning the
modification methylase gene of Bacillus sphaericus R in
Escherichia coli. Gene 10, 219-225 .
Tao, T., Bourne, J .C ., and Blumenthal, R .M . (1991) . A family of
regulatory genes associated with Typell restriction -modification systems . 173,1367-1375 .
Walder, R .Y., Hartley, J .L., Donelson, J .E ., and Walder, J .A. (1981) .
Cloning and expression of the Pstl restriction-modification
system in Escherichia coli . Proc . Natl . Acad . Sci. USA, 70,
1503-1507 .
Zhang, X., and Studier, F W. (1995) . Isolation of transcriptionally
active mutants of T7 RNA polymerase that do not support
phage growth . J . Mol . Biol . 250,156-168 .
Zhang, X ., and Studier, EW. (1997) . Mechanism of inhibition of
bacteriophage T7 RNA polymerase by T7 lysozyme . J . Mol .
Biol . 269, 10-27 .
Received September 30,1997; accepted February 4,1998