AN ABSTRACT OF THE DISSERTATION OF Su Jung Yang for the degree of Doctor of Philosophy in Microbiology presented on December 22, 2006. Title: Characterization of Vaccinia Virus A12L Protein: Its Proteolysis and Functional Analyses in Virus Replication. Abstract approved: Dr. Dennis E. Hruby In order to produce infectious virus progeny, vaccinia virus (VV) undergoes morphogenic proteolysis to regulate the structural rearrangements of virus particles. Several of the major structural precursor proteins of VV are cleaved at a conserved Ala-Gly-X (where X is any amino acid) motif by the VV I7L core protein proteinase at a step, which is necessary for formation of mature virus particles. VV A12L encodes a 25kDa core protein, which is cleaved at an AG/A site, yielding a 17kDa cleavage product. Both A12L precursor and the cleavage product are localized to mature virions. The open reading frame (ORF) of A12L contains two more AG/X (AG/K) sites, however, cleavage at these sites has not been analyzed. Therefore, the aim of this study is to characterize the in vivo processing of A12L proteolysis and elucidate the biological function of A12L. The result of these studies would provide more details on the regulation and participation of VV proteolysis during the morphogenic transitions. Proteolytic processing of A12L produces multiple peptides, which do not appear to utilize AG/K sites, but rather cleavages occur at both the N- and Cterminus. Of the three AG/X motifs in A12L, cleavage has only been demonstrated at the AG/A site. The enzyme responsible for this cleavage has been shown to be I7L. Immunoprecipitation studies have shown that A12L associates with VV core and membrane proteins. A conditional mutant virus of A12L was constructed and determined the essentiality of A12L in virus replication and helped to elucidate its functions in the assembly of virus particles. An AG/A site mutation abrogated the ability of the transfected A12L gene to rescue the conditional mutant under non-permissive conditions, indicating that its proteolysis at the AG/A site is required during viral replication. Next, we compared the protein expression of A12L with D13L, an internal scaffolding protein, to investigate the role of A12L in virus assembly. We showed that A12L is stably synthesized only in the presence of D13L. Consequently, we established that A12L protein and its proteolysis participate in viral assembly subsequent to D13L involvement. ©Copyright by Su Jung Yang December 22, 2006 All Rights Reserved CHARACTERIZATION OF VACCINIA VIRUS A12L PROTEIN: ITS PROTEOLYSIS AND FUNCTIONAL ANALYSES IN VIRUS REPLICATION. by Su Jung Yang A THESIS submitted to Oregon State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy Presented December 22, 2006 Commencement June 2007 Doctor of Philosophy dissertation of Su Jung Yang presented on December 22, 2006. APPROVED: Major Professor, representing Microbiology Chair of the Department of Microbiology Dean of the Graduate School I understand that my dissertation will become part of the permanent collection of Oregon State University libraries. My signature below authorizes release of my dissertation to any reader upon request. Su Jung Yang, Author ACKNOWLEDGEMENTS I would like to express my sincere appreciation to all the committee members, Dr. Daniel Rockey, Dr. Theo Dreher, Dr. Thomas Wolpert, Dr. Machteld, Mok for their help, guidance and encouragement. I would like to appreciate for all of the support the laboratory members in Dr. Hruby’s lab have shown me. Special thanks to Jennifer Yoder, the Lab manager, who helped me to complete the writing of this thesis and for her helpful discussions, which were valuable for conducting experiments. Dr. Chelsea Byrd, a former graduate student in the same lab provided help with the writing and editing of this thesis as well as with protocols and experimental procedures. I would also like to say thanks for all the fun at American Society for Virology conferences. Dr. Dina Alzhanova, a postdoctoral scientist, encouraged me a lot when I struggled with experiments and taught me experimental skills for the fluorescent microscopy. Thank you. Finally, I would like to thank Dr. Dennis Hruby, a mentor who offered me a great opportunity to work in his lab and always encouraged to have fun with A12L protein project. To be honest, I had a hard time with this protein, but I was able to discover what the real meaning of “research” and “dance of joy” are and how much I need to believe in myself. I would like to express my sincere appreciation to Dr. Hruby for being my mentor and for setting the example of being a good scientist. I also would like to mention that I had unforgettable time being a teaching assistant with all the graduate students during 2001 and 2002. I would like to say thank you to everyone for being such good friends and sharing great times with me. Despite the fact that I came to the US by myself, I happened to have family here. With help from all the church members especially in the college group, I learned about God and how to love others. That became the source of my strength not only working in the lab but also with the rest of life. Finally, I would like to express my sincere love and appreciation to my family, Han Seob Yang, Soon Ok Whang and Su Chul Yang, Su Hee Yang, Su Seon Yang, and friends in Korea, who have shown even stronger faith in me than myself and given me a consistent support and love. I cannot imagine standing here and receiving a Ph.D degree without their love. Thank you all, who always stand behind me and pray for me. I would like to say that I love you all. TABLE OF CONTENTS PAGE 1. INTRODUCTION 1.1 Vaccinia virus life cycle · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 1.2 Virus assembly and dissemination · · · · · · · · · · · · · · · · · · · · · · · · 1.3 Proteolysis in virus replication · · · · · · · · · · · · · · · · · · · · · · · · · · · · 1.4 Vaccinia virus proteolysis · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 1.5 VV contextual proteolytic processing · · · · · · · · · · · · · · · · · · · · · · 1.6 Vaccinia virus proteases · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 1.7 Vaccinia virus A12L core protein · · · · · · · · · · · · · · · · · · · · · · · · · · 1 3 5 9 11 14 15 2. CHARACTERIZATION OF A12L PROTEOLYSIS AND ITS PARTICIPATION IN VIRUS ASSEMBLY. 2.1 Abstract · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 21 2.2 Introduction · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 2.3 Material and methods · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 2.4 Results · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 2.5 Discussion · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 22 26 32 43 3. ESSENTIALITY OF A12L IN VIRAL REPLICATION AND MORPHOLOGICAL TRANSITION. 3.1 Abstract · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 3.2 Introduction · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 3.3 Material and methods · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 3.4 Results · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 3.5 Discussion · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 61 62 67 71 76 4. PARTICIPATION A12L IN VACCINIA VIRUS ASSEMBLY SUBSEQUENT TO D13L INVOLVEMENT 4.1 Abstract · ·· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 4.2 Introduction · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 4.3 Material and methods · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 4.4 Results · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 89 90 94 96 TABLE OF CONTENTS (Continued) PAGE 4.5 Discussion · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 99 5. CONCLUSION · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 106 6. BIBLOGRAPHY · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 110 LIST OF FIGURES PAGE FIGURE Chapter 1. 1.1 Vaccinia virus life cycle. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 17 1.2 Diagram of VV virion-associated proteins and their cleavage products. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 19 Chapter 2. 2.1 Multiple cleavage products of A12L protein. 49 2.2 Kinetic analysis and pulse chase of A12L protein. · · · · · · · · · · · · · 51 2.3 Proteolysis of A12L. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 53 2.4 The AG/A site cleavage by the VV proteinase I7L. · · · · · · · · · · · · · 55 2.5 N-terminal proteolysis of A12L. · · · · · · · · · · · · · · · · · · · · · · · · · · · · 56 2.6 Identification of A12L-derived peptides. · · · · · · · · · · · · · · · · · · · · · 57 2.7 Association of A12L with other VV proteins. · · · · · · · · · · · · · · · · · · 58 2.8 Subcellular localization of A12L protein. · · · · · · · · · · · · · · · · · · · · · 60 Chapter 3. 3.1 Tet-dependent replication of vvtetOA12L and one-step growth curve. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 81 3.2 Essentiality of A12L protein in VV replication. · · · · · · · · · · · · · · · · 83 LIST OF FIGURES (Continued) PAGE FIGURE 3.3 Morphology defects in the absence of A12L expression. · · · · · · · 85 3.4 Morphology defects by abrogated AG/A cleavage of A12L. · · · · · 87 Chapter 4. 4.1 Rifampicin-resistant loci in D13L ORF. · · · · · · · · · · · · · · · · · · · · · 101 4.2 Sensitivity of RifR viruses to different concentrations of rifampicin. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 103 4.3 Protein expression of D13L and A12L in the presence of Rif. · · · 105 LIST OF TABLES PAGE TABLE Chapter 2 2.1 Diagram of VV virion-associated proteins and their cleavage products. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 46 2.2 The predicted molecular weights and pI’s of potential A12L cleavage products. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 48 Chapter 3 3.1 Schematic diagram of a conditional mutant virus of A12L. · · · · · · 79 CHAPTER 1. INTRODUCTION 1 VACCINIA VIRUS LIFE CYCLE Vaccinia virus (VV), one of the most well-studied animal viruses, belongs to the Orthopoxvirus genus of the Poxviridae family, distinguished by their cytoplasmic site of replication, temporal regulation of gene expression, and unique morphology. VV possesses a large double-stranded DNA genome of approximately 190 kilobase pairs (kbp) and produces at least 250 gene products during the viral replication cycle. However, the virus resides in the cell cytoplasm from the time the virus enters the host cell until the progeny viruses are produced. Thus, in order to promote viral replication in the cytoplasm, VV needs to encode its own enzymes for transcription as well as DNA replication, which suggests a high level of independence from host cells. In addition, VV acquires its infectivity by assembling multiple virion forms, which require complex morphogenic pathways. The large number of gene products and the complex virion assembly suggest that VV possesses tightly regulated gene expression systems to control individual genes. Upon binding of virions to cell surfaces, the viral entry into the host cells is mediated differently depending on the form of the virus, intracellular mature virus (IMV) or extracellular enveloped virus (EEV). IMV are hypothesized to enter the cells by plasma membrane fusion in the presence of a single membrane (Chang, 1976) or by uncoating outside of the cell in the presence of multiple membranes (Krijnse-Locker et al. 2000). EEV, with an extra membrane, is proposed to enter the cells by acidification of the virions in intracellular vesicles (Ichihashi, 1996) or by shedding the membranes at the cell surface (Krijnse- 2 Locker et al. 2000). Regardless of the mechanism of viral entry, once a virus is inside the cell, VV accomplishes coordinating the processes of genome replication and virus assembly through three consecutive stages categorized as the early, intermediate, and late gene expression as described at Fig 1.1 (Broyles, 2003). Once the core is uncoated, the mRNAs and VV-encoded enzymes packaged within the core particles are transported near to cellular ribosomes by microtubules (Carter et al. 2003, Mallardo et al. 2001). The enzymes in VV core include: DNA-dependant RNA polymerase; early transcription factors; capping and methylating enzymes; polyA polymerase; and DNA topoisomerase type I. With these enzymes, the viral mRNAs are modified with 3’-capping and 5’polyadenylation and promote the first stage of gene expression. Proteins participating in DNA replication, nucleotide biosynthesis and intermediate transcription are synthesized as early class genes, which represent approximately half of the viral genome. DNA replication begins in concert with intermediate gene expression. Newly replicated viral DNA provides templates for intermediate gene expression, of which the products, A1L, A2L, and G8R act as a set of late gene transcriptional factors. At the late stage, virion structural proteins, enzymes for DNA packaging and early transcription factors are expressed by virtue of the 5’-polyA leader sequences. Then, the late gene products undergo different post-translational modifications morphogenesis at the post-replicative stage. initiating virion assembly and 3 VIRUS ASSEMBLY AND DISSEMINATION. The assembly of virus progeny commences with the coalescence of viral DNA, enzymes, lipids and structural proteins to form pre-virion particles, which have crescent-shaped lipid membranes surrounding electron-dense areas called viral factories (viroplasm) (Fig. 1.1). Unlike other viruses such as vesicular stomatitis virus or influenza virus, VV membranes appear to be assembled in virus cytoplasmic foci (viroplasm) into uniform, spherical, immature virus particles (IV). The gene product of D13L, a 65kDa late protein, is reported to act as a transitory scaffolding protein and is responsible for the formation of spicules, giving the IV particle its characteristic morphology (Mark et al. 1991, Sodeik et al. 1994). This non-infectious IV develops an internal core surrounding the viral DNA and becomes associated with host-originated membranes acquired from the intermediate compartment (IC), which is located between the endoplasmic reticulum (ER) and the Golgi complex. The association of the IC membrane with the IV particles gives rise to the development of the first infectious form of virus with a brick-shaped core, referred to as intracellular mature virus (IMV) (Sodeik et al. 1994). However, the origin and numbers of the membranes around the IMV is controversial. In contrast to IC-originated double membranes, a single membrane is postulated to be synthesized de novo. (Dales, 1968) The evidence that IC resident proteins were not detected in purified virions, and that inhibitors causing a blockage of the transport from ER to IC and Golgi did not disrupt IMV membranes, suggests that IV may not use host-derived IC, but rather 4 synthesizes membranes from its own expression. (Krauss et al. 2002, Husain and Moss, 2003) Regardless of the numbers and origins of the membranes, the structural transformation of IV to produce IMV appears to involve the proteolytic processing of certain polypeptide precursors (Lee and Hruby, 1994, Moss and Rosenblum, 1973) and the participation of some proteins required for DNA packing and core condensation (Morgan, 1976, Wilcock and Smith, 1996, Cassetti et al. 1998). Although IMV particles are infectious, they are not sufficient for longrange infection or efficient viral spread. An additional envelope is required for viral spread. A portion of IMV is transported to the microtubule-organizing centre (MTOC) and enwrapped in double layers of membrane cisternae, derived from the trans-Golgi network or endosomes (Schemilz et al. 1994, Hollinshead et al. 2001, Rietdorf et al 2001, Ward and Moss, 2001), forming intracellular enveloped virus (IEV). Consequently, IEV particles obtain two more membranes surrounding the IMV and are migrated to the cell surface by microtubules, where the outermost IEV membrane is fused with the plasma membrane. As a result, the outer layer of the membrane is lost and the virus becomes exposed on the cell surface in a manner similar to the exocytosis of intracellular vesicles. Depending on the location and role in virus dissemination, this virion can be referred to as an extracellular-enveloped virus (EEV) or cell-associated enveloped virus (CEV). If the virion is released into the external medium mediating the long-range spread of viruses, it is called EEV whereas if it is retained on the cell surface, it is named CEV (Law et al. 2002). CEV stimulates actin polymerization beneath the plasma 5 membrane where CEV is attached (Van Eijl et al. 2000) and the growing actin tails become the source of propelling the virus particles away, infecting surrounding cells. Some poxviruses such as Cowpox virus (CPV) are capable of producing another infectious form of IMV particles called A-type inclusion bodies (ATI) (Patel et al. 1986). ATI is a late gene product, which forms the cytoplasmic inclusion bodies with IMV particles occluded inside. The highly stable proteinaceous bodies help to retain viral infectivity outside of host cells. Considering the large number of gene products and multiple forms of infectious progeny, VV must regulate a complex assembly process. By taking advantage of such post-translational modifications as myristylation, acylation, phosphorylation, glycosylation, and ADP-ribosylation, VV is capable to modulate not only gene expression but also proper configuration, localization, and interactions of proteins. During the morphogenic transition from IV to IMV, one of the essential modifications VV undergoes is proteolytic processing. PROTEOLYSIS IN VIRUS REPLICATION Proteolysis is defined as hydrolysis selectively occurring at specific residues in a polypeptide catalyzed by an enzyme called a proteinase (also called an endopeptidase). Due to the characteristics of the proteinase, which is capable of recognizing and cleaving specific peptide bonds in substrates, proteolytic processing is often considered a limited process, whereas protein degradation refers to non-specific and extensive cleavage of peptide bonds in the substrate. Like other post-translational modifications, proteolysis often has a role in obtaining 6 and regulating protein properties such as enzymatic activity, interactions between proteins, and assembly. Protein hydrolysis results in stimulating conformational changes in the tertiary structures, bringing functional residues in proximity to one another, which fit the active pocket of enzymes or other protein complexes. The high energy requirement for reconstruction of broken peptide bonds and the lack of a biological system identified to repair proteolysis suggest that proteolytic processing may be a unidirectional mechanism for a variety of biological processes such as food digestion, signal transduction, hormone/growth factor production, complement immune cascade and pathogen eradication (Neurath, 1989, Horl and Heidland, 1982, Reich et al. 1975). Proteolytic processing of viral proteins is common to most, if not all viruses, including poliovirus, African swine fever virus, human immunodeficiency virus, herpesvirus, and adenovirus (Pallanch et al. 1984, Lopez-Otin et al. 1989, Tozser and Oroszlan, 2003, Flynn et al. 1997, Webster et al. 1994). The proteinases can be provided by the host cell, the virus, or both. Since cellular proteinases generally participate in signal transduction and intracellular trafficking of proteins via secretory pathways, viruses take advantage of cleavage reactions at secretary compartments, where signal peptides of viral envelope and membrane proteins are proteolytically processed and transported along with the cellular pathways. Moreover, viral proteins possess the capacity of utilizing host-driven posttranslational modifications such as acylation and glycosylation, which is observed for the E1 and E2 golycoproteins of Sindbis virus (Schlesinger and Schlesinger, 1990). 7 Depending on the role of proteolysis during the viral replication cycle, there are two types of proteolytic reactions, categorized as formative and morphogenic (Byrd and Hruby, 2006). Formative proteolysis refers to the processing of viral polyproteins into structural and nonstructural proteins, commonly observed in RNA viruses such as picornavirus, retrovirus and coronavirus. (Kay and Dunn, 1990) In RNA viruses, whose genomic RNAs are of the same polarity as the viral mRNAs, polyprotein processing acts as a mechanism of gene expression in accordance with eukaryotic translation systems of monocistronic mRNAs (Kozak, 1983). In addition, the synthesis of a polyprotein in small RNA viruses can maximize “the genetic economy”, yielding several proteins from a single transcription/translation event. Once the cleavage of the precursor protein occurs, the resultant proteins often become activated and localized to the appropriate compartment of the cell or to the assembling virus particles. (Dougherty and Semler, 1993) Tobacco Etch Virus (TEV), a plant potyvirus, encodes a NIa protease, which undergoes a formative cleavage reaction. (Dougherty and Parks, 1991) The NIa protease is a 49kDa single polyprotein consisting of a 27kDa C-terminal protease domain and a 21kDa Nterminal genome-linked domain (VPg). The VPg domain peptide contains a nuclear localization signal that directly transports VPg domains to the nucleus and covalently binds to the 5’-terminus of viral genomic RNA through a phosphodiester linkage at the hydroxyl group of Tyr-62. The NIa protease homologous to picornavirus 3C protease contains a chemotrypsin-like fold with a cysteine residue in the nucleophilic active site and catalyzes a cis- or transcleavage processing. 8 Morphogenic proteolysis refers to the cleavage of virus structural precursor proteins assembled in previrions, of which the products typically become constituents of mature virions. The cleavage reaction commences in combination with virus assembly and is often required for the acquisition of infectivity. Both RNA and DNA viruses such as retrovirus, picornavirus, adenovirus and bacteriophage T4 are reported to utilize morphogenic proteolysis. Despite little information regarding morphogenic proteolysis, several functions have been suggested in a variety of viruses. Both avian retrovirus and HIV retrovirus have demonstrated proteolytic processing of the retroviral Gag polyprotein, which produces major structural proteins participating in virius assembly and dissemination (Craven, 1996). Absence of an active proteinase led to the failure of the Gag cleavage reaction and the incorrect dimerizations of genomic RNA in assembling premature virus particles and resulted in the acquisition of noninfectious virus particles (Navia and McKeever, 1990, Stewart et al. 1990). Adenovirus proteolysis catalyzed by the L3 cysteine proteinase is required for the proper disassembly of the virus particles at the initial stage of infection (Freimuth and Anderson, 1993) whereas the cleavage reaction in picornavirus to process VP0 into VP2 and VP4 takes place to mediate correct aggregation of genomic RNA with capsid components (Lee et al. 1993). Both viruses demonstrate that cleavage of structural proteins plays an important role in virion assembly. Similarly, bacteriophage T4 undergoes proteolysis to promote unidirectional DNA genome packaging (Hersko and Fry, 1975). 9 VACCINIA VIRUS PROTEOLYSIS Vaccinia virus (VV) utilizes both types of proteolytic processing. VV growth factor (VVGF) and the VV hemagglutinin (HA) proteins are examples of proteins that undergo formative proteolysis. They appear to have signal peptides at the Nterminus, which are removed post synthesis and most likely processed by host cell proteinases (Chang et al. 1988, Shida and Matsumoto, 1983, Stroobant et al. 1985). Purification and microsequencing analysis of VVGF showed it to be a processed protein. The VVGF precursor has homology to epidermal growth factor (EGF) and its signal sequence and transmembrane domain are removed through proteolysis. Isolated HA mutant collections have demonstrated that the mutant proteins were accumulated on rough endoplasmic reticulum (RER) and the outer nuclear envelope, which has morphogenic continuity with the RER and displayed a molecular weight difference compared to wild type HA. These properties were explained by the fact that the proteolytic cleavage at the N-terminus caused the disassociation of N-terminal peptides attached in the RER lumen and C-terminal peptides projected into the cytoplasm, followed by the transportation of the Cterminal peptides toward the Golgi. Likewise, a number of VV structural proteins, including A10L (p4a), A3L (p4b), L4R (p25K), A17L (p21K), G7L and A12L (p17K), have been shown to undergo morphogenic processing to produce cleavage products that are localized to the core after virion assembly (VanSlyke et al. 1991a, VanSlyke et al. 1991b, Whitehead and Hruby, 1994a, Mercer and Traktman, 2005, Rodriguez et al. 1993). Through N-terminal sequencing of the cleavage products, the conserved Ala-Gly- 10 X (X: any amino acid) cleavage motif was identified. Most cleavages were observed at AG/A sites in A3L, L4R, A17L, and A12L whereas the AG/S and AG/T residues were utilized for A10L processing. Similar to A10L, the G7L gene product contains AG/F and AG/L motifs, which are likely involved in proteolytic processing (Mercer and Traktman, 2005). Studies of these core and membrane proteins, as representative proteins of VV morphogenic processing have determined the essentiality of their proteolytic processing for virus replication and infectivity. They also provided more details of the participation of VV proteolysis in virus morphogenesis such as the formation of a defined core and organization of virion membranes. Studies with temperature-sensitive (ts) and inducible mutant viruses revealed several DNA-binding proteins such as L4R and F17R phosphoprotein. Both are required for the structural maturation process involved in the correct DNA packaging and efficient DNA transcription and nucleoid condensation (Wilcock and Smith, 1996, Zhang and Moss, 1991), respectively. One of the most abundant core proteins, A10L is cleaved into a 60kDa (4a) and a 23kDa peptide, which are both incorporated into the mature core. The repression of A10L expression leads to aberrant IV formation or IMV with irregular shaped electrondense cores. The observation that A10L participates in the uptake of viral DNA into the IV structure strongly indicates that it might have a role as a nucleoprotein complex assembled into the IV particles (Heljasavaara et al. 2001). The A17L gene product, a virion-membrane protein, is associated with viral crescents in wild type virus infections but no characterized viral membranes are detected in the absence of A17L suggesting it contributes to the generation of viral nascent membranes at an early stage of IV formation (Wolffe et al. 1996). The G7L 11 phosphoprotein is also known to be processed at the AG/F and AG/L sites, producing a 16kDa cleavage product. The repression of G7L demonstrated similar phenotypic defects observed from the absence of A14L and H5R core proteins showing a disassociation of virosomes from the crescent membranes (Mercer and Traktman, 2005). Therefore, the VV proteins involved in morphogenic processing play an essential role in VV morphogenesis, especially during the transition of IV into IMV. VV CONTEXTUAL PROTEOLYTIC PROCESSING The significant relevance between proteolytic processing and virus assembly, which has critical effects on acquisition of infectivity, raises the question of how the viral proteolytic processing is regulated. Possible regulators could be specific activators/repressors, differential compartmentalization of enzymes and substrates, and requirements for processing in sequence. For example, adenovirus has a disulfide-bond linked peptide produced from the pVI structural protein, which plays a role in turning on the active L3 protease function. Retroviruses regulate their protease activity by forming a dimer after the relatively acidic extracellular environmental signal (Pettit et al. 1991). Sindbis virus promotes inactivation of the viral protease by auto-catalysis right after the assembly of the nucleocapsid, resulting in a conformational change, which displaces the C-terminal region of the protein in the active pocket, preventing the substrates from binding and being cleaved (Choi et al. 1991). Irrespective of the type of regulation of proteinase activity, viruses are 12 capable to modulate a cascade of cleavage reactions in polyproteins by giving rise to structural conformational changes. Africa swine fever virus (ASFV), a large double-stranded DNA icosahedral virus, has shown similar characteristics of replication in the cytoplasm, and similar genetic structures to VV. ASFV encodes two polyproteins, pp220 and pp62, which are subsequentially processed into six different structural proteins in the core shell. The cleavage takes place after the second glycine in the consensus motif Gly-Gly-X (X:any amino acids) and is catalyzed by the viral protease, pS273R cysteine proteinase. The proteinase activity on pp62, which contains two GG-X residues, shows that an N-terminal cleavage occurs first. The first cleavage at an N-terminus releases the final cleavage product, p15 along with the intermediate form, pp46, which is cleaved at the second GG-X site, producing p35 and p8. However, the cleavage sitemutated pp62 was able to show partial cleavages, indicating that the GG-X motif is a recognition site but not an absolute requirement for proteolysis. Rather, the first cleavage induces conformational change allowing subsequent interaction with additional proteins or further processing (Rubio et al. 2003). Similarly, VV proteolysis is observed at conserved Ala-Gly-X (X:any amino acids) residues and is mainly catalyzed by the I7L cysteine proteinase (Byrd et al. 2002). However, VV core precursor proteins demonstrated a delayed processing of precursors to be the final products requiring up to 45 min, which is relatively slow, compared to other proteolysis and cleavage reactions. Treatment with cycloheximide, an inhibitor of protein synthesis caused a complete abrogation of proteolytic maturation. This requirement of the timing and de novo 13 protein synthesis strongly suggests that the viral proteolysis takes place within the context of virion assembly, referred as “a contextual processing”. As an attempt to identify which proteins undergo contextual processing, the entire VV proteome was searched for the existence of AG/X motifs. There were 82 occurrences of an AG/X motif, most of which are not cleaved. Only 18 motifs showed the same residues as the core proteins, AG/A, S, T, which are actively utilized for proteolysis. Of these 18 tripeptides, 5 gene products, which contain the AG/A residues, were selected and the proteolytic processing of each gene product and the site utilizations were carefully examined (Whitehead and Hruby, 1994a). A DNA polymerase (DNAP, E9L), a host range protein (HR, K1L), and an outer membrane protein (p37, F13L) were not processed while only p21K (A17L) and p17K (A12L) were reported to produce a 21kDa and a 17kDa peptide, respectively, both of which are localized to core of mature virions. N-terminal microsequencing of each cleavage product confirmed that the AG/A sites serve as an active cleavage motif. The fact that each of these proteins has the same AG/A sites but only two proteins were cleaved at the residues suggests the more contextually constrained requirements for proteolysis other than the consensus motifs. That is, proteins destined for this morphogenic cleavage pathway contain an active AG/X motif, are late proteins (DNAP is an early protein and HR is an intermediate gene product), and are proteins incorporated within the core of assembling virions (p37 is a late protein but localized to virion membrane.) (Whitehead and Hruby, 1994a). 14 VACCINIA VIRUS PROTEASES The complete genomic sequence of VV gave rise to the discovery of two possible viral proteases responsible for the viral proteolytic processing. I7L, a 47kDa cysteine protease, has a conserved active site region with homology to the adenovirus and ASFV cysteine proteases and likely belongs to a new family of SUMO-1 related enzymes (Byrd et al. 2002). The nucleophilic cysteine residue is activated by the imidazol group of the catalytic histidine residue modulating the cleavage reactions (Byrd et al. 2003). The I7L protease activity has been analyzed in vivo and in vitro to show that I7L is the core protein protease involved in the proteolysis of the major core proteins such as p4a, p4b, p25K and the p21K membrane protein at a conserved AG/X tripeptide, as indicated Fig 1.2. The absence of I7L resulted in morphological defects such as the irregular shape of dense particles and poorly formed cores inside of IMV particles suggesting a requirement for I7L protease activity in virus assembly (Byrd and Hruby, 2005, Ansarah-Sobrinho and Moss, 2004). Another VV encoded proteinase is the gene product of the G1L ORF. Amino acid alignment of the G1L ORF suggests that it belongs to a group of metalloendopeptidases, which contains a conserved HXXEH zinc-binding motif. (Becker and Roth, 1992) The HXXEH motif in G1L ORF exists as an inverted version of the motif, HXXEHXnE, found in a variety of matrix metalloendopeptidases (MMP) and shows structural similarity to the β-subunit of the yeast mitochondrial processing peptidase. (Honeychurch et al. 2006) Previous studies of G1L have suggested that this putative virus-encoded MMP is 15 capable of carrying out cleavage at the AG/S residues in p25K, producing 25K’ that is observed as another processed form of p25K, whereas the AG/A site in p25K is utilized by the I7L protease (Whitehead and Hruby, 1994b). Mutant viruses lacking G1L showed the virus particles with incomplete core condensations as well as arrested virus replications without disrupting the proteolysis of the core proteins (Hedengren-Olcott et al. 2004). This strongly suggests that the G1L protease participates in the structural maturation stage of IV to IMV just like I7L but at a later stage. However, the identification of other substrates and the specific function of G1L are still under investigation. VACCINIA VIRUS A12L CORE PROTEIN The VV A12L ORF encodes a late protein of 192 amino acids with an apparent molecular weight of 25 kDa. Previously, it was demonstrated that the precursor protein (p17K) is processed into the molecular weight of a 17kDa product (17K) apparently at an N-terminal AG/A site similar to p4b and p25K and that A12L processing is sensitive to rifampicin (Whitehead and Hruby, 1994a). However, unlike these two core proteins, of which only the mature peptides 4b and 25K are localized to the virion, both p17K and 17K are observed in the core of mature virions. This suggests that either A12L maturation is an incomplete processing event or both the precursor and the cleavage product may have an independent function in mature core formation. Despite of the fact that A12L undergoes proteolysis at an N-terminal AG/A site, A12L displays distinct characteristics as follows. First of all, A12L protein 16 contains multiple AG/X sites ([1] AG/A and [2] AG/K sites), which have not been analyzed to determine their utilizations as cleavage sites. Second, the localization of the A12L precursor as well as its cleavage products in virion particles indicates that the A12L protein might be subjected to contextual processing constraints. Third, the common characteristics shared with the other core proteins suggest that A12L is likely involved in the developmental stage of IV to IMV but the possible incomplete cleavage processing may also indicate different requirements and regulations for the A12L proteolysis such as the participation of G1L. Fourth, the net basic charge of A12L shows the possibility of its interaction with viral DNA and proteins, providing a clue to their biological function. Thus, the characterization of A12L proteolytic maturation processing as a substrate of VV proteolysis will contribute to a better understanding of the overall regulation of VV proteolytic processing and its participation in virus assembly. Therefore, we attempted to investigate the proteolytic maturation of the A12L protein by answering the following questions; which protease among I7L, G1L or cellular proteases is responsible for A12L processing; are there any other AG/X tripeptides utilized as cleavage motif; how is the processing regulated; what are the functions of the precursor and the cleavage product. In addition, the essentiality of the A12L protein and its cleavage reaction in virus replication has not been determined. Thus, the biological function of A12L in virion morphogenesis needs to be elucidated. Through the course of the studies presented here, we were able to demonstrate not only the properties of A12L proteolytic processing but also the participation/function of the A12L protein in VV replication. 17 Figure 1.1. Vaccinia virus life cycle. 18 Figure 1.1 Vaccinia virus life cycle. The VV life cycle begins with the attachment of virus to cell surfaces and ends with exiting from the cell. VV undergoes three stages of gene expressions represented by dotted arrows (blue), which are regulated in a temporal fashion. Virus assembly initiates with the formation of cytoplasmic foci called virus factories or virosomes (viroplasm), which are surrounded by crescent-shaped membranes (indicated by a red curve), forming the first characterized virus particle referred as immature virus (IV). The IV undergoes different post-translational modifications and evolves into the characteristic of brick-shaped intracellular mature virus (IMV). The IMV buds through the trans-Golgi network to obtain an extra membrane forming intracellular enveloped virus (IEV), which then fuses with the plasma membrane resulting in the loss of the outer membrane. If IEV is released from the cell, the virion is named extracellular enveloped virus (EEV) or if retained on cell surface, it is referred as cell-associated enveloped virus (CEV). 19 20 Figure 1.2 Diagram of VV virion-associated proteins and their cleavage products. This diagram provides information of six major virion-associated proteins, which undergo VV proteolytic processing: A10L, A3L, L4R, G7L, A17L and A12L. Black bars indicate cleavage residues utilized to produce major cleavage products, which are demonstrated with dotted lines. Orange bars represent the AG/X residues not utilized for cleavage events. Most proteins such as p4b, p25K, p21K and p17K are processed at an N-terminal AG/A site. P4a proteolysis occurs at AG/S and AG/T sites, while G7L undergoes cleavage at AG/F and AG/L sites. However, the AG/L in p4b and the AG/N in p4a are not utilized as cleavage sites. P25K is cleaved at an AG/S site located near the N-terminus, yielding 25K’. CHAPTER 2. CHARACTERIZATION OF A12L PROTEOLYSIS AND ITS PARTICIPATION IN VIRUS ASSEMBLY. 21 ABSTRACT Vaccinia virus (VV), a dsDNA virus undergoes a proteolytic processing to evolve from immature virus particles (IV) into intracellular mature virus particles (IMV). Most of structural core protein precursors such as p4a, p4b and p25K are assembled into previrions and then proteolytically processed yielding the cleavage products, 4a, 4b and 25K, which become components of a mature virus particle. The structural rearrangement that occurs via VV proteolysis is referred to as morphogenic proteolytic processing, and observed at a conserved cleavage motif, Ala-Gly-X (where X is any amino acid) and is catalyzed by a VV encoded proteinase, the I7L gene product. The VV A12L gene product, a 25kDa protein synthesized at late times during infection, is cleaved at an N-terminal AG/A site, resulting in a 17kDa cleavage product. Both of the A12L full-length protein and its cleavage product are localized to mature virions. The open reading frame (ORF) of A12L contains two more putative cleavage sites (Ala-Gly-Lys) located at internal and C-terminal regions, although cleavage at these sites has not been determined. Thus, we attempted to examine the in vivo processing of A12L by: determining the kinetics of the proteolysis, the responsible viral protease, and the function of the A12L protein and its cleavage events. Surprisingly, the 25kDa A12L precursor was cleaved into multiple peptides and the I7L cysteine proteinase catalyzes the AG/A cleavage events. Additional cleavage events were observed at both the N-terminus and C-terminus but no cleavage occurred at the two AG/K sites. An immunoprecipitation experiment in concert with mass spectrometry and N-terminal sequencing analyses led to the identification of VV core and membrane proteins, which may be associated with the A12L protein. 22 INTRODUCTION Vaccinia virus (VV), the prototype member of the Poxviridae family has a large double-stranded DNA genome. Replication and viral assembly occur entirely in the cytoplasm of host cells, in particular, in areas referred as viroplasms or virosomes. Virus assembly initiates at virosomes surrounded by crescent membranes, which subsequently engulf granular materials forming spherical-shaped particles named immature virions (IV). The IVs transform into brick-shaped structures referred to as intracellular mature virions (IMV) where viral DNA becomes condensed and packaged in an electron dense area and is covered by a viral envelope membrane. A portion of IMVs are enwrapped by a membrane cisternae derived from the trans-Golgi network and result in the formation of intracellular enveloped virus (IEV), which then become fused with the plasma membrane. If the IEVs remain associated with the cells, they are referred to as cell associated enveloped virus (CEV), or if they bud through the plasma membrane spreading outside of the cells, they are considered extracellular enveloped virus (EEV). Despite intensive study of VV morphogenesis, the mechanism required for the transformation of IV to IMV still remains poorly understood. The complex morphological developments during the transition include successful DNA replication, concatermer resolution (Delange, 1989, Merchlinsky and Moss, 1989), and condensation/packaging of the viral genome in IV particles (Morgan, 1976). This is followed by encapsidation of a transcription complex, formation of a defined core, and reorganization of virion membranes (Zhang et al. 1994). In 23 addition, a variety of post-translational modifications take place during the IV to IMV transformation. Proteolytic processing of VV structural precursor proteins is a prerequisite for proper virus morphogenic development and acquisition of viral infectivity. VV structural proteins synthesized during the last stage of infection are incorporated into pre-virions, which are proteolytically processed and developed into mature virions. Most of the cleavage events of virion-associated proteins take place after the second Gly residue of an Ala-Gly-X (AG/X) conserved motif producing mature virion components as shown in Table 2.1. Most of the precursors contain acidic residues upstream and basic residues downstream of the cleavage site, which are located within the N-terminal 60 amino acid residues and catalyzed by I7L, a cysteine proteinase (Byrd et al. 2002) (Table 2.1). As an example, p4b (A3L) and p25K (L4R) are synthesized at a late stage in the virus life cycle with molecular weights of 66kDa and 28kDa respectively, and are proteolytically processed at an N-terminal AG/A site to yield a 60kDa peptide, 4b and a 25kDa cleavage product, 25K respectively (Vanslyke et al. 1991a). P4a, however, a 102kDa precursor protein undergoes cleavage events at two different AG/X motifs: an AG/S and an AG/T located at amino acids 619 and 697 (Vanslyke et al, 1991b, Whitehead et al, 1995). Proteolysis at the AG/S and the AG/T sites leads to the release of a 62kDa (4a) and a 23kDa C-terminal peptide. Cleavage at the N-terminal AG/A site in A17L processes a 23kDa full-length precursor protein into a 21kDa peptide and additional cleavage at the C-terminal AG/N site is catalyzed by the I7L core protein proteinase (Ansarah-Sobrinho and Moss, 2004). G7L has two distinct 24 motifs, AG/F and AG/L. Mutagenesis studies have demonstrated that both of these sites are essential for the production of infectious virus (Mercer and Traktman, 2005). It is of interest to note that the presence of the cleavage site consensus motif is not sufficient enough to induce VV proteolysis. Although a partial cleavage was observed at an AG/S motif in the p25K ORF with an larger molecular weight of 25K, referred as 25K’ (Table 2.1), the tripeptides such as AG/L and AG/N located in the N-terminus of p4b and p4a ORF do not serve as reaction sites. However these alternate sites do appear to be utilized for the proteolysis of G7L and A17L . The VV A12L protein is synthesized at a late stage with an apparent molecular weight of 25kDa and is proteolytically processed at an N-terminal AG/A site yielding a 17kDa polypeptide. However, the A12L ORF contains two more putative AG/X sites (AG/K) in the internal region and C-terminus, which have not been analyzed for the utilization of cleavage events. The participation of A12L full-length protein and a cleavage product in mature virions suggested different regulation/function of A12L proteolysis (Whitehead and Hruby, 1994a). Thus, the research on A12L proteolytic processing may contribute to a more comprehensive understanding of the requirements/regulations for VV proteolysis other than the conserved cleavage motif. Here, we attempted to characterize the proteolytic processing of the A12L protein in order to determine the kinetics and the sites selected for the cleavage reactions. We also sought to identify the responsible protease. We were able to demonstrate possible A12L interactions with other VV proteins, providing a clue to the biological function of the A12L 25 protein in virus assembly. 26 MATERIALS AND METHODS Cell cultures. VV WR (Western Reserve strain) was grown on confluent monolayers of BSC-40 cells maintained in Eagle’s minimal essential medium (EMEM, Invitrogen) supplemented with 10% fetal calf serum (FCS, Invitrogen), 2 mM glutamine (Invitrogen), and 10 mM gentamicin sulfate (Invitrogen) at 37 °C in a 95% humidified atmosphere containing 5% CO2. For infection of WR, BSC-40 cells were maintained in infection media (EMEM) supplemented with 5% FCS, 2 mM glutamine, and 10 mM gentamicin sulfate and were infected at a multiplicity of infection (MOI) as indicated. Infected cells were harvested by centrifugation at 750x g for 10 min., and resuspended in phosphate buffered saline solution (PBS), which contained a protease inhibitor mix tablet (Roche), followed by three cycles of freezing and thawing to lyse the cells. After a post nuclear spin at 350x g at 4 °C, cell extracts were subjected to immunoblot or immunoprecipitation analyses. Rifampicin-reversibility experiment. Rifampicin stock solution (10 mg/ml, Sigma-Aldrich) was prepared in 100% Methanol (MeOH) and diluted out with dH2O for various concentrations. BSC-40 cells were synchronously infected with VV WR at an MOI of 5 plaque forming units (PFU)/cell and then treated with rifampicin (150 µg/ml). The treatment with rifampicin was performed at 5 hours post infection (hpi) for the rifampicin-reversible experiment. In order to compare the pattern of proteolysis in the absence and presence of the drug, the VV infected cell extracts were harvested when the drug was added and removed. After removal of rifampicin, new infection media with and without the drug was replaced. Infected cell pellets were re-suspended in PBS, subjected to three 27 cycles of freezing and thawing, and clarified by low speed centrifugation. Immunoblot analysis was performed on 12% NuPAGE Bis-Tris gels (Invitrogen). Antibody of A12L was generated by bacterial expression of A12L full-length protein, which was fused with an N-terminal 7X His tag and affinity purified over a Ni-NTA-agarose column. (Whitehead and Hruby, 1994a) Kinetics of A12L processing. Confluent BSC-40 cells were synchronously infected with VV WR at a MOI of 10 PFU/cell. The infected cells were harvested at various time points after infection (5, 8, 12, and 24 hpi) and resuspended in protease inhibitor-containing PBS, followed by a post-nuclear spin as previously described. The same amount of each sample was resolved on a 12% NuPAGE Bis-Tris gel (Invitrogen) prior to immunoblot analysis with A12L antisera and preimmune serum was used as a control. Pulse chase. Confluent monolayers of BSC-40 cells were synchronously infected with VV WR at a MOI of 10 PFU/cell. At 5 hpi, [35S]-methionine (10 µCi/mL, EasyTag EXPRE35S protein labeling mixture, Perkin Elmer Life Science) was added to the infection medium. After 1 hour, the radioactive medium was replaced with the medium containing 100X non-radioactive methionine/cysteine and chased for 19 hours. The infected cell extracts were used for immunoprecipitation and analyzed by electrophoresis on a 12% NuPAGE Bis-Tris gel. The gel was dried and exposed to a film for 72 hours. Immunoprecipitation. Protein A-Sepharose beads (Amersham) were prepared 28 according to manufacturer’s instructions. Infected cell extracts were lysed and diluted with RIPA buffer (Radioimmunoprecipitation buffer: 50 mM Tris [pH7.4], 1 mM NP-40, 150 mM NaCl, 1 mM EDTA, 0.25% sodium deoxycholate and protease inhibitor cocktail tablets) and pre-cleared for an hour- incubation with rehydrated beads at 4°C. After a short spin, the supernatant was transferred to a fresh tube and incubated with A12L antibody overnight at 4°C with shaking. Fresh beads were added and incubated for 2-3 hours at the same temperature. The beads were collected by a short centrifugation at 14,000x g for 40 sec, followed by three cycles of washing with 50% PBS/RIPA buffer and the final re-suspension in 4X sample buffer. After 5 min. of boiling, the samples were analyzed by gel electrophoresis on a 12% NuPAGE Bis-Tris gel. Plasmid construction and transfection. To determine the cleavage residues and the protease responsible for A12L protein processing, three possible AG/X sites (AG/A and two AG/K) were changed into IDI and IDR, respectively by Quickchange site-directed mutagenesis kit (Stratagene). The open reading frame (ORF) of both the wild-type A12L and the mutated A12L genes were placed into the pRB21 plasmid (Blasco and Moss, 1995), which has a VV early/late synthetic promoter. Primers for the site mutations were designed as follows: site-directed mutation 1 (SD1) for the first AG/A mutation at the residues 55-57, 5’-CTT AAT TCT CAA ACA GAT GTG ACT ATC GAC ATC TGT GAT ACA AAA TCA AAG AGT TCA-3’, site-directed mutation 2 (SD2) for the middle AGK site mutation the residues 119121 into IDR, 5’-CAG ATT GTC CAA GCT GTT ACT AAT ATC GAC CGC ATA GTT TAT GGT ACC GTC AGA GAC-3’, and site-directed mutation (SD3) for the C-terminal 29 AGK site mutation at the residues 153-155 into IDR, 5’-CTT CTA GGT ATC GAC TCA GTT AAT ATC GAC CGC AAG AAA CCA TCT AAA AAG ATG CCT-3’. Underlined characters indicate the mutation sites. SD1&2, SD1&3, and SD2&3 are double site mutations generated by using each combination of the primers. In addition, a FLAG-epitope was added to the C-terminus (FC) and N-terminus of each ORF (FN) to discriminate this transient expression from an endogenous protein. For transfection of the plasmids into BSC-40 cells, infection media of EMEM was placed in new eppendorf tubes and mixed with 2 to 10 µg of DNA and 30 µl of a transfection reagent, (DMRIE-C, Invitrogen). The mixture was vortexed, placed at room temperature for 20 min. and loaded on 6-well plates of ~100% confluent BSC-40 cells in concert with infection of VV WR or Dts8 (IHD-J derived I7L-termperature sensitive mutant virus, Kindly provided by Dr. Rich Condit) at an MOI as indicated. Two dimensional gel electrophoresis (2D gel eletrophoresis). Monolayers of BSC-40 cells in 100mm plates were infected with VV WR at an MOI of 10 PFU/cell and harvested at 24 hpi for the immunoprecipitation with anti-A12L as described above. The beads after the final spin were resuspended with 180 µl of rehydration buffer (9M Urea, 4% CHAPS, 50mM DTT, 2% ampholyte, and Bromophenol blue) for an hour at room temperature with shaking. After a short spin, the rehydration solution was applied into the strip tray where 11cm IPG Readystrips with a pH range of 3-10 (BioRad) were positioned overnight. The IPG strips were transferred to a Protean IEF tray (BioRad), which was placed to the Protean IEF cell for isoelectro-focusing. For the second dimensional gel 30 electrophoresis, the IPG strips were treated with sample preparation buffer (0.0625M Tris [pH 6.8], 5% β-mercaptoethanol, and 2% SDS), followed by treatment with Equilibration buffer (EB) I and II, which contained 200mg of DTT and 250mg of Iodoacetamide respectively in 10mL of EB (6M Urea, 2% SDS, 0.05M Tris [pH 8.8], and 20% glycerol). Then, the IPG strips were rinsed with 1X Running buffer and loaded on precast Criterion gels (BioRad) for separation on the basis of molecular weight. The gels were either stained with Coomassie R250 solution (0.1% Coomassie R-250, 40% MeOH, and 1% Acetic acid [HoAC]) or transferred to PVDF membrane, followed by the Coommassie stain R-250. Mass spectrometry of A12L-derived products. The BSC-40 infected cell extracts with VV WR at an MOI of 5 PFU/cell were subjected to immunoprecipitation experiment with anti-A12L as described above. The immunoprecipitates of A12L protein were resolved on 2D gel, followed by staining with Coomassie R-250 and de-staining until protein bands could be easily visualized. Protein bands of interest were excised in as small of piece of gel as possible. The gel slices were then dehydrated with acetonitrile (AcN) and rehydrated with 50 mM ammonium bicarbonate. This procedure was repeated and the final dehydration was dried under a vacuum. To each tube 10-40 µL of 1 µg/µL Promega trypsin in 10 mM Tris-HCl, pH=8.0 was added. After the enzyme solution was fully absorbed, the excess trypsin solution was removed and replaced with 40 µL of 10 mM Tris-HCl, pH=8.0. Each sample was incubated at 37ºC for 12-16 hours. The peptides were then extracted from the gel by vortexing with 40-80 µL of 80% AcN/5% TFA. The extraction fluid was placed in a new tube 31 and concentrated to 10-15 µL. The tryptic peptides were injected onto an HPLC system with a C18 column system (Jupiter, 0.2 x 10 mm, 300 Å) followed by liquid chromatography electrospray ionization quadrupole ion trap (LC-ESI-QIT) mass spectrometry (Finnigan LCQ). HPLC was performed with a gradient from 90% Buffer A (0.1% TFA in water) to 90% Buffer B (0.01% TFA and 5% water in acetonitrile) over 80 min (Yoder et al. 2006). The LC-ESI-QIT MS data was converted into Sequest DTA files and searched with the Mascot program. Mascot (Matrix Science, London, UK) software was used for the protein identification. The uninterpreted tandem mass spectral data were searched against the MSDB database, a composite, non-identical protein sequence database built from a number of primary source databases (Matrix Science). Differential centrifugation for subcellular fractionation. Confluent BSC-40 cells were infected with VV WR at a MOI of 10 PFU/cell and harvested as described. From 1mL of total cell lysates, 100µl was used as total cell extracts while the rest of the lysate was centrifuged at 700x g for 10 min. to pellet the nuclei. Subsequent centrifugation at 20,000xg for 30 min of the supernatant separated the soluble cytosolic fraction from the insoluble cytosolic fraction. Each pellet of nuclei and insoluble fraction was resuspended in 900µl of PBS (Grosenbach et al. 2000). 32 RESULTS Multiple cleavage products of A12L protein in vivo Previous work by Whitehead and Hruby (Whitehead and Hruby, 1994a) demonstrated that both the A12L precursor, p17K, and the AG/A cleavage product, 17K, were present in the core of assembling virions. To determine if any other A12L-derived protein species were evident within the cytoplasm of VVinfected cells, cytoplasmic extracts were prepared and subjected to immunoblot analysis using A12L antisera (anti-A12L) directed against the entire A12L protein. Surprisingly, not only were the 25kDa (p17K) and the 17kDa (17K) proteins detected, but also five other peptides with apparent molecular weights of 21, 18, 15, 13 and 11kDa were observed (Fig. 2.1A). Pre-immune sera of A12L did not cross-react with any of these peptides, suggesting that all of the proteins are indeed A12L-derived products (data not shown). In order to determine if proteolysis was the reason for the production of a number of A12L-derived peptides, we examined the pattern of A12L protein processing in the presence and absence of rifampicin. Rifampicin is an antibiotic known to reversibly block the assembly of VV by disrupting the viral membrane biogenesis and arresting maturational events of the structural core proteins, such as p4a and p4b (Katz and Moss, 1970). VV-infected cells were incubated with rifampicin at various concentrations from 100 µg/ml to 400 µg/ml for 24 hours (Fig. 2.1B). Using p4b as a positive control, we were able to show that cleavage was suppressed at concentrations of 100~200 µg/ml of rifampicin, while proteolysis was observed in the absence of rifampicin (Rif) treatment. Drug 33 concentrations of more than 200 µg/ml inhibited the expression of the precursor proteins, p4b and p17K. P17K was expressed in the presence and absence of rifampicin, but the smaller products were detected only in the absence of the drug, similar to the p4b processing. Next we performed a rifampicin-reversibility experiment to confirm that the A12L protein undergoes proteolytic processing, which produces multiple peptides. The hypothesis that the rifampicin-arrested proteolysis of A12L would be re-initiated by the removal of the drug has been proposed from other core protein processing experiments. Infected cells were treated with rifampicin at 5 hpi to allow the A12L precursor to be expressed and VV proteolysis to be suppressed for the next 14 hours (Fig. 2.1C). Rifampicininhibition of VV cleavage processing resulted in no production of the A12Lderived peptides. The removal of rifampicin, however, allowed the A12L-derived peptides to be produced whereas the continuous presence of rifampicin completely suppressed the proteolysis of A12L. In order to rule out the possibility of protein degradation, all the cell lysates were resuspended in PBS with a protein inhibitor cocktail tablet and the same amount of proteins were loaded for the immunoblot analysis. Thus, it is concluded that the A12L protein is proteolytically processed into six peptides, including 17K, in a similar morphogenesis-associated manner to other VV core proteins. Kinetic analysis of A12L For the kinetic analysis of A12L protein processing, cell extracts were prepared at various times post infection and equal amounts of the cell lysates were loaded for the immunoblot analysis (Fig. 2.2A). The 25 kDa precursor of 34 A12L was first detected at 5 hpi, demonstrating that the A12L protein is a late gene product. Over time the amount of the 25 kDa species accumulated throughout from 5 to 24 hpi. The 21, 18, 15, 13, and 11 kDa bands were first detected at 8 hpi and accumulated from 8 to 24 hpi. Unlike these other peptides, the 17 kDa peptide began to appear at 12 till 24 hpi. Although the A12L full-length protein is being expressed at 5 hpi, its processing appears to be initiated at 8 hpi and reaches a steady-state at 12 to 24 hpi. This is albeit slow compared to the processing of other core proteins, which takes 4 to 6 hpi (Vanslyke et al. 1991b). The slow kinetics of the A12L cleavage event may be attributed to the possibilities of either inefficient processing or different regulation of the A12L proteolysis. As expected from the previous pulse-chase experiment of A12L, the full-length protein by itself may be required for mature virions or once the quantitative requirement of the intermediate and final peptides is met, the A12L proteolytic processing may be arrested. Moreover, the fact that the 25 kDa precursor is processed into peptides in a range of sizes from 11 to 21 kDa suggests that the cleavage reactions are occurring not only at the AG/A site, but also at other residues such as the two AGK sites located internal and C-terminus of the A12L protein. To examine further characteristics of A12L processing, a pulse-chase labeling experiment was conducted in concert with immunoprecipitation (Fig. 2.2B). Using cells alone as a negative control, the 25 kDa full-length A12L protein was chased for 19 hours into four peptides with apparent molecular weights of 25, 21, 18, and 11 kDa. P17K remained relatively faint while the 21, 18, and 11 kDa 35 species became more evident after 19 hours of chase. The absence of these four peptides in the rifampicin-treated cells confirmed that all of these peptides are cleavage products. Importantly, the precursor remained after the chase suggesting that the cleavage reaction of the A12L protein did not proceed to completion. In agreement with the kinetic analysis, the proteolysis of A12L was halted when a steady-state mixture of intermediates was formed. Predicted characterization of A12L protein processing The multiple numbers and the molecular sizes of the A12L cleavage products together with the slow kinetics suggested cryptic proteolysis events occurring at AG/K sites. The amino acid sequences of the A12L proteins encoded by several representative orthopoxviruses shows a highly conserved alignment (>95% identity), indicating that A12L may be essential for virus replication. Moreover, both the N-terminal AG/A and the two AG/K motifs are conserved, suggesting that these motifs are possibly required for protein function and the cleavage reaction. As an attempt to identify the cleavage motifs, we considered the possible schematic cleavage products by utilizing different combinations of all three AG/X sites. The relative position of the three AG/X motifs within the A12L ORF is shown in Table 2.2. The molecular sizes of the predicted cleavage products and their calculated isoelectric points (pI’s) for both complete and incomplete processing of the A12L precursor are also indicated. If all three sites were utilized and the processing proceeds to completion, four small proteins with molecular weights of 6.5, 6, 4.4, and 3.6 kDa would be produced. However, the numbers of peptides detected during the previous immunoblot analysis implies 36 that the A12L protein is not fully processed at all of the AG/X sites. Rather, it appears that partial cleavage at AG/X sites in concert with redundant processing might result in production of multiple cleavage products. Of note, for the three major core protein precursors, p4a, p4b, and p25K, the portion of the protein that is removed by proteolysis is acidic (pI’s of 4.04, 4.08, and 3.26, respectively). Among the potential A12L fragments, only the 6 kDa (pI 5.9) and the 3.6 kDa (pI 4.8) have similar characteristics. Since the 6 kDa protein is not detected after 17K production, the 3.6 kDa peptide might be designed to be cleaved off. Moreover, the predicted molecular weight of the A12L protein is approximately 21 kDa, however it runs at an apparent molecular weight of 25 kDa. All of the A12L-derived cleavage products also run higher than predicted in this gel system. AG/A utilization and C-terminal proteolysis. In order to demonstrate the utilization of each AG/X site in the A12L ORF, we constructed A12L expression plasmids, which contained AG/A and AG/K site mutations into ID/I and ID/R, respectively (Fig. 2.3A). In addition, a FLAG epitope was attached at the C-terminus of the A12L ORF to discriminate the mutated expression from the wild-type endogenous protein. To examine the capability of a single site as a cleavage residue, different combinations of two sites were chosen as follows; N-terminal AG/A and middle AG/K sites (SD1&2), N-terminal AG/A and C-terminal AG/K sites (SD1&3), and middle and C-terminal AG/K sites (SD2&3). Under the assumption that each AG/X site is being utilized, there would 37 be peptides corresponding to the sizes of 15, 8, and 4kDa, resulting from Nterminal AG/A, middle AG/K and C-terminal AG/K cleavages respectively. Although all of the A12L constructs with double mutations demonstrated the fulllength proteins, a 17K protein was observed only in the expression of the SD2&3 plasmid, which contained the double AG/K site mutations. This result suggests a cleavage event only at the AG/A site without the utilization of AG/K residues. Consistently, none of the A12L mutant constructs conjugated with a FLAG epitope at the N-terminus displayed a 17K band, due to the N-terminal AG/A site proteolysis. (Fig. 2.3B) However, the N-terminal AG/A site mutated A12L ORF with a FLAG epitope at the N-terminus demonstrated another cleavage product corresponding to a 21kDa peptide, suggesting C-terminal proteolysis. The absence of a 21kDa signal in intact A12L with a FLAG at the N-terminus may be explained by the complete AG/A site cleavage prior to the C-terminal processing. Here, we were able to report only the AG/A site selection as an active cleavage residue, ruling out the possibility of AG/K utilization. Instead, possible proteolysis was discovered to take place at the C-terminus, yielding a 21kDa species. In addition, we were not able to detect the other A12L cleavage products in this transient expression experiment. Possible reasons are that cleavage events, which occur near the N- or C-terminus would result in the degradation of FLAG-tagged small peptides, or the FLAG epitope interrupts protein folding, allowing only partial cleavage. More likely, the cleavage reactions occurred in a cascade, which may also explain the loss of signals matching to the smaller A12L-derived peptides. If proteolysis takes place first at the AG/A site, followed 38 by another cleavage in close proximity to the C-terminus, a FLAG epitope at either end of A12L ORF would not detect any cleavage products. AG/A site cleavage by I7L, the VV proteinase. Since its maturation showed similar characteristics as p25K and p4b, whose cleavages are driven by the VV I7L cysteine protease, it was likely that A12L might be a substrate of I7L. By taking advantage of a temperature-sensitive mutant virus of I7L, named Dts-8 (Moerdyk et al. 2006), we were able to compare the processing of transiently expressed A12L protein with a FLAG epitope at its C-terminus (Fig. 2.4). While the full-length protein and 17K species were observed at the permissive temperature (31°C), the 17K species was absent at the non-permissive temperature (39°C), suggesting that I7L is the protease responsible for the AG/A cleavage of A12L. This result was confirmed by a rescue experiment using plasmid borne I7L (pI7L), which permitted p17K to be processed into 17K at the non-permissive temperature. Using as a plasmid vector alone, pRB21 as a negative control we did not see any signal under the permissive and non-permissive temperatures, indicating the signals are FLAGspecific. Consequently, we concluded that the I7L protease is responsible for the AG/A site cleavage. However, it has not been determined whether I7L is also responsible for the production of other peptides than 17K. Priority of N-terminal cleavage of A12L. The transient expression experiment of the A12L with a FLAG epitope and pI7L showed not only 17K but also some faint signal at the approximate 39 molecular weight of 21kDa. In order to determine if a 21kDa species is another cleavage product of A12L, we repeated the transient expression experiment transfecting A12L with a FLAG tag at the N-terminus (FN) and C-terminus (FC) in concert with WR and Dts-8 infection. As shown in Figure 2.5, both WR and Dts-8 infection at the permissive temperature demonstrated not only a 17K but also a 21kDa species. The 21kDa species, however, appeared only in the expression of A12L FC plasmid while no cleavage products were detected in the expression of the A12L FN plasmid. This indicates that a 21kDa peptide is not a Dts-8 virusspecific signal but a cleavage product of A12L corresponding to the N-terminal processing. The absence of a 21kDa species in the previous transient expression experiments and its relatively weak intensity suggests that the 21kDa peptide might exist as an intermediate cleavage product rather than a final product. Taken together with the fact that pA12L FN did not show any cleavage product, it was concluded that the cleavage events at the N-terminus occur prior to the Cterminal proteolysis, which results in the loss of the signal from pA12L FN expression. Possible association of A12L with a variety of VV proteins. In order to identify the cleavage residues of the A12L-derived peptides, immunoprecipitation of A12L was performed and resolved on 12% NuPAGE BisTris gel electrophoresis. Figure 2.6 shows the PVDF membrane, which A12L immunoprecipitates were transferred onto and stained with Commassie R-250. Four bands were detected with approximate molecular weights of 20kDa, which appeared to have two peptides, 21 and 18 kDa together, and 15, 13, and 11kDa. 40 Surprisingly, only one of the four peptides, corresponding to 11kDa turned out to be A12L, which was cleaved at the N-terminal AG/A site. In contrast, the ~21kDa peptide was identified as an A17L gene product, which is a virion membrane protein while the 14kDa peptide matched with the A14L protein. The sequence of the A17L 21kDa peptide represents a 21kDa cleavage product (21K) of the 23kDa full-length A17L protein (p21K), being generated by the removal of the Nterminal 16 amino acids. Consistently, the gene product of A14L, a phosphorylated membrane protein, is previously reported to interact with 21K, forming a stable complex with A17L and A27L envelope proteins (Rodriguez et al. 1996, Rodriguez et al. 1997). The A12L association with these VV membrane proteins may imply its associations with viral membrane biogenesis and reorganization. Although we were able to obtain sequence of each of the three peptides, some of them were mixed with other protein sequences and not enough protein of the 15 kDa was obtained for N-terminal sequencing. Thus, to identify other cleavage residues and determine more clearly which VV proteins are interacting with the A12L protein, we took advantage of immunoprecipitation with 2-dimensional (2D) PAGE for better resolution and mass-spectrometry (MS) as well as N-terminal sequencing for acquisition of protein sequences. Compared to a negative control, mock (Fig. 2.7) and antibody of A12L alone (data not shown), A12L specific spots were separated and cut out for Nterminal sequencing. On the basis of N-terminal sequencing (Fig. 2.7 bottom panel), a 13kDa peptide contains the amino acids (aa) at 57 to 66 residues of the A12L gene product while a 11kDa peptide showed two mixed sequences with the 41 same sequences as the 13kDa A12L peptide and the sequences of a F17R gene product from 11 to 19 residues. Due to N-terminal blockage of the other peptides, we employed mass spectrometry to identify the proteins. As a result, a variety of different VV proteins with sequence coverage from 12 to 55% were obtained, which is above the minimum coverage (5 %) for protein identification. The A12Limmunoprecipitates were separated into 39, 28, 25, 23, 15, 13, and 11kDa, which were identified as a gene products of A4L, L4R, A12L (full-lenth), A10L, A27L, A12L (cleaved at AG/A) and F17R, respectively with the sequence coverage as indicated in Fig. 2.7. It was surprising to report that the VV gene product identified as A4L, a 39kDa core protein is associated with a 60kDa major cleavage product of A10L (4a) whereas A27L, a 15kDa VV envelope protein, associates with A17L. The A4L, a 39kDa protein, is essential for virus replication, being required for the progression of IV to IMV (Williams et al. 1999). More recently, it was established that the complex of A4L with p4a/4a participated in early virus morphogenesis after its incorporation into mature virions and proteolytic maturation of p4a (Risco et al. 1999). Similarly, the A17L complex with A27L and A14L is responsible for the initial sequence of events of VV membrane formation and transition from IV to IMV (Rodriguez et al. 1996, Rodriguez et al. 1993, Rodriguez et al. 1997). This suggests that the A12L protein may have a role in early biogenesis of the VV membrane, having effects on virion assembly together with other VV membrane and core proteins. Intracellular localization of A12L and its cleavage products. Since N-terminal AG/A cleavage is observed in the A12L protein, it was 42 hypothesized that the N-terminal residues might be required for localization of A12L-derived peptides. Other core proteins such as p25K (L4R) have been shown to be cleaved at an N-terminal AG/A site like A12L. Absence of this cleavage in p25K resulted in impaired intraviral localization and loss of packaging into virions. (Lee and Hruby, 1995) This is commonly observed among different viruses, which express polypeptides and localize their cleavage products into different subcellular locations. Thus, it was of interest to determine whether the AG/A cleavage of A12L results in different intracellular localization of the cleavage products from the precursor. The infected cell lysates were fractionated by differential centrifugation to yield a nuclear fraction, a cytosolic fraction, which includes whole virions and cytoplasmic membraneous components, and a soluble cytoplasmic fraction (Fig. 2.8). As a control, the subcellular localization of the L1R gene product was examined. The L1R gene product is a VV membrane protein, which is known to be located in the nucleic and the membraneous fraction but not found in the soluble cytosolic fraction (Grosenbach et al. 2000). In contrast to L1R, both full-length A12L and its cleaved peptides were localized to not only nuclear fractions but also soluble/particulate cytosolic fractions of the total lysates. Therefore, the cleavage at the AG/A site in the A12L ORF does not lead to different subcellular localization of cleavage products. Rather, the fulllength proteins are distributed all around the cytoplasm and then undergo proteolytic processing, generating multiple peptides. It is also suggested that A12L protein is not subject to contextual processing, which would demonstrate all of the cleavage products only in the fraction that contains whole virions. 43 DISCUSSION Investigation of the proteolytic maturation of the VV A12L core protein yielded several unexpected results. It is most interesting that proteolytic processing of the VV A12L protein produces a mixture of products and does not proceed to completion, as do the other VV core proteins previously studied. There are two hypotheses to consider for this phenomenon. First, perhaps some of the multiple cleavages are “accidental”, occurring due to a quirk of having cryptic AG/X sites within the precursor. This assumption appears unlikely since all of the sites are well conserved with the orthopoxviruses and the viruses have had ample time to remove the sites by mutation if cleavage was deleterious. Furthermore, other core protein precursors have cryptic cleavage sites, (AG/S in p25K, and AG/N in p4a) which are either not recognized or do not interfere with the reaction proceeding to completion. Second, a more intriguing possibility is that the incomplete processing of the A12L precursor is required to produce multiple protein species, some of which have different functions. Certainly for other viruses such as poliovirus, partially cleaved peptides are known to have different functions from the fully matured products (Hellen and Wimmer, 1992). In addition, the multiple cleavage products of A12L show both characteristics of formative and morphogenic processing pathway, which indicate that the A12L fulllength protein and its derived peptides are involved in not only assembling mature virions but also in producing non-structural proteins. In contrast to the presence of multiple cleavage products in vivo, only AG/A site cleavage is reported here, catalyzed by the I7L VV core protein proteinase. 44 Despite no observation of cleavage at the putative AG/K residues, it cannot be ruled out that the AG/K sites may become recognizable by the proteinase after the first cleavage. In consideration of the fact that the A12L proteolysis takes place at an N-terminus in advance to a C-terminal cleavage, it is more convincing to speculate that the A12L cleavage is regulated in order, of which initial blockage may inhibit a subsequent cleavage by forming an improper structure not fully accessible to the proteinase. However, the proteolysis at both ends of A12L raises another possibility that the A12L proteolysis utilizes a new cleavage motif other than the AG/X site in concert with involvement of another protease. Given this atypical behavior it is of interest to determine the essentiality of the A12L protein in viral replication. Therefore, a conditional A12L mutant virus (vvtetOA12L) may need to be designed and used to address the role of A12L as well as how important each AG/X site is to the function of A12L. The identification of the numbers of viral proteins immunoprecipitated with antibody of A12L is contradictory to the fact that A12L precursor proteins are processed into the multiple peptides. This result could be explained by crossreactivity of A12L antibody. Considering the immunoblot analyses at Fig. 2, which demonstrated the consistent pattern of detection that are regulated by rifampicin, it would be likely that antibody of A12L precipitates virus-encoded late gene products as the identified proteins by mass spectrometry and N-terminal sequencing analyses are synthesized at the late stage. Recent studies of early morphogenic processing events have provided the 45 participation of the membrane proteins such as A17L, A14L and A27L in early development of IV particles as well as IEV particles, recruiting nascent viral membranes to the viral foci, inducing their stable attachment to the surfaces of viral factories, and developing envelopment of IMV particles (Traktman et al. 2000). Unlike these membraneous proteins, VV core proteins are not directly responsible for generation of viral membranes. Instead, the association of A4L with 4a plays a role in the correct assembly of nucleoprotein complex and organization of IV content with the membranes while F17R (a DNA-binding phosphoprotein), and L4R (a DNA-binding protein) are proposed to work for the correct packaging of the viral genome and efficient transcription (Risco et al. 1999, Heljasvaaraet al. 2001, Wilcock and Smith, 1994, Zhang and Moss, 1991). The participation of the proteins associated with A12L not only in the development of early viral membranes but also the correct assembly of the nucleoprotein complex and IEV development suggests that the A12L may be involved in multiple stages of virus morphogenesis. 46 47 Table 2.1. Vaccinia virus morphogenic proteolysis. VV has six structural precursor proteins, which undergo morphogenic proteolysis. Both A3L and L4R are catalyzed at an AG/A site while A10L shows the cleavage at AG/S and AG/T. A17L is cleaved at AG/A as well as AGN, which is not utilized for A10L proteolysis. G7L utilizes AG/F and AG/L, of which site in A3L is not catalyzed. A12L has shown to be processed at an N-terminal AG/A just like other core proteins, while AG/K sites in residue 120 and 154 have never been determined. Thus, the consensus motif is not enough to induce VV proteolysis. Most of cleavage events are catalyzed by I7L cysteine proteinase whereas the responsible for the proteolysis of G7L and A12L remains unknown. From left to right, the table shows the name of gene product, cleavage motif (red: utilized, blue: not utilized, underlined: not determined), the location of cleavage product, and the responsible proteinase. 48 Table 2.2. The predicted molecular weights and pI’s of potential A12L cleavage products. The schematic cleavage products at each AG/X site were drawn with the molecular weights of 6, 6.5, 3.6, and 4.4kDa. Utilizing single and double AG/X sites, proteolytic processing of A12L were predicted as follows: cleavage at the middle AG/K site would only produce a 12kDa and a 8kDa peptide, while cleavages at the C-terminus AG/K site and the N-terminus AG/A site only would introduce a 16kDa and a 15kDa product (bottom), respectively. The utilization of both AG/A and N-terminal AG/K site would generate a 10kDa peptide. 49 Figure 2.1. Multiple cleavage products of A12L protein. 50 Figure 2.1. Multiple cleavage products of A12L protein. A. Multiple peptides detected by immunoblot analysis of VV-infected cells. Mock: cells alone, WR: Western Reserve VV infected cell extracts. BSC-40 cells were infected by VV WR at an MOI of 10 PFU/cell and harvested at 24 hpi. B. Rifampicin inhibition of A12L protein processing. BSC-40 cells were infected with VV WR at an MOI of 1 PFU/cell for 24 hours and incubated with rifampicin at concentrations of 0, 100, 150, 200, 300, and 400 µg/ml from left to right. As a positive control of drug induced-inhibition of VV proteolysis, p4b processing was demonstrated. C. Rifampicin-reversibility experiment. Cells were infected with VV at an MOI of 5 PFU/cell and treated with rifampicin (150 µg/ml) at 5 hpi. The rifampicin was replaced with new infection media with and without the drug at 19 hpi to determine the effects of the drug on A12L protein processing for 12 hours. Mock (lane1): cells alone, Rif- (lane 2): rifampicin-free cell extracts harvested at 5 hpi, Rif- (lane 3): rifampicin-free cell extracts harvested at 19 hpi, Rif+ (lane 4): rifampicin-treated cell extracts harvested at 19hpi, Rif+/- (lane 5): rifampicin treated cells at 5 hpi and new media without the drug was replace at 19 hpi, Rif+/+ (lane 6): rifampicin treated cells at 5 hpi and new media containing rifampicin was replaced at 19 hpi. Both Rif+/- and Rif+/+ were harvested at 31 hpi. 51 . Figure 2.2. Kinetic analysis and pulse chase of A12L protein. 52 Figure 2.2. Kinetic analysis and pulse chase of A12L protein. A. Kinetic analysis of proteolytic processing of A12L. BSC-40 cells were infected with VV WR at an MOI of 10 PFU/cell for 30 min. and harvested at different time courses as indicated above each lane. A 25 kDa protein corresponds to the A12L precursor, while smaller peptides with the molecular weights from 21 to 11 kDa are suspected to be the A12L-derived cleavage products. B. Immunoprecipitation of pulse-chase labeled VV-infected cell extracts. Infected cells were labeled with [35 S]-methionine for an hour at 5 hpi and chased with 100x non-radioactive methionine/cysteine. Each pulse (P) and chase (C) of cells alone (Mock), rifampicin-treated (Rif+) and no rifampicin-treated WR (WR) infections were analyzed. The labeled full-length of A12L protein was processed into three peptides with apparent molecular sizes of 21, 18, 11kDa. The precursor remained after the chase suggesting that A12L proteolysis did not go to the completion. 53 Figure 2.3. Proteolysis of A12L. 54 Figure 2.3. Proteolysis of A12L. A. The A12L ORF with double AG/X site mutations were placed into pRB21, which has an early/late synthetic promoter and appended with a C-terminal FLAG epitope (FC). The N-terminal AG/A site and internal AG/K site mutations, the N-terminal AG/A and C-terminal AG/K site mutations, and the internal and C-terminal AG/K site mutations were indicated as SD 1&2, SD 1&3, and SD 2&3, respectively, of which transient expression would result in 4, 8, and 15kDa cleavage product. The amino aicds, A, G, and K were converted into I, D, and R, respectively. B. All of the plasmids contained the same mutations as described above except a FLAG epitope in the Nterminus (FN) of A12L ORF. A12L-FN represents A12L intact ORF with a FLAG epitope at the N-terminus while Ara-C refers to the cells transfected with A12L FN in the presence of cytosine arabinoside (Ara-C, 40µg/mL). The FLAG tag at the N-terminus of each mutant plasmid would represent the products of 16, 12, and 6kDa peptides resulted from each utilization of the Cterminal AG/K, internal AG/K, and N-terminal AG/A site. 55 Figure 2.4. The AG/A site cleavage by the VV proteinase I7L. BSC-40 cells were transfected with a plasmid containing a FLAG epitope at C-terminus of A12L ORF (pA12L-FC) and infected with WR or Dts-8 (I7L temperature-sensitive mutant virus). Having WR-infected cells as a positive control, Dts-8 infection at the permissive (31°C) and non-permissive (39°C) temperatures showed I7L participation in A12L cleavage event. pA12L: plasmid born A12L under an early/late synthetic promoter, pRB21: vector plasmid of pA12L. pI7L: plasmid born I7L in pRB21. 56 Figure 2.5. N-terminal proteolysis of A12L. To determine another cleavage reaction observed by a FLAG epitope at the C-terminus of A12L (pA12L-FC), the A12L plasmids with a FLAG epitope at C-terminus (pA12L-FC) and N-terminus of A12L ORF (pA12L-FN) were transfected into BSC-40 cells and infected with VV WR and Dts-8 (I7L temperature-sensitive mutant virus) at an MOI of 5 PFU/cell. Both infections were incubated at permissive temperature (31°C). 57 Figure 2.6. Identification of A12L-derived peptides. BSC-40 cells were infected with WR at an MOI of 5 PFU/cell, of which cell lysates were subjected to immunoprecipitation analyses with anti-A12L. The immunoprecipitates were resolved in 12% gel, transferred to PVDF membrane, followed by staining with Coomassie R-250. The four bands in molecular weights of 20, 15, 13, and 11kDa were cut out and sent for Nterminal sequencing. The sequence data we obtained from N-terminal sequencing is represented in the table. Only the 11kDa peptide was identified as A12L peptide, which contained sequences after the N-terminal AG/A cleavage event, while 13kDa and 20kDa peptides were identified as A14L and A17L proteins. Arrows indicate the peptides, which are N-terminally blocked or not enough protein to analyze the amino acid sequences. 58 Figure 2.7. Association of A12L with other VV proteins. 59 Figure 2.7. Association of A12L with other VV proteins. The immunoprecipitates with anti-A12L were absorbed in IPG strips for two dimensional gel eletrophoresis (2D-gel), which were stained with Coomassie R-250. The distinguished spots were cut out and sent for either N-terminal sequencing or MS analyses (LC-ESI-Q-TOF MS). The upper panel shows the immunoprecipitates of the cells alone (Mock) while the bottom panel is WR-infected cell lysates (WR) immunoprecipitated with anti-A12L. Arrowheads are the A12L-derived peptides distinguished from mock (upper panel) and antibody alone (data not shown). The table underneath the 2D gel stains shows the summary of the total results from both analyses. 60 Figure 2.8. Subcellular localization of A12L protein. BSC-40 cells were infected with WR at an MOI of 10 PFU/cell and the cell extracts were separated by differential centrifugations. TCE: total cell extracts, NP: nuclear pellet fraction, PC: particulate cytosolic fraction, which contains whole virions and membraneous cytosolic portions, SC: soluble cytosolic fraction. Right and left panels show each localization of A12L and L1R, respectively. The localization of L1R, a VV membrane protein in the nucleic fraction and particulate cytosolic fraction showed the differential fractionation was conducted correctly. CHAPTER 3. ESSENTIALITY OF A12L IN VIRAL REPLICATION AND MORPHOLOGICAL TRANSITION. 61 ABSTRACT Like the major vaccinia virus (VV) core protein precursors, p4b and p25K, the 25 kDa VV A12L late gene product (p17K) undergoes proteolysis at the conserved Ala-Gly-Ala motif. However, unlike p4b and p25k, the p17K precursor was cleaved into multiple peptides via additional cleavage events. Furthermore, the association of A12L with VV core and membrane proteins suggested that A12L might have a function in the generation of immature virion (IV) membranes and core formation of intracellular mature virions (IMV). Here, in order to test the requirement of the A12L protein in viral replication and elucidate its biological function, a conditional lethal mutant virus (vvtetOA12L) was constructed to regulate A12L expression by the presence or absence of tetracycline. In the absence of tetracycline, replication of vvtetOA12L was inhibited by 75% and this inhibition could be overcome by transient expression of the wild-type copy of the A12L gene. In contrast, mutation of the AG/A site abrogated the ability of the transfected A12L gene to rescue just like other A12L truncates, indicating that A12L proteolysis is required for VV replication. Electron microscopy analysis of the A12L deficient virus infection demonstrated the aberrant viral assembly, which displayed albeit larger aggregates of virus factories, viroplasm detached from the viral membrane and disrupted core formation inside of IMV. Taken together, we concluded that the VV A12L gene product and its cleavage products are required during the viral replication cycle. 62 INTRODUCTION Proteolytic processing in vaccinia virus (VV) plays an important role in morphogenic transitions during the virus replication cycle. To date, six VVencoded, proteolytically processed proteins have been reported. They are the gene products of A10L (p4a), A3L (p4b), L4R (p25K), A17L (p21K), G7L, and A12L (p17K) (Vanslyke et al. 1991b, Whitehead et al. 1995, Vanslyke et al., 1991a, Whitehead and Hruby, 1994a, Mercer and Traktman, 2005). Extensive studies of the structural proteins have provided more specific mechanisms of VV proteolysis in terms of the transformation of immature virions (IV) into intracellular mature virions (IMV). One of the VV major core proteins, A10L has been shown to be essential through a IPTG (isopropyl β-D-thiogalactopyranoside)-regulated mutant virus, with more than one log reduction in virus yield in the absence of the inducer (Heljasvaara et al. 2001). Aside from the expression of A10L, VV protein synthesis was the same both in the presence and absence of IPTG while little processing of p4b and p25K occurred in the absence of the inducer. The absence of A10L resulted in defective virus morphology such as IV-like particles, which lacked dense viroplasm and consequently produced the irregular-shaped virus particles. Regardless of the disturbed IV contents, the formation of the viral membrane and envelope was indistinguishable from WR infected cells. On the basis of the electron microscopic analyses, it was suggested that p4a and its cleavage products are required for VV proteolysis and the correct organization of the nucleocomplex within the IVs (Heljasvaara et al. 2001, Risco et al. 1999). 63 L4R (p25K), a DNA binding protein is essential for virus replication. A conditional mutant virus of p25K demonstrated approximately 80% of the wild-type level of mature virus particle formation such as intracellular mature virion (IMV) or extracellular enveloped virion (EEV) but a two log-reduction in infectivity, indicating that p25K is required for acquisition of viral infectivity not for the virus particle formation. This inconsistent result implied that p25K might be involved in early stage of infection such as early transcription or unpackaging viral DNA and core (Wilcock and Smith, 1994). The absence of p25K led to a defective phenotype with non-associated viroplasm and surrounding viral membranes but no blockage of proteolysis of p4a and p4b, suggesting an important role for p25K in correct incorporation of viral DNA and cores with immature virus membrane but not for VV proteolysis. Both the G7L and A17L gene products are essential for virus replication and are involved in the early development of IV membranes in contrast to A10L and L4R, which play a role in the correct IV content and its association with the membrane. G7L, a phosphoprotein associated with the A30L and H5R proteins, is responsible for the correct recruitment and attachment of crescent-shaped membranes to viroplasms (Szajner et al. 2003). The absence of G7L subsequently led to defective IV formation, which showed tubular elements apart from the granular virosomes and instead displayed empty or multiple wrapped IV particles, eventually affecting the integrity of the virosomal matrix in corporation of A30L and H5R (Mercer and Traktman, 2005, Szajner et al. 2004). The A17L mutant virus under non-permissive conditions produced large aggregates of 64 accumulated electron-dense materials, and numerous vesicles/tubules engulfing viroplasms, demonstrating that A17L is an essential component for generation of IV and IMV membranes (Rodriguez et al. 1996, Wolffe et al. 1996, Mercer and Traktman, 2005). A17L (p21K) and its cleavage product (21K) co-localized with GTPase Rab1, a marker of intermediate compartment (IC) membranes, the origin of viral membrane (Krinjse-Locker et al. 1996), suggesting the A17L participation in very early stage of the membrane biogenesis. Another viral membrane component, A14L, was localized into virosomes only in the presence of A17L, which also associated with A27L, an envelope protein required for IMV transport out of virus factories (Rodriguez et al. 1996, Sanderson et al. 2000) Thus, A17L protein participated in multiple steps of VV morphogenesis from biogenesis of viral membranes to the formation and envelopment of IMV particles. Despite the fact that most of the VV structural precursor proteins that undergo proteolytic maturation play a role in the organization of the first recognized membrane and the formation of viral genome content, the essentiality and biological role of the A12L gene products have not been analyzed. VV A12L is a late gene product, which is proteolytically processed from a 25kDa precursor into a 17kDa cleavage product (Whitehead and Hruby, 1994a). Its proteolysis is similar to the processing of the other VV core proteins in that the cleavage is regulated by rifampicin, takes place at the conserved recognition motif, Ala-Gly-X (X: any amino acid), is catalyzed by the I7L VV core protein proteinase, and is associated with mature virions. On the other hand, there is also an evidence to distinguish A12L proteolysis from other cleavage events. 65 First of all, a 25kDa full-length protein is processed into more than one cleavage product, yielding a total of six peptides. Second, the proteolysis of A12L does not proceed to completion, rather it is halted after a mixture of intermediate and final products is obtained, suggesting an incomplete but redundant cleavage processing of A12L. Third, A12L maturation takes relatively longer in comparison to p4b and p25K, which are also cleaved at an N-terminal AG/A residue. Despite the same cleavage motif located within the N-terminal 60 residues, the kinetics of A12L proteolysis is more similar to that of p4a maturation, which takes 8 to 12 hours after infection. Thus, A12L cleavage event may introduce different requirements or participants for the regulation of VV proteolysis. To investigate the requirement of the A12L protein and elucidate its function in virion-morphogenesis, we constructed a conditional mutant virus of A12L, in which protein expression can be regulated by tetracycline (Tet) (Hedengren-Olcott and Hruby, 2004). The Tet-regulated genetic system is introduced in Table 3. 1. By placing the Tet operator (TetO) in front of the A12L open reading frame (ORF), A12L gene expression can be suppressed by the presence of the Tet repressor (TetR), which binds to the TetO and consequently blocks the transcription of A12L. In the presence of Tet, however, Tet binds to TetR and leaves TetO available for transcription. For this system, the recombinant virus contains the TetO and we used T-REx 293 cells (Invitrogen), which constitutively express the TetR. In order to construct the mutant virus, we designed a plasmid, which contains the Neomycin selective marker (NeoR) as well as two homologous regions to A12L and its neighbor gene, A13L, with the 66 TetO placed between A12L and A13L. Two rounds of virus homologous recombination resulted in generating an A12L mutant virus, referred to as vvtetOA12L. Here, we report that the absence of A12L results in approximately one log reduction of virus replication in concert with phenotypic defects. In addition, plasmid bourn A12L with an AG/A site mutation, which would prevent A12L proteolysis, failed to rescue the lack of A12L demonstrating that cleavage of A12L is essential for virus replication as well as formation of mature virions. 67 METHODS AND MATERIALS Cell cultures. VV WR (Western Reserve strain) was grown and titered on confluent monolayers of BSC-40 cells maintained in Eagle’s minimal essential medium (EMEM, Invitrogen) supplemented with 10% fetal calf serum (FCS, Invitrogen), 2 mM glutamine (Invitrogen), and 10 mM gentamicin sulfate (Invitrogen) at 37 °C in a 95% humidified atmosphere containing 5% CO2. For infection of the conditional mutant virus of A12L (vvtetOA12L), T-REx 293 cells (Invitrogen) were grown in Dulbecco’s modified Eagle’s medium (D-MEM, Invitrogen) supplemented with 10% Tet system approved fetal bovine serum (BD Biosciences), 2 mM Glutamax (Invitrogen), and 1% penicillin–streptomycin (Invitrogen), and incubated as described above. Blasticidin (5 µg/ml, Invitrogen) was added to the D-MEM growth media for selection of the pcDNA6/TR plasmid (Yao et al. 1998), which expresses the tetracycline repressor (TetR). Virus infections and titers. BSC-40 cells in infection media of EMEM supplemented with 5% FCS, 2 mM glutamine, and 10 mM gentamicin sulfate were infected with VV WR at an multiplicity of infection (MOI) as indicated. Infected cells were harvested by centrifugation at 750x g for 10 min., followed by a post nuclear spin at 350x g at 4 °C. The mutant virus (vvtetOA12L) was grown on T-REx 293 cells as previously described. When T-REx 293 cells were approximately 80% confluent, vvtetOA12L virus in phosphate-buffered saline (PBS) at an MOI of 1 plaque forming unit (PFU)/cell were placed on the cells for 30 min at room temperature. The infection D-MEM containing 5% of Tetapproved FBS, L-glutamax (10 mM), penicillin–streptomycin (10 mM) was then 68 added. Tetracycline (10-30 µg/ml, Sigma–Aldrich) was placed in infection D-MEM media for induction of the A12L protein. Cell extracts were harvested at 24-48 hours post infection (hpi) by centrifugation (750x g) for 5 min at 4°C, followed by three cycles of freezing and thawing to lyse the cells. Virus titers were conducted on BSC-40 cells, incubated at 37°C for 40 hours, and stained with 0.1% crystal violet solution in 30% ethanol. Construction of conditional mutant A12L virus (vvtetOA12L). VV WR was used for the construction of the conditional mutant A12L virus (vvtetOA12L). The tetracycline operator (TetO) was inserted in front of the A12L ORF by virtue of two-step polymerase chain reaction (PCR) and amplified with 215 nucleotides (nts) upstream of the A12L ORF and 213 nts downstream of the A13L ORF. The PCR products were cloned into the p7.5:NEO vector (Franke et al. 1985), resulting in the construction of the p7.5:TetOA12L:NEO plasmid. Transfection of the p7.5:TetOA12L:NEO plasmid in concert with VV WR infection induced the first recombination (Table 3.1). The Neomycin resistance gene (NEOR) in the p7.5:TetOA12L:NEO plasmid was used as a transient selective marker in the presence of Geneticin G418 sulfate (Invitrogen). The second recombination of NEOR-containing viruses occurred in the absence of Geneticin G418 sulfate, producing a wild type virus and an A12L mutant virus (vvtetOA12L) containing TetO without NEOR. Plaque purifications were performed in concert with PCR screens using the primers specific for TetO and 3’ end of A12L ORF to identify pure vvtetOA12L isolates. Experimental infections of vvtetOA12L were carried out in T-REx 293 cell line, which constitutively expresses the Tetracycline 69 repressor (TetR). Transfection and marker rescue. In order to rescue the absence of A12L by plasmid-bourn intact A12L (pA12L), full-length of A12L ORF was placed right after an early/late synthetic promoter in pRB21 (Blasco, R. 1995). The same ORF were placed in TOPO TA cloning vector (Invitrogen) to have its native promoter, which contained upstream 233 nucleotides (p233-A12L). To place A12L ORF in both pRB21 and TOPO vector, two different sets of primers were designed; pA12L-forward: pA12L-reverse: 5’-CACTCCATGGATGGCGGATAAAAAAAATTTAGCC 5’-CAGGATCCTTAATACATTCCCATATCCAGACAAC; and p233- forward: 5’-ATGGCGGATAAAAAAAATTTAGCC and A12L-reverse: 5’-TTAATACA TTCCCATATCCAGACAAAATTCG. In order to construct A12L with abrogated cleavage at an N-terminal AG/A site (AG/A), the AG/A sites were altered into ID/I by site-directed mutagenesis kit (Stratagene) with a specific primer, which has the changed sequences at the residues 55-57 (underlined), 5’-CTTAATTCTCAA ACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3’ and was inserted in pRB21 vector. To construct all of the A12L truncates, different forward primers were designed as follows. For the construction of 17K, we used a 17K-forward primer, 5’-ATGGCATGTGATACAAAATCAAAGAGTTC and the A12L reverse primer, while 2K and 3K were generated by a A12L forward primer, 5’- ATGGCG GATAAA AAA AATTTAGCC and reverse primers covering nucleotides at middle and C-terminal AG/K: 2K-reverse: 5’-TTAACCAGCATTAGTAACAGCTTGGAC and 3K-reverse: 5’-TTACCCAGCATTAACTGAGTCGATACCTAG. To make A12L 70 truncates cleaved at an N-terminal AG/A site and at a middle AG/K (A2K) or Cterminal AG/K (A3K), we used the 17K-forward primer, and the 2K and 3K reverse primers. The PCR products were conjugated with the 233nts native promoter by performing another PCR and placed into TOPO TA cloning vector (Invitrogen). For transfection of plasmids into T-REx 293 cells, infection media of DMEM medium was placed in new eppendorf tubes and mixed with 2 to 10 µg of DNA and 30 µl of the transfection reagent, DMRIE-C (Invitrogen). After vortexing the mixture, it was placed at room temperature for 20 min. and loaded on 6-well plates of ~60% confluent T-REx 293 cells. The cells were incubated at 37 °C for 5-6 hours and infected by vvtetOA12L at an MOI of 1 PFU/cell for 24 hours. Virus titers were determined as described earlier. Electron microscopy. T-REx 293 cells were infected at an MOI of 1 PFU/cell with vvtetOA12L and harvested at 24 hpi by centrifugation (270x g) at 4°C. The cell extracts were resuspended with 1X PBS, followed by incubation with fixative buffer (2% glutaraldehyde, 1.25% paraformaldehyde in 0.1 M cacodylate buffer [pH7.3]) for 2 hours at room temperature. Postfixation, ultrathin section, and staining were performed as described (Hedengren-Olcott et al. 2004). 71 RESULTS Tet-regulated conditional mutant virus of A12L. To examine the regulation of a conditional mutant virus of A12L (vvtetOA12L), we infected T-REx 293 cells with vvtetOA12L at various concentrations of Tet from 0 to 40 µg/mL (Fig. 3.1A). Virus yield increased as the concentration of Tet increased from 0 to 30 µg/mL. This increased virus yield demonstrates that vvtetOA12L replicates in a Tet-dependent manner. Setting the optimal concentration of Tet at 30 µg/mL, we performed a one-step growth curve of vvtetOA12L with the cell extracts harvested at different time points after infection. Figure. 3.1B shows the initial drop of virus yield at 5 hours post infection (hpi), when the A12L protein begins to be expressed as a late gene product. The maximum viral yields of vvtetOA12L in the presence of Tet was obtained at 24 hpi with approximately one log difference, which is attributed to the expression of the A12L protein and its essentiality in virus replication. Essentiality of A12L protein in VV replication. The sequence alignment of the A12L ORF with other representative orthopoxviruses such as cowpox, variola, and ectromelia viruses has shown highly conserved sequence alignment with more than 95 % identity. Thus, it is expected that A12L may be essential for virus replication. Moreover, both the Nterminal AG/A and the middle AG/K motifs are highly conserved while the Cterminal AG/K residue is relatively less conserved. This may indicate that these motifs are possibly required for maintaining the protein function and proteolytic maturation. 72 To determine the essentiality of the A12L protein in viral replication, a conditional A12L mutant virus (vvtetOA12L) was used to address the requirement of the A12L protein and the AG/A site cleavage for viral replication. To begin with, A12L protein expression was confirmed by immunoblot analysis with A12L specific bands obtained only in the presence of Tet (data not shown). Infection of vvtetOA12L was carried out in T-REx 293 cells and titered on BSC-40 cells. Approximately 75 % reduction of virus titer was observed in the absence of Tet (Fig 3. 2), suggesting that A12L is required for VV replication. Confirmation that the defect in replication was due to the shut-off of A12L expression was obtained by marker rescue experiments. Plasmid-borne A12L under the control of either its native promoter, which includes 233 nucleotides upstream of the A12L ORF (p233-A12L), or an early/late synthetic promoter in pRB21 vector (pA12L) provided almost 100 % rescue in virus yield. This rescue experiment established the essentiality of A12L expression in viral replication despite the leakiness of vvtetOA12L. Another rescue experiment of A12L expression with the AG/A site mutation (AG/A) failed to complement the absence of A12L protein, resulting in a virus yield, which is similar to the titer of vvtetOA12L infection in the absence of Tet. Therefore, it is suggested that cleavage at the AG/A site plays an essential role in A12L functionality. In comparison to the AG/A mutant A12L plasmid, the Nterminal AG/A cleavage product, 17K, showed even lower levels of rescue, implying that the proper removal of the N-terminal residues at the AG/A site is required for virus replication. As an attempt to discover the final cleavage product of A12L, we 73 constructed possible truncates of A12L proteins by utilizing all three AG/X sites and examined the virus replication under the transient expression of each truncate (Fig 3. 2). Since all the truncates of A12L failed to rescue the lack of A12L, it is hypothesized that A12L may not be proteolytically maturated into one final cleavage product, rather required to have a mixture of different sizes of products, which are all essential for VV replication. The failure of two AG/K mutations of A12L ORF also indicated that all three AG/X residues play an important role in maintaining the biological function of A12L proteins (data not shown). Morphology defects in the absence of A12L expression. In order to study the phenotypic effects of A12L repression in the mutant virus, T-REx 293 cells were infected with vvtetOA12L in the presence and absence of Tet (Fig. 3.3). In the presence of Tet, vvtetOA12L was able to assemble into mature virions as wild type VV does, producing oval particles with condensed cores (Fig. 3.3). In the absence of Tet, vvtetOA12L displayed several phenotypic defects. The A12L deficiency caused accumulated granules of electron-dense areas including viral DNA and protein-rich aggregates while crescent membranes were formed. Some immature virus particles (IV) were devoid of the internal materials or contained small IV contents surrounded by irregular-shaped membranes. This indicated that the absence of A12L might delay or interrupt recruitment of viral membrane to engulf and adhere to the viral materials, which eventually led to the abrogated formation of spherical membranes. A portion of the abnormal IV particles was able to mature into IMV, 74 however the core did not form the characteristic of the bi-concave core shape. Rather the cores of the IMV retained a round shape, which appeared to lose the center-compressed concave structure. Thus, we concluded that the lack of A12L led to not only the defects in the association of the viroplasm with crescentshaped membranes but also the formation of spherical IV membranes and subsequent disruption of interior cores of the IMV. Morphology defects by abrogated AG/A cleavage of A12L. The morphogenic defects of the mutant virus under the restrictive conditions could be overcome by the transient expression of plasmid borne A12L (Fig. 3.4). Consistent with the rescue experiment, plasmid born A12L was able to form regular IV particles, which had electron-dense viral materials inside and associated with the spherical membrane tightly. In addition, a condensed core was observed together with the development of the inner layer, which established the biconcave characteristics of IMV particles. The AG/A site mutant A12L, however, failed to produce fully matured IMV particles. The transient expression of AG/A site mutant A12L demonstrated similar phenotypic deformities as the absence of A12L, producing the irregular shaped IV-like particles with little viral material. Relatively more regular IV particles, however, were displayed while the core appeared to be condensed but failed to form a concaved layer inside of the IMV particles. Similarly, IMV particles retained round boundary membranes and abnormal inner layers. This can be explained by the fact that the impaired cleavage at an N-terminal AG/A site might lead to the correct assembly of IV contents and its close adhesion to the IV membrane but not to the proper core 75 condensation in concert with a concave inner core layer. 76 DISCUSSION The VV A12L protein, which has a highly conserved sequence alignment with other orthopoxviruses, plays an essential role in virus replication demonstrating more than 70% reduction in virus yield in the absence of A12L. Marker rescue experiments with vvtetOA12L infected cells not only confirmed the essentiality of A12L but also demonstrated that the mutation of AG/A site in the A12L protein eliminated its complementing functionality, strongly suggesting that the proteolytic processing of A12L is essential, possibly due to the impaired morphological transition of IV to IMV as indicated by electron microscope analysis. In addition, the failure of each of the A12L truncates to rescue the lack of A12L protein provides several clues regarding its proteolysis. First of all, A12L proteolysis does not simply produce one major cleavage product, rather it yields a stable mixtures of intermediate and final peptides, both of which have an essential role in virus replication. Second, the fact that A12L truncates such as 17K, 2K, and 3K were not able to rescue despite relatively more coverage of the A12L ORF indicates that the interruption of the first cleavage at an N-terminus or C-terminus may block subsequent proteolysis. In agreement with previous studies of A12L proteolytic processing, we have shown that the cleavage events of A12L take place in order in concert with conformational changes, which allow the very next cleavage event. Third, the virus yield obtained by the transfection of AG/A site mutated A12L (AG/A) displayed higher virus titers than 17K, suggesting that the N-terminal residues of the AG/A may have a critical role in A12L 77 maturation. This could explain the lower virus titer in the cells transfected with A2K and A3K. The AG/A site mutated A12L might inhibit further cleavage processing but may also lead to N- and C-terminal cleavages producing ~21 kDa peptides, which could explain the relatively higher rescue than 17K. The absence of A12L resulted in the phenotypic defects of arresting the development of IV particles prior to acquisition of the typical biconcave-core shape. It is of interest to report that these defects were observed throughout the virus life cycle from the early stage of IV formation to the very last stage to become fully matured IMV. The IV particles generated in the absence of A12L were filled with small electron-dense viral DNA or surrounded by irregular-shaped membranes, suggesting A12L participation in formation of spherical membranes and its tight association with IV contents. In addition, the A12L deficiency displayed aberrant core condensation together with more round shaped-inner layers of IMV. This phenotypic defect is similar to that of the A10L deficient virus infection, which suggested A10L-induced DNA uptake into spherical IV particles and formation of nucleoprotein complex within the IV (Heljzsvaara et al. 2001). The empty and partially electron-dense materials observed by A12L deficient virus infection provides supportive evidence of possible incorporation of A12L with A10L (23kDa cleavage product) previously reported, implying that the A12L protein together with the C-terminal cleavage product of A10L might be responsible for the correct organization of the IV contents. The absence of the association between A12L and A10L might allow only partial uptake of the dense viral materials into virus particles. In addition, the abrogated biconcave IMV 78 particle with inner layer was obtained by the lack of both proteins, extending a role of the A12L into the formation of a center-compressed core in IMV particles. It is worthwhile to note that the aggregated viral foci and IV-like particles were reported by A17L and A14L deficient viruses, which have a role in the recruitment of viral membrane adjacent to viroplasmic materials and the attachment of virus membranes with electron-dense viral materials (Wolffe et al. 1996, Rodriguez et al. 1998). In terms of the generation of viral membranes, A12L deficient virus introduced neither the absence of viral membrane nor unfinished or interrupted IV membranes, which were observed by the lack of A17L and A14L, respectively. On the basis of the possible association of A12L with A17L and A14L previously suggested, it can be speculated that A12L with these two proteins might not be responsible for the generation of the crescent membranes but instead for their correct positions and linkage to viroplasm. Thus, this electron microscopy analysis confirms that the A12L protein is required for virus replication and complete virion maturation. The similar phenotypic defect of each mutant virus of A12L and its potentially-associated proteins may highlight the participation of VV proteolysis in the correct assembly of nucleoprotein complex in IV particles, the capability to maintain the stable spherical shape of IV, proper condensation of the core and its layer into center-concaved IMV formation. Therefore, additional characterization of the vvtetOA12L mutant virus would be interesting in order to establish the more specific biological function of the A12L protein regarding its contribution during VV morphogenic transitions. 79 Table 3.1. Schematic diagram of a conditional mutant virus of A12L. 80 Table 3.1. Schematic diagram of a conditional mutant A12L virus. To investigate the essentiality of A12L in virus replication and its biological function, a conditional mutant A12L virus (vvtetOA12L) was constructed by taking advantage of the viral homologous recombination. The Tet operator (TetO) flanked with A12L and A13L was placed in the p7.5:NEO plasmid, which contains the Neomycin-resistance gene (NeoR) as a selective marker. The resulting p7.5:TetOA12L:NEO plasmid was subjected to another homologous recombination and screened for the vvtetOA12L mutant virus. The vvtetOA12L mutant virus can be regulated through the absence or presence of Tet. In the absence of Tet, the tetracycline repressor (TetR) expressed from T-REx 293 cells occupies the TetO blocking the transcription of A12L. The addition of Tet, however, binds to the tetracycline repressor (TetR) leaving the promoter of A12L available for transcription. 81 Figure 3.1. Tet-dependent replication of vvtetOA12L and one-step growth curve. 82 Figure 3.1. Tet-dependent replication of vvtetOA12L and one-step growth curve. . A. Tet-dependent replication of vvtetOA12L. T-REx 293 cells were infected with vvtetOA12L at a MOI of 1 PFU/cell in the presence of tetracycline (Tet) at various concentrations of 0, 10, 20, 30, and 40 µg/mL. The infected cell extracts harvested at 24 hpi were titered on BSC 40 cells to determine the virus yields. As the concentration of Tet increased, the virus yield increased showing that virus replication of vvtetOA12L is Tet-dependent. B. One-step growth curve. T-REx 293 cells were infected with vvtetOA12L in the presence and absence of Tet (30 µg/mL) and harvested at 3, 5, 8, 12, and 24 hpi. The reduction of virus titer was observed at the time when A12L protein expression was initiated and reached maximum levels at 24 hpi. Approximately one-log reduction of vvtetOA12L in non-permissive condition showed the requirement of A12L protein in VV replication. Each virus titer (PFU/ml) was scaled in log phase. 83 The construction of A12L truncates cleaved at all three AG/X sites Figure 3.2. Essentiality of A12L protein in VV replication. 84 Figure 3.2. Essentiality of A12L protein in VV replication. The upper panel is a diagram of the constructed A12L truncates. Under the assumption that all of three AG/X sites in A12L ORF are utilized, A12L truncates were constructed. 17K is the cleavage product at an N-terminal AG/A while 2K and 3K are the cleavage products at an internal (2) and Cterminal AG/K (3) sites, respectively. A2K and A3K are the peptides processed at an N-terminal AG/A, followed by an additional cleavage event at an internal and C-terminal AG/K residue. All of the A12L truncates were placed under the native promoter, which contains upstream 233 nts. Bottom panel shows the virus rescue experiment of vvtetOA12L with plasmid born A12L and A12L truncates. T-REx 293 cells were infected with vvtetOA12L in the presence/absence of Tet (Tet+/-) to determine the essentiality of the A12L protein in viral replication. The lack of A12L was complemented by the transient expression of plasmid born A12L under the control of an early/late synthetic promoter (pA12L) or the native promoter (233 nucleotide upstream of A12L ORF, p233-A12L). In addition, the A12L truncates generated by different combination of three AG/X sites failed to rescue the absence of A12L protein. pA12L: A12L ORF under the control of the early/late synthetic promoter; p233-A12L: plasmid born A12L under the native promoter; pRB21: vector plasmid alone; AG/A: plasmid born A12L with N-terminal AG/A site mutation into ID/I. A12L truncates were indicated above. Each virus titer (PFU/ml) was scaled in log phase. 85 86 Figure 3.3. Morphology defects in the absence of A12L expression. To investigate a role of A12L protein in virus assembly, T-REx 293 cells were infected by vvtetOA12L in the presence (left panels: a, c, e) and the absence of Tet (right panels: b, d, f). In the presence of Tet (a and c), spherical IV particles were demonstrated, which evolved into the biconcave IMV particles. An arrow shows a virus particle, which initiated developing the inner layer of the core. The inner layer of the core is localized along with the outer membrane (panel e). In the absence of Tet (panel b and d), mostly IV-like particles (IV*) were observed with accumulated electron-dense viral materials (V). IV-like particles contained little of viral dense materials in the membranes, which also formed not round but irregular-shape. Arrowheads in the panel b indicate IV particles with a gap between the viral materials and the surrounding membranes and c in the panel d indicates a crescent membrane. Some of IV particles were developed into IMV-like particles (IMV*), of which cores showed abrogated condensation along with abnormalshaped layer as indicated by arrows at the panel f. Bars indicate 0.5µm. 87 88 Figure 3.4. Morphology defects by abrogated AG/A cleavage of A12L. In order to examine VV morphology by rescuing the absence of A12L, we transfected plasmid born A12L under the control of an early/late synthetic promoter (pA12L) and infected with vvtetOA12L in the absence of Tet. The transient expression of A12L induced regular IV and IMV particles as observed in the panel a and b. However, the transfection of A12L plasmid, which contained AG/A mutation into ID/I (AG/A) displayed defective phenotypes the same as to the absence of A12L protein (panel c, d, and e). Panel c shows IV like particles, which are more filled up with densematerials, while panel d and e demonstrate the aberrant layers of the cores. IMV* represents defective IMV-like particles. Bars indicate 0.2 or 0.5µm. CHAPTER 4. PARTICIPATION OF A12L IN VACCINIA VIRUS ASSEMBLY SUBSEQUENT TO D13L INVOLVEMENT. 89 ABSTRACT The vaccinia virus (VV) A12L gene product, a 25kDa core protein has been shown to be associated with VV-encoded core proteins (A10L, L4R, and F17R) as well as membrane proteins (A17L, A4L, and A27L), suggesting the possible participation of A12L protein in the organization of immature virions and intracellular mature virions. In addition, the phenotypic defects in the absence of A12L protein implies that A12L might have a role in recruiting VV proteins to form the rigid connection between the core and the surrounding membrane. In order to investigate more details regarding to the biological function of A12L in virus assembly, we attempted to compare the protein synthesis and subcellular localization of A12L with D13L gene product, which is an internal scaffolding protein responsible for development of viral crescent membranes. By screening rifampicin-resistant viruses (RifR), we were able to obtain the D13L mutant viruses conferring rifampicin-resisant loci at both terminus and internal region of D13L open reading frame. The RifR viruses showed stable expression of D13L and A12L proteins in the presence of the drug, which were attributed to the release out of rifampicin-inhibited VV replication as well as morphogenic development. Thus, we concluded that the stable expression of D13L appears to be a prerequisite for not only the expression and proteolysis of A12L but also its participation in the viral morphogenic transition. 90 INTRODUCTION The assembly and replication of vaccinia virus (VV) has been shown to be reversibly blocked at a discrete step in the virus life cycle by treatment with the macrolide antibiotic rifampicin (Rif) (Moss et al. 1969b.). Rifampicin irreversibly binds to the β-subunit of the Escherichia coli RNA polymerase to inhibit bacterial transcription (Boothroyd et al. 1983.). Treatment of VV with rifampicin, however, leads to viral morphogenic defects including irregularshaped crescent membranes surrounding viroplasm, referred to as rifampicin bodies or membrane-limited domains (Szjaner et al. 2005). In addition, two more unique virus morphologies were observed: more electron-dense materials with aberrant shaped crystalloid structures containing viral DNA, and punctate cytoplasmic structures referred to as inclusion bodies (Sodeik et al. 1994). The study done by McNulty-Kowalczyk and Paoletti discovered that rifampicin interrupted the formation of a dense-spicule layer on nascent membrane structures and subsequently impaired the curvature and rigidity of IV particles (Dales et al. 1978, McNulty-Kowalczyk and Paoletti, 1993). Furthermore, biochemical analyses of rifampicin effects on VV replication and proteolysis demonstrated that rifampicin treatment resulted in the failure of viral DNA to package into mature virions and led to the abrogated proteolysis of the major core protein precursors (Moss et al. 1969a, Katz and Moss, 1970). In contrast, rifampicin treatment had little effect on the synthesis of RNA, DNA and proteins (Pennington, 1973, Ben-Ishai et al. 1969) The removal of the drug, however, led to recovery not only of arrested packaging of the viral genome and proteolytic processing but also to correct virus assembly. The re-initiation of viral assembly 91 occurred rapidly upon removal of rifampicin with the generation of convexshaped membranes around rifampicin bodies and the development of normal immature virus particles (IV) and infectious intracellular mature virus particles (IMV) (Grimley et al. 1970). In agreement with the normal protein synthesis in the presence of rifampicin, the fast reversibility suggested that de novo synthesis of macromolecules or protein was not required for the release of the rifampicininduced inhibition (Moss et al. 1969a, Moss et al. 1969b). The rifampicin target is the gene product of the D13L open reading frame (ORF), which is synthesized as a 65kDa late structural protein named L65 (Tartaglia and Paolett, 1985). Rifampicin-resistant viruses led to the identification of mutations in the D13L gene located either at the N-terminus or C-terminus (Baldick and Moss, 1987, Tartaglia and Paoletti, 1985, McNulty-Kowalczyk and Paoletti, 1993). In addition, D13L deficient virus demonstrated the same phenotypic defects as rifampicin-treated viruses, confirming that D13L is the target gene modulated by the antibiotic (Zhang and Moss, 1992). D13L is normally localized to the viroplasms and the crescent-shaped membranes, predominantly on the inner surface of the viral cisternae or the concave surface of the virions. In the presence of rifampicin, however, the distribution of D13L was not limited to viroplasm but to inclusion bodies, showing the inhibited translocation of D13L into the viral foci, which resulted in the subsequent repression of the production of infectious virus particles (Miner and Hruby, 1989, Sodeik et al. 1994). Another electron microscopic analysis of the D13L deficient virus or its distracted localization in the presence of the drug showed little or no 92 production of viral crescent membranes, which appeared to be derived from the membrane cisternae of the intermediate compartment (IC) (Sodeik et al. 1993, Zhang and Moss, 1992). On the basis of this observation, it was hypothesized that D13L may serve as an internal scaffolding protein to recruit the host IC into the crescent-shaped viral membranes at an early stage of IV morphogenesis (Sodeik et al. 1994). A12L, a 25kDa late gene product demonstrated that A12L might have associations with VV core proteins such as A10L (p4a), L4R (p25K), and F17R (11K) and viral membrane proteins, A17L (p21K), A14L (15K), A27L (14K), and A4L (39K). Taken together with the viral phenotypic defects of conditional lethal mutant virus of A12L in the absence of inducer, which displayed detached viroplasm from the membrane and irregular core formation, it is suggested that A12L might be involved in the generation of immature virus particles (IV) and correct core assembly by contributing to the proper protein architecture, which promotes the association between viral crescent membranes and viroplasm in IV particles and the core and outer membranes of IMV particles. Since both D13L and A12L may have a similar role as matrix proteins and participate in the early development of IV formation, it was of interest to define a more detailed function of each protein and determine the hierarchy between the two proteins. Despite rifampicin-regulated proteolytic processing of the A12L protein, the protein expression as well as subcellular localization of the A12L in the presence of rifampicin has not been determined. Thus, the comparison of each protein synthesis and distribution in the presence and absence of rifampicin would 93 provide clues not only to the function of each protein but also the mechanism of action of rifampicin on virus assembly. Here, we attempted to obtain rifampicin-resistant (RifR) viruses to characterize the subcellular localization of D13L and A12L and to determine their association with viral crescent membranes. Using WR-infected cells in the presence and absence of rifampicin, we compared rifampicin-induced protein expression of D13L and A12L and established that A12L participation in virus assembly may take place subsequent to the involvement of D13L. 94 MATERIALS AND METHODS Cell cultures. VV WR (Western Reserve strain) was grown on confluent monolayers of BSC-40 cells maintained in Eagle’s minimal essential medium (EMEM, Invitrogen) supplemented with 10% fetal calf serum (FCS, Invitrogen), 2 mM glutamine (Invitrogen), and 10 mM gentamicin sulfate (Invitrogen) at 37 °C in a 95% humidified atmosphere containing 5% CO2. For infection, BSC-40 cells were maintained in infection media (EMEM) supplemented with 5% FCS, 2 mM glutamine, and 10 mM gentamicin sulfate and infected with VV WR and rifampicin-resistant viruses (RifR) at an multiplicity of infection (MOI) of 1 plaque forming unit (PFU)/cell. Rifampicin-resistant (RifR) viruses. In order to obtain RifR viruses, confluent BSC-40 cells were infected with VV Western Reserve strain (VV WR) at an MOI of 1 PFU/cell in the presence of 100 µg/ml of rifampicin followed by two more series of infection with the previous cell extracts in a higher concentration of rifampicin (150 and 200 µg/ml). Rifampicin stock solution (1000x, Sigma-Aldrich) was stored in dimethyl sulfoxide at –20°C and diluted out with dH2O for various concentrations. After a total of three series of infections in the presence of the drug, the infected cell lysates were titered and screened for mutations through polymerase-chain reaction (PCR) with D13L specific primers. In order to screen the full sequences of D13L, primers were designed to have the nucleotides (nts) from the 3’ region of A1L to the internal region of D13L (837 nts) and from the internal region of D13L (812 nts) to the 5’ region of D12L: A1L forward, 5’TCTCTACGGAGTTTATTGTAA; D13L internal primer (IP-reverse), 5’- TGCATCT 95 ATATATCTTTTTC; D13L-IP forward, TTCGTATCCAGGGTACTCACAAG; D12Lreverse, 5’- ATGGATGAAATTGTAAAAAATATCCG. After screening, the resistant viruses were subjected to three rounds of plaque purification prior to the virus purification. Protein expression of D13L and A12L. Confluent BSC-40 cells were infected with VV WR and RifR viruses at an MOI of 1 PFU/cell and treated with rifampicin (100 µg/mL) at the time of infection. The infected cells were harvested at 24 hpi by centrifugation at 750x g for 10 min. and resuspended in the protease inhibitorcontaining PBS, followed by three cycles of freezing and thawing to lyse the cells. After a post-nuclear spin at 350x g at 4 °C, the same amount of each sample was resolved on a 12% NuPAGE Bis-Tris gel (Invitrogen) prior to immunoblot analysis with D13L and A12L antisera. D13L antisera (anti-D13L) were developed by over expression of L65 fusion protein with trpE and injection of the purified protein into New Zealand white rabbits. (Miner and Hruby, 1989). A12L antisera (anti-A12L) were generated by expression of the fusion protein, A12L with a 7x his tag at an N-terminus, followed by purification and injection into New Zealand white rabbit as described (Whitehead and Hruby, 1994a). 96 RESULTS Identification of new rifampicin-resistant loci in the D13L ORF. In an attempt to obtain rifampicin-resistant (RifR) viruses, we performed plaque purification in the presence of the drug and screened for D13L mutations. Surprisingly the mutations were mapped to not only the N- and C-terminus but also to an internal region of the D13L ORF. Figure 4.1 shows all of the mutant loci conferring rifampicin-resistance discovered from previously reported RifR viruses and from newly identified resistant viruses. Due to all the amino acid (aa) substitutions in D13L located to both termini of the D13L ORF, it was suggested that the D13L protein might form a head-tail structure, which can be modulated by rifampicin. Thus, it is of interest to report here that a single aa change in an internal ORF such as K into T at residue 159 and S into L at residue 227 provides the drug resistance. This could be explained by the possible participation of the internal amino acids in formation of either the head-tail interaction of D13L or in generation of another conformational structure, which prevents D13L from interacting with rifampicin. By taking advantage of these four different RifR viruses, we determined the sensitivity of each resistant virus to different concentrations of rifampicin and compare protein stability of D13L and A12L. In order to confirm that all of the RifR viruses are resistant to rifampicin, each virus including WR was infected in the presence of rifampicin in a range of concentrations at 0, 50, 100, 200, or 300 µg/mL (Fig. 4.2). WR infection showed more than three-log reduction of virus yield with addition of 50-300 µg/mL of the drug while the other resistant viruses showed approximately one-log reduction in 97 titer at 50 µg/mL and a 2.5 log reduction in titer at the higher concentrations. Compared to WR, all the RifR viruses demonstrated the most significant resistance to rifampicin at 50 µg/mL and at least one-log higher virus yield at 100300 µg/mL of rifampicin. Thus, we reported here that the internal mutations in D13L could provide the same resistance against rifampicin as the other resistant viruses with the mutations at an N- or C-terminus of D13L ORF. Protein expression of D13L and A12L in the presence of rifampicin. To determine whether the resistance to rifampicin observed in the RifR viruses is attributed to protein instability of D13L, we examined protein expression levels by immunoblot analysis (Fig. 4.3). Equal amounts of protein were loaded on a 12% NuPAGE Bis-Tris gel and subjected to immunoblot analysis with antibody of D13L (anti-D13L). D13L (L65) was stably expressed from WR in the absence of rifampicin, but relatively little of protein was expressed in the presence of the drug (Fig. 4.3, lane 6). Each of the resistant viruses, however, showed stable expression of D13L in the presence of rifampicin, regardless of the location of the mutant loci. Using the same cell extracts, the protein stability as well as the cleavage of the A12L protein was examined with antibody of A12L (anti-A12L). Like D13L, A12L was expressed and processed in all the RifR viruses in the presence of rifampicin (Fig. 4.3). As a control, WR in the presence of rifampicin showed little expression of A12L and consequently no proteolysis was observed. From this we concluded that rifampicin repressed the synthesis of D13L and A12L, which might result in rifampicin-induced defects of VV proteolysis. It is of interest to note that 98 considering the fact that rifampicin has not hampered VV protein synthesis, it may be speculated that rifampicin stimulated the degradation of each A12L and D13L protein. However, due to the high MOI of virus infection in the presence of rifampicin (100 µg/mL) previously used, it cannot be ruled out whether the drug by itself at a low MOI of 1 introduced the interrupted proper expression of late gene products. The fact that all the rifampicin-resistant viruses were capable of expressing both D13L and A12L protein even in the presence of the drug suggests that the proper D13L expression in the presence of rifampicin appears to be enough to either re-synthesize A12L gene product or inhibit the repression of A12L protein. 99 DISCUSSION The identification of the rifampicin-resistant viruses introduced a new map of the resistance loci. It has been previously reported that all the altered amino acids were located in either an N- or C-terminus of the D13L ORF as described Fig. 4.1. Distribution of the resistant loci at both ends established a model of a head-tail interaction of D13L, of which mutations would inhibit its association with rifampicin. However, the mutant loci we identified here are located in an internal region of D13L at amino acid residue 159 and 227. There are two possibilities that either both substitutions of internal amino acids cause a change in a tertiary structure, interrupting the head-tail conformation or the internal amino acids are located in an active pocket that the drug binds to. In addition, it is of interest to report that rifampicin-treated cell did not express D13L (Fig 4.3), which is opposite to reports from the previous studies. Rifampicin did not hamper the synthesis of RNA, DNA and proteins, which was not observed here. The presence of the drug inhibited expression of D13L and A12L while all the resistant viruses displayed the both proteins and A12L cleavage products, suggesting that the rifampicin-induced phenotypic defects and halted proteolysis might result from the lack of D13L protein. This inconsistent data might be caused by different experimental procedures such as MOI and timing of placement of rifampicin. Consistently, the subcellular localization of A12L determined by immunofluorescent microscopy (data not shown) demonstrated the consistent localization of A12L observed by rifampicin-resistant viruses compared to WR- 100 induced normal distribution, implying that rifampicin, by itself cannot alter A12L protein expression and localization unless the D13L protein is depleted or its localization is disrupted. Therefore, it is hypothesized that D13L might have a role in recruiting and localizing A12L protein to viral factories and stimulating proper proteolytic maturation and localization either in a direct or indirect manner. 101 102 Figure 4.1. Rifampicin-resistant loci in D13L ORF. Black lines represent the resistant viruses we obtained while the dotted lines represent the previously reported D13L loci conferring rifampicin-resistance. † RifR 3: Q to K amino acid change at residue 27, RifR 4: K to T amino acid † change at residue 159, RifR 5: S to L amino acid change at residue 227, RifR † 9: K to N amino acid change at residue 484. : Newly identified D13L mutant loci located in the internal region of D13L ORF. The rifampicinresistant loci had been limited to either an N-terminus or a C-terminus of D13L, while the newly reported mutant loci are located in the internal region (RifR4 and RifR5). 103 Figure 4.2. Sensitivity of RifR viruses to different concentrations of rifampicin. 104 Figure 4.2. Sensitivity of RifR mutant viruses to different concentrations of rifampicin. To determine the sensitivity of all of the rifampicin-resistant viruses (RifR), BSC-40 cells were infected at an MOI of 1 PFU/cell in the presence of various concentrations of rifampicin (Rif): 0, 50, 100, 200, and 300 µg/mL. The infected cells were harvested at 24 hpi and titered. Each RifR virus contains a different amino acid change as mentioned in Fig.41, but showed the similar sensitivity to rifampicin. Wild-type VV WR, however, could not replicate in the presence of rifampicin, compared to RifR viruses. 105 Figure 4.3. Protein stability of D13L and A12L in the presence of Rif. To examine the protein stability of D13L (L65) and its effect on the A12L proteolysis, BSC-40 cells were infected with WR and the RifR viruses in the presence of rifampicin (100 µg/mL). The same amount of each cell lysate was analyzed by the immunoblot analyses with anti-D13L (upper panel) and anti-A12L (bottom panel). WR (lane 1) is the VV WR-infected cells in the absence of rifampicin, while Q27K (lane 2), K159T (lane 3), S227L (lane 4), K484N (lane 5), and WR (lane 6) are each RifR virus and WR-infected cells in the presence of rifampicin. CHAPTER 5. CONCLUSIONS. 106 As an attempt to elucidate more details of the regulation and requirement of vaccinia virus (VV) proteolytic processing, we chose to study the A12L late gene product. The 25kDa full-length protein A12L protein is proteolytically processed into six multiple peptides with molecular weights of 21, 18, 17, 15, 13, and 11kDa. Proteolysis of A12L appears to be halted once a stable mixture of these peptides is obtained. Cleavage events are initiated with the processing at an N-terminus AG/A site as well as at unknown locations in proximity to the Nterminus, producing 17kDa and 21kDa peptides. This is followed by a C-terminal processing event. Since cleavage has only been demonstrated at the AG/A site among the three AG/K motifs in the ORF, the two AG/K motifs in A12L ORF may not participate in the initial cleavage reaction but rather in subsequent processing. In addition, we report here that the VV I7L cysteine proteinase is responsible for cleaving A12L at an AG/A site. Considering the incomplete cleavage observed at each of the AG/X sites and the appearance of multiple products, we speculate that A12L proteolysis is a redundant processing event, which appears to form a specific tertiary structure by the first cleavage for further processing and might be catalyzed by not only the I7L cysteine proteinase but also another VV-encoded proteinase. Although we were not able to identify all of the exact cleavage sites of A12L, we demonstrated that A12L might associate with VV core (A10L, A4L, L4R, F17R) and membrane (A17L, A14L, A27L) proteins, playing a role as a matrix protein. These possible associations of A12L with a variety of VV proteins led to the hypothesis that A12L may participate in connecting viral cores and 107 membranes tightly to form rigid virion particles not limited to the formation of immature virus particles (IV) but also involved in formation of intracellular mature virus (IMV) and IEV particles. The construction of a conditional lethal mutant virus of A12L (vvtetOA12L) showed that A12L protein and its cleavage processing are essential for VV replication. The failed rescue experiment with AG/A site mutant A12L and A12L truncates demonstrated that the removal of an N-terminal AG/A site is required for viral replication and subsequent cleavage reactions. Processing at the AG/A site is likely required for the development of the correct tertiary structure. Disrupted cleavage abrogates the ability to complement the deficiency of A12L. In terms of VV morphology, the absence of A12L resulted in the accumulation of electron-dense materials and irregular shaped membranes of immature virions (IV), which displayed a gap generated by incomplete association between the viroplasm and membranes. Some of virus particles were able to form typical IV with spherical membranes and correctly filled viral materials. However, no typical IMV particles were observed, supporting the theory that A12L participates in assembling correct IV content with surrounding membranes and core condensation into biconcave-shape rather than the generation of IV membranes. The similar morphogenic defects observed by the expression of AG/A mutated A12L directly show the requirement of A12L proteolysis during VV morphological transitions. Due to the multiple associations of A12L with other virus-encoded proteins 108 involved in the early development of virus membranes, we raised the question of whether A12L has any interaction with D13L, a scaffold protein, which participates in the formation of crescent-shaped viral membranes. Since D13L localization and its resistance against rifampicin have been well studied, we screened all rifampicin-resistant viruses with D13L mutant loci, which were used as positive controls in the presence of drug. The effects of rifampicin on A12L expression suggested that despite the presence of rifampicin, proper D13L expression by the resistant loci resulted in proper expression and subsequent proteolysis of A12L protein. Therefore, we concluded that the generation of the crescent membranes by D13L would occur prior to the participation of A12L in IV assembly. In summary, the study of A12L proteolysis and its biological function provided a more comprehensive understanding of regulation and participation of VV proteolysis. VV proteolysis of A12L may not be designed to produce one or two major cleavage products as observed with the other proteolytic maturation of A10L, A3L, L4R, A17L, and G7L. Rather, multiple stable cleavage products can be obtained by sequential cleavage processing, which appears to be required for specific conformational structures. Once a desirable set of products is obtained, the proteolysis is halted. Besides, A12L-induced defects in virus assembly demonstrate that proteolytic maturation of viral structural proteins as an essential post-translational modification, assembles the correct nucleoprotein complex with spherical-shaped membranes and compresses an inner layer of core into the characteristics of biconcave-shaped IMV particles. Further research of each 109 biological function of all the A12L-derived cleavage products as well as the participation of A12L associated with each protein will eventually discover more details of VV morphogenesis developed by VV proteolysis. 110 CHAPTER 6. BIBLIOGRAPHY Ansarah-Sobrinho, C. and B. Moss. 2004. Role of the I7L protein in proteolytic processing of vaccinia virus membrane and core components. J. Virol. 78: 63356343. Baldick, C. J. and B. Moss. 1987. Resistance of vaccinia to rifampicin conferred by a single nucleotide substitution near the predicted NH2 terminus of a gene encoding a Mr 62,000 polypeptide. Virology. 156: 138-145. Becker, A. B. and R. A. Roth. 1992. An unusual active site identified in a family of zinc metalloendopeptidases. Proc. Natl. Acad. Sci. USA. 89: 3835-3839. Ben-Ishai, Z., E. Heller, N. Goldblum and Y. Becker. 1969. Rifampicin poxvirus and trachoma agent. Nature. 224: 29-32. Blasco, R. and B. Moss. 1995. Selection of recombinant vaccinia viruses on the basis of plaque formation. Gene. 158: 157–162. Boothroyd, C. M., R. M. Malet, V. Nene and R. E. Glass. 1983. Genetic studies on the β subunit of Escherichia coli RNA polymerase. III. Analysis of low-level rifampicin-resistant mutants. Mol. Gen. Genet. 190: 523-526. Broyles, S. S. 2003. Vaccinia virus transcription. J. Gen. Virol. 84: 2293-2303. Byrd, C. M., T. C. Bolken and D. E. Hruby. 2002. The vaccinia virus I7L gene product is the core protein proteinase. J. Virol. 76: 8973-8936. Byrd, C. M., T. C. Bolken and D. E. Hruby. 2003. Molecular dissection of the vaccinia virus I7L core protein proteinase. J. Virol. 77: 11279-11283. Byrd, C. M. and D. E. Hruby. 2005. A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis. Virol J. 2:4 111 Byrd, C. M. and D. E. Hruby. 2006. Vaccinia virus proteolysis-a review. Rev. Med. Virol. 16: 187-202. Carter, G. C., G. Rodger, B. J. Murphy, M. Law, O. Karuss, M. Hollinshead, G. L. Smith. 2003. Vaccinia virus cores are transported on microtubules. J. Gen. Virol. 84: 636-638. Cassetti, M. C., M. Merchlinsky, E. J. Wolffe, A. S. Weisberg, and B. Moss. 1998. DNA packaging mutant: repression of the vaccinia virus A32 gene results in noninfectious DNA-deficient spherical, enveloped particles. J. Virol. 72: 57695780. Chang, A. and D. H.Metx. 1976. Further investigations on the mode of entry of vaccinia virus into cells. J. Gen. Virol. 32: 275-282. Chang, W., J. G. Lim, I. Hellstrom, L. E. Gentry. 1988. Characterization of vaccinia virus growth factor biosynthetic pathway with an antipeptide antiserum. J. Virol. 62: 1080-1083. Choi, H. K., L. Tong, W. Minor, P. Dumas, U. Boege, M. G. Rossmann and G. Wengler. 1991. Structure of Sindbis virus core protein reveals a chymotrypsinlike serine proteinase and the organization of the virion. Nature. 354: 37-43. Craven, R. C. 1996. Dynamic interactions of the Gag polyprotein. Curr. Top. Microbiol. Immunol. 214:65-94. Dales, S. and E. H. Mosbach. 1968. Vaccinia as a model for membrane biogenesis. Virology. 35: 564-583. DeLange, A. M. 1989. Identification of temperature sensitive mutants of vaccinia virus that are defective in conversion of concatemeric replicative intermdediates to the mature linear DNA genome. J. Virol. 63: 2437-2444. Dougherty, W. G. and B. L. Semler. 1993. Expression of virus-encoded proteinases: functional and structural similarities with cellular enzymes. Microbiol. Rev. 57: 781-822. 112 Dougherty, W. G. and T. D. Parks. 1991. Post-translational processing of the tobacco etch virus 49-kDa small nuclear inclusion polyprotein: identification of an internal cleavage site and delimitation of VPg and proteinase domains. Virology. 183: 302-310. Flynn, D. L., D. P. Becker, V. M. Dilworth, M. K. Highkin, P. J. Hippenmeyer, K. A. Houseman, L. M. Levine, M. Li, A. E. Moormann, A. Rankin, M. V. Toth, C. I. Villamil, A. J. Wittwer and B. C. Holwerda. 1997. The herpesvirus protease: mechanistic studies and discovery of inhibitors of the human cytomegalovirus protease. Drug Des Discov. 15:3-15. Franke, C. A., C. M. Rice, J. H. Strauss, and D. E. Hruby. 1985. Neomycin resistance as a dominant selectable marker for selection and isolation of vaccinia virus recombinants. Mol. Cell. Biol. 5:1918-1924. Freimuth, P. and C. W. Anderson. 1993. Human adenovirus serotype 12 virion precursors pMu and pVI are cleaved at amino-terminal and Carboxy-terminal sites that conform to the adenovirus 2 endoproteinase cleavage consensus sequence. Virology. 193: 348-355. Grimley, P. M., E. N. Rosenblum, S. J. Mims and B. Moss. 1970. Interruption by rifampicin of an early stage in vaccinia virus morphogensis: accumulation of membranes which are precursors of virus envelope. J. Virol. 6: 519-533. Grosenbach, D. W., S. G. Hansen and D. E. Hruby. 2000. Identification and analysis of vaccinia virus palmitylproteins. Virology. 275: 193-206. Hedengren-Olcott, M., C. M. Byrd, J. Waston and D. E. Hruby. 2004. The vaccinia virus G1L putative metalloproteinase is essential for viral replication In vivo. J. Virol. 78: 9947-9953. Hedengren-Olcott, M., and D. E. Hruby. 2004. Conditional expression of vaccinia virus genes in mammalian cell lines expressing the tetracycline repressor. J Virol Methods. 1:120(1): 9-12. 113 Heljasvaara, R., D. Rodriguez, C. Risco, J. L. Carrascosa, M. Esteban, and J. R. Rodriguez. 2001. The major core protein p4a (A10L gene) of vaccinia virus is essential for correct assembly of viral DNA into the nucleoprotein complex to form immature viral particles. J. Virol. 75: 5778-5795. Hellen, C. U. T. and E. Wimmer. 1992. Maturation of poliovirus capsid proteins. Virology. 187: 391-397. Hershko, A. and M. Fry. 1975. Post-translational cleavage of polypeptides chains: Role in assembly. Ann. Rev. Biochem. 44: 775-797. Hollinshead, M., G. Rodger, H. van Eijl, R. Hollinshead, M. Law, D. T. Vaux and G. L. Smith. 2001. Vaccinia virus utilizes microtubules for movement to the cell surface. J. Cell. Biol. 154: 389-402. Honeychurch, K. M., C. M. Byrd, and D. E. Hruby. 2006. Mutational analysis of the potential catalytic residues of the VV G1L metalloproteinase. Virol J. 3:7. Horl, W. H. and A. H. Heidland. 1982. Protease: potential role in health and disease. Adv. Exp. Med. Biol. 167: 1-591. Husain, M., and B. Moss. 2003. Evidence against an essential role of COP II mediated cargo transport to the endoplasmic reticulum-Golgi intermediate compartment in the formation of the primary membrane of vaccinia virus. J. Virol. 77: 11754-11766. Ichihashi, Y. 1996. Extracellular enveloped vaccinia virus escapes neutralization. Virology. 308: 233-242 Jennifer Y. D., T. S. Chen, C. R. Gagnier, S. Vemulapalli, C. S. Maier, and D. E. Hruby. 2006. Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins. Virol J. 3:10 Katz, E. and B. Moss. 1970. Formation of a vaccinia structural polypeptide from a higher molecular weight precursor:Inhibition by rifampicin. Proc. Natl. Sci. USA. 66:677-684. 114 Kay, J. and B. M. Dunn. 1990. Viral proteinase: weakness in strength. Biochim. Biophys. Acta. 1048: 1-18. Kozak, M. 1983. Microbiol. Rev. 47: 1-45. Krauss, O., R. Hollinshead, M. Hollinshead and G. L. Smith. 2002. An investigation of incorporation of cellular antigens into vaccinia virus particles. J. Gen. Vriol. 83: 2347-2359. Krijnse-Locker, J., J. Kuehn, S. Schleich, G. Rutter, H. Hohenberg, R. Wepf, G. Griffiths. 2000. Entry of the two infectious forms of vaccinia virus at the plasma membrane is signaling-dependent for the IMV but not the EEV. Mol. Biol. Cell. 11: 2497-2511. Krinjse-Locker, J., S. Schleich, D. Rodriguez, B. Bould, E. J. Snijder, and G. Griffiths. 1996. The role of a 21kDa viral membrane protein in the assemblyof vaccinia virus from the intermedicate compartment. J. Biol. Chem. 271: 1495014958. Law, M., R. Hollinshead, G. L. Smith. 2002. Antibody-sensitive and antibodyresistant cell-to-cell spread by vaccinia virus: role of the A33R protein in antibodyresistant spread. J. Gen. Virol. 83: 209-222. Lee, P and D. E. Hruby. 1994. Proteolytic cleavage of vaccinia virion proteins: mutational analysis of the specificity determinants. J. Biol. Chem. 269: 8616-8622. Lee, P. and D. E. Hruby. 1995. Analysis of the role of the amino-terminal peptide of vaccinia virus structural protein precursors during proteolytic processing. Virology. 207: 229-233. Lee, W-M., S. S. Monrow and R. R. Rueckert. 1993. Role of maturation cleavage in infectivity of picornaviruses: Activation of an infectosome. J. Virol. 67: 2110-2122. Lopez-Otin, C., C. Simon-Mateo, L. Martinez and E. Vinuela. 1989. Gly-Gly-X, a novel consensus sequence for the proteolytic processing of viral and cellular 115 proteins. J. Biol. Chem. 264: 9107-9110. Mallardo, M., S. Schleich and J. Krijnse Locker. 2001. Microtubuledepdendent organization of vaccinia virus core-derived early mRNAs into distinct cytoplasmic structures. Mol. Biol. Cell. 12: 3875-3891. Mark, R., L. Buller and G. J. Palumbo. 1991. Poxvirus pathogenesis. Micro review. 55: 80-122. McNulty-Kowalczyk, J. and E. Paoletti. 1993. Mutations in ORF D13L and other genetic loci alter the rifampicin phenotype of vaccinia virus. Virology. 194: 638-646. Mercer, J. and P. Traktman. 2005. Genetic and cell biological characterization of the vaccinia virus A30 and G7 phosphoproteins. J. Virol. 79: 7146-7161. Merchlinsky, M., and B. Moss. 1989. Resolution of vaccinia virus DNA concatemer junctions requires late-gene expression. J. Virol. 63: 1595-1603. Miner, J. N. and D. E. Hruby. 1989. Rifampicin prevents virosom localization of L65, an essential vaccinia virus polypeptide. Virology. 170: 227-237. Moerdyk, M. J., C. M. Byrd, and D. E. Hruby. 2006. Analysis of vaccinia virus temperature-sensitive I7L mutants reveals two potential functional domains. Virol J. 3:64 Morgan, C. 1976. Vaccinia virus reexamined: development and release. Virology. 73: 43-58. Moss, B. and E. N. Rosenblum. 1973. Protein cleavage and poxvirus morphogenesis: tryptic peptide analysis of core precursors accumulated by blocking assembly with rifampicin. J. Mol. Biol. 81: 267-269. Moss, B., E. Katz and E. N. Rosenblum. 1969a. Vaccinia virus directed RNA and protein synthesis in the presence of rifampicin. Biochem. Biophys. Res. Commun. 36: 858-865. 116 Moss, B., E. N. Rosenblum and E. Katz. 1969b. Rifampicin: a apecific inhibitor of vaccinia virus assembly. Nature. 224: 1280-1284. Navia, M. A. and B. M. McKeever. 1990. A role for the aspartyl protease from HIV-1 in orchestration of virus assembly. Ann. N. Y. Acad. Sci. 616:73-85. Neurath, H. 1989. Proteolytic processing and physiological regulation. Trends in Biol. Sci. 14: 268-271. Pallansch, M. A., O. M. Kew, B. L. Semler, D. R. Omilianowski, C. W. Anderson. E. Wimmer and R. R. Rueckert. 1984. Protein processing map of poliovirus. J. Virol. 49: 873-880. Patel, D. D., D. J. Pickup and W. K. Joklik. 1986. Isolation of cowpox virus Atype inclusions and characterization of their major protein component. Virology. 149: 174-189. Pennington, T. H. 1973. Vaccinia virus morphogenesis: A comparison of virusinduced antigens and polypeptides. J. Gen. Virol. 19: 65-79. Pettit, S. C., J. Simsic, D. D. Loeb, L. Everitt, C. A. Hutchison, 3d, and R. Swanstrom. 1991. Analysis of retroviral protease cleavage sites reveals two types of cleavage sites and the structural requirements of the P1 amino acid. J. Biol. Chem. 266: 14539-14547. Reich, E., D. B. Rifkin and E. Shaw (eds). 1975. Protease and Biological Control. Cold Spring Harbor Laboratory Press: New York, 1975. Rietdorf, J., A. Ploubidou, I. Reckmann, A. Holmstrom, F. Frischkneht, M. Zettl, T. Zimmermann, and M. Way. 2001. Kinesin-dependent movement on microtubules precedes actin-based motility of vaccinia virus. Nat. Cell. Biol. 3: 992-1000. Risco, C., J. R. Rodriguez, W. Demkowicz, R. Heljasvaara, J. L. Carrascosa, M. Esteban, and D. Rodriguez. 1999. The vaccinia virus 39-kDa protein forms a stable complex with the p4a/4a major core protein early in morphogenesis. 117 Virology. 265: 375-386. Rodriguez, D., C. Risco, J. R. Rodriguez, J. L. Carrascosa and M. Esteban. 1996. Inducible expression of the vaccinia virus A17L gene provides a synchronized system to monitor sorting of viral proteins during morphogenesis. J. Virol. 70: 7641-7653. Rodriguez, D., J. R. Rodriguez and M. Esteban. 1993. The vaccinia virus 14kilodalton fusion protein forms a stable complex with the processed protein encoded by the vaccinia virus A17L gene. J. Virol. 67: 3435-3440. Rodriguez, J. R., C. Risco, J. L. Carrascosa, M. Esteban, and D. Rodriguez. 1997. Characterization of early stages in vaccinia virus membrane biogenesis:implications of the 21-kilodalton protein and a newly identified 15kilodalton envelope protein. J. Virol. 71:1821-1833. Rodriguez, J. R., C. Risco, J. L. Carrascosa, M. Esteban, and D. Rodriguez. 1998. Vaccinia virus 15-kilodalton (A14L) protein is essential for assembly and attachment of viral crescent to virosomes. J. Virol. 72: 1287-1296. Rubio, D., A. Alejo, I. Rodriguez and M. L. Salas. 2003. Polyprotein processing protease of African swine fever virus: purification and biochemical characterization. J. Viol. 77: 4444-4448. Sanderson, C. M., M. Hollinshead and G. L. Smith. 2000. The vaccinia virus A27L protein is needed for the microtubule-dependent transport of intracellular mature virus particles. J. Gen. Virol. 81: 47-58. Schemilz, M., B. Sodeik, M. Ericsson, E. J. Wolffe, H. Shida, G. Hiller, and G. Griffiths. 1994. Assembly of vaccinia virus: the second wrapping cisternae is derived from the trnas Golgi network. J. Virol. 68:130-147. Schlesinger, S and M. J. Schlesinger. 1990. Replication of togaviridae and flaviviridae. In Virology, 2nd edn, Vol. 1, Fields B.N., D. M. Knipe, R. M. Chnock, M. S. Hirsch, J. L Melnick, T. P. Monath, B. Roizman (eds). 697-710. 118 Shida, H. and S. Matsumoto. 1983. Analysis of the hemagglutinin glycoprotein from mutants of vaccinia virus that accumulates on the nuclear envelope. Cell. 33: 423-434. Sodeik, B., G. Griffithes, M. Ericsson, B. Moss and R. W. Doms. 1994. Assembly of vaccinia virus: effects of rifampicin on the intracellular distribution of viral protein p65. J. Virol. 68: 1103-1114. Sodeik, B., R. W. Doms, M. Ericsson, G. Hiller, D. E. Machamer, W. van’t Hof, G. van Meer, B. Moss and G. Griffiths. 1993. Assembly of vaccinia virus: role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks. J. Cell. Biol. 121:521-541 Stewart, L., G. Schatz and V. M. Vogt. 1990. Properties of avian retrovirus particles defective in viral protease. J. Virol. 64: 5076-5092. Stroobant, P., A. P. Rice, W. J. Gullick, D. J. Cheng, I. M. Kerr, M. D. Waterfield. 1985. Purification and characterization of vaccinia virus growth factor. Cell. 42: 383-393. Szajner, P., H. Jaffe, A. S. Weisberg, and B. Moss. 2003. Vaccinia virus G7L protein interacts with the A30L protein and is required for association of viral membranes with dense viroplasm to form immature virions. J. Virol. 77: 34183429. Szajner, P., H. Jaffe, A. S. Weisberg, and B. Moss. 2004. A complex of seven vaccinia virus proteins conserved in all chordopoxviruses is required for the association of membranes and viroplasm to form immature virions. Virology. 330:447-459. Tartaglia, J. and E. Paoletti. 1985. Physical mapping and DNA sequence analysis of the rifampicin resistance locus in vaccinia virus. Virology. 147: 394404. Tozer, J. and S. Oroszlan. 2003. Proteolytic events of HIV-1 replication as targets for therapeutic intervention. Curr. Pharm. Des. 22:1803-1815. 119 Traktman, P., K. Liu, J. DeMasi, R. Rollins, S. Jesty, and B. Unger. 2000. Elucidating the essential forl of the A14L phosphoprotein in vaccinia virus morphogenesis: construction and characterization of a tetracycline-inducible recombinant. J. Virol. 74: 3682-3695. Van Eijl, H., M, Hollinshead and G. L. Smith. 2000. The vaccinia virus A36R protein is a type Ib membrane protein present on intracellular but not extracellular enveloped particles. Virology. 271: 26-36. VanSlyke, J. K., C. A. Franke and D. E. Hruby. 1991a. Proteolytic maturation of vaccinia virus core proteins: identification of a conserved motif at the N-termini of the 4b and 25K virion proteins. J. Gen. Virol. 72: 411-416. VanSlyke, J. K., S. S. Whitehead, E. M. Willson and D. E. Hruby. 1991b. The multiple proteolytic maturation pathway utilized by vaccinia virus p4a protein: A degenerative conserved cleavage motif within core proteins. Virology. 183: 467478. Ward, B., and B. Moss. 2001. Vaccinia virusintracellular movement is associated with microtubules and independent of actin tails. J. Virol. 75: 1165111663. Webster, A., I. R. Leith and R. T. Hay. 1994. Activiation of adenovirus-coded protease and processing of preterminal protein. J. Virol. 68: 7292-7300. Whitehead, S. S. and D. E. Hruby. 1994a. Differential utilization of a conserved motif for the proteolytic maturation of vaccinia virus core proteins. Virology. 200: 154-161. Whitehead, S. S. and D. E. Hruby. 1994b. A transcriptionally-controlled transprocessing assay: identification of a putative vaccinia virus-encoded proteinase which cleaves precursor protein P25K. J. Virol. 68: 7603-7608. Whitehead, S. S., N. A. Bersani, and D. E. Hruby. 1995. Physical and molecular genetic analysis of the multistep proteolytic maturation pathway utilized by vaccinia virus p4a protein. J. Gen. Virol. 76:717-721. 120 Wilcock, D., and G. L. Smith. 1994. Vaccinia virus core protein VP8 is required for virus infectivity, but not for core protein processing or for INV and EEV formation. Virol. 202: 294-304. Wilcock, D., and G. L. Smith. 1996. Vaccinia virions lacking core protein VP8are deficient in early transcription. J. Virol. 70: 934-943. Williams, O., Wolffe, E. J., Weisberg, A. S., and Merchlinsky, M. 1999. Vaccinia virus WR gene A5L is required for morphogenesis of mature virions. J. Virol. 73: 4590-4599. Wolffe, E. J., D. M. Moore, P. J. Peters and B. Moss. 1996. Vaccinia virus A17L open reading frame encodes an essential component of nascent viral membranes that is required to initiate morphogenesis. J. Virol. 70: 2797-2808. Yao, F., T. Svensjo, T. Winkler, M. Lu, C. Eriksson and E. Eriksson. 1998. Tetracyclin repressor, tetR, rather than the tetR-mammalian cell transcription factor fusion derivatives, regulates inducible gene expression in mammalian cells. Human Gene Therapy 9: 1939-1950. Zhang, Y. and B. Moss. 1991. Vaccinia virus morphogenesis is interrupted when expression of the gene encoding an 11-kilodalton phosphorylated protein is prevented by the Escherichia coli lac repressor. J. Virol. 65: 6101-6110. Zhang, Y., and B. Moss. 1992. Immature viral envelope formation is interrupted at the same stage by lac operator-mediated repression of the vaccinia virus D13L gene and by the drug rifampicin. Virology. 187: 643-653. Zhang, Y., B. Y. Ahn, and B. Moss. 1994. Targeting of a multicomponent transcription apparatus into assembling viaccinia virus particles requires RAP94, an RNA polymerase-associated protein. J. Virol. 68: 1360-1370.