AN ABSTRACT OF THE THESIS OF
Oi Wang for the degree of Master of Science in Toxicology presented on March
iQ 2005.
Title: Hypermutagenic Induction of Mitotic Recombination by Ionizing Radiation
in Mihi Null Mouse Cells
Abstract approved:
Redacted for privacy
Mitchell S. Turker
Mitotic recombination is a common autosomal mutation in mammalian cells
involving crossover events between homologous chromosomes. This process can
convert a cell with a heterozygous deficiency to one with a homozygous
deficiency, and thus often represents the second step in tumor suppressor gene
inactivation. In this study I examined the frequency and spectrum of ionizing
radiation (IR)-induced autosomal mutations affecting Aprt activity in a mouse
kidney cell line null for the Mihi mismatch repair (MMR) gene. The mutant
frequency results demonstrated a hypermutable response to JR and the spectral
analysis revealed that most of this response was due to the induction of mitotic
recombinational events. High frequency induction of mitotic recombination was
not observed in a DNA repair-proficient cell line or a cell line with an MMRindependent mutator type. I also provide evidence that JR exposure did not induce
significant numbers of base-substitution in the Mihi null cells. These results
demonstrate that IR exposure can initiate a process leading to mitotic
recombinational events and that MMR function suppresses these events. My
results suggest a caveat for use of IR to treat MMR deficient tumors because the
combination of high levels of induced mitotic recombinational events and preexisting intragenic mutations might increase malignant potential in surviving
cells.
Hypermutagenic Induction of Mitotic Recombination by Ionizing Radiation in
MI/il Null Mouse Cells
by
Qi Wang
A THESIS
submitted to
Oregon State University
in partial fulfillment of
the requirements for the
degree of
Master of Science
Presented March 10, 2005
Commencement June 2005
Master of Science thesis of Qi Wang
Presented on March 10. 2005
APPROVED:
Redacted for privacy
Major Professor, representing Toxicology
Redacted for privacy
Head of the Department of Environmen1 and
olecu1ar Toxicology
Redacted for privacy
Dean olthe Gra)LJchoo1
I understand that my thesis will become part of the permanent collection of
Oregon State University libraries. My signature below authorizes release of my
thesis to any reader upon request.
Redacted for privacy
Qi Wang, Author
ACKNOWLEDGMENTS
The author expresses sincere appreciation for the enthusiastic supervision of
Prof. Mitchell Turker during this work. Without him, this thesis would not have
been possible. I thank him for his patience and encouragement that carried me on
through difficult times, and for his insights and suggestions that helped to shape
my research and life career goals. His valuable feedback contributed greatly to
this thesis.
I thank Prof. Andrew Buermeyer for his help and support during my initial
stages of my study when I first came US. I am thankful to my committee
members: Prof John Hays, Prof. Andrew Buermeyer, Prof. David Williams and
Prof. Jeffrey Stone for their wise counsel and support.
I would like to acknowledge the help of Dr. Phillip Yates for his support. Olga
Ponomareva and Michaele Lasarev are greatly thanked for sharing ionizing
radiation mutagenesis data of MMR proficient cells with me. I thank Lanelle
Connolly, Amy Skinner, Renee Lewis, Sarah Godsey, Jon Oyer, Elizabeth
Kasameyer and all the other former Turker lab members for their assistance with
all types of technical problems at all times.
I thank all the staff in Department of Environmental and Molecular Toxicology,
and Center for Research on Occupational and Environmental Toxicology at
Oregon Science and Health Unviersity. Without them, my study would not be that
smooth and tolerable.
Finally I would like to express my deep gratitude for the constant support,
understanding and love that I received from my parents, my sister and my
husband during the past years.
I am supported by a training core from NIEHS 1P42 ES 10338.
TABLE OF CONTENTS
Page
Introduction
.................................................
Materials and Methods .....................................
Cell lines ..................................................
1
12
12
IR Cell survival assay ....................................12
Determination of mutant frequency
and mutant isolation ....................................
13
Isolation of genomic DNA ...........................
14
Distinguishing between large and
small Aprt mutations in mutant cells
15
LOH analysis for large
mutational event ...........................................
16
DNA sequencing for
small mutational event ................................... 22
Statistical analysis .......................................
23
Results .........................................................
24
Effect of Mihi status on cell
survival to ionizing radiation
.........................
24
Mutagenic effect from IR
on Mihi null cells .......................................
25
TABLE OF CONTENTS (CONTINUED)
Page
The hypermutagenic response in the
Mihi null cells is due to the induction
of mitotic recombinational event........................
30
Discussion ......................................................
38
Conclusion ......................................................
44
Bibliography .....................................................
45
LIST OF FIGURES
Figure
Pg
1. Large and small mutational events can be
determined by amplifying Aprt gene ........................
16
2. Large mutational event can be characterized
by LOH patterns of microsatellite markers
along chromosome 8 ...........................................
18
3. Retention of heterozyogsity or loss of
heterozygosity for microsatellite markers 56
and 190 shown in LOH analysis ..............................
21
4. Primers used to amplify and sequence
mouse Aprt gene ................................................
22
5. Cell survival to ionizing radiation .............................
25
6. Mutant frequencies for JR-exposed and
unexposed subclones for three kidney
celllines ...........................................................
28
7. The frequencies of mutational events with
or without JR-exposure .......................................... 34
LIST OF TABLES
Table
Page
1. Mutant frequency for IR-exposed and
unexposed kidney cell line subclones .......................
26
2. Spectrum of mutations for IR-exposed
and unexposed cells ..........................................
32
3. Frequency of each mutational event .......................
33
4. Examples of alleles with mutations ........................
36
5. Mutation distribution at the Aprt Locus of
unexposed and IR-exposed K634 ..........................
37
Hypermutagenic Induction of Mitotic Recombination by
Ionizing Radiation in Mihi Null Mouse Cells
Introduction
Different factors contribute to mutagenesis and carcinogenesis in living
organisms. These factors may come from endogenous or exogenous sources.
Exogenous sources include ultraviolet radiation, ionizing radiation, or various
environmental chemicals such as alkylating agents. Endogenous sources such as
reactive oxygen species are produced inside the cell.
Mutations can also arise as a result of DNA polymerase error. The error rate of
replicative polymerases is approximately io. The 3' to 5' exonuclease activity of
DNA polymerase reduces this rate to approximately 1 o. A well-studied pathway
named mismatch repair (MMR) further decrease the rate to one in 1 O.
Prokaryotic and eukaryotic cells have evolved this highly conserved mechanism
to correct mismatches arising during replication. Although most studies of MMR
functions have focused on postreplication fidelity, recent studies suggest that
MMR proteins are also involved in other processes to maintain genomic integrity
and to avoid mutations. These processes include DNA damage recognition and
homologous recombination. These functions will be discussed below as drawn
from comprehensive reviews [1] [2] [31 and original research reports.
The steps in MMR are recognition and binding, nicking (in prokaryotes),
excision of fragments, replication and ligation. In E. coli, MutS recognizes base-
pair mismatches and 1-4 base pair insertion-deletion loops (IDL). MutS is an
ATPase that funtions as a homodimer. Its N-terminus contains the DNA binding
domain, and its C-terminus includes ATP binding/hydrolysis and dimerization
sites. Both subunits in MutS homodimers are involved in ATP binding/hydrolysis
and mismatch binding. MutS has counterparts in eukaryotic MMR systems. In
yeast, the MutS homologs include MSH1, MSH2, MSH3 and MSH6, which
function in MMR, and MSH4 and MSH5, which function in meiotic
recombination rather than postreplication correction. MSH 1 is involved in mitotic
mismatch repair in mitochondna. Instead of working as homodimers as in E. coli,
MSH2, MSH3 and MSH6 recognize and bind mismatches as heterodimers.
MSH2/MSH6 form MutSy and bind base-base mismatches and +1 IDL.
MSH2/MSH3 form MutSy and bind +1 IDL and 2-8 nucleotide loops. MutS
homologs in mammalian cells are similar to those in yeast.
In the presence of ATP and a mismatch, MutS recruits MutL. MutL is also an
ATPase and functions as a homodimer. The N-terminus of MutL belongs to the
GHKL ATPase superfamily and its C-terminus may be used for dimerization and
interaction between MutL and UvrD helicase. MutL coordinates functions of
MutS, MutH, and UvrD. The latter two proteins will be discussed below.
Eukaryotes also have MutL conterparts. In yeast, MutL homologs form
heterodimers MLH1/PMS1, which is a major player in postreplication repair, and
MLHI/MLH3 and MLH1/MLH2, which play minor roles. Mammalian MutL
homologs form MLH1/PMS2 (MutLy), MLH1/PMS1 (MutLy) and
MLH1/MLH3 heterodimers. Inactivating mutations in MutS and MutL homologs
'I
can induce higher spontaneous mutation rates in cells. In humans, HNPCC
(human nonpolyposis colon cancer) is caused by germline mutations in MMR
genes Msh2 (50%), Mlhl( 40%) and Pms2
(10%) [4].
ATP hydrolysis releases MutS from a mismatch and triggers its movement
along the DNA molecule in both directions, which can be up to 1KB in E. coli. In
E. coli, MutL recruits and activates MutH, which is a monomeric endonuclease.
To correct mismatches MMR must replace the incorrect base in the newly
synthesized strand. Hemimethylated GATC sites help MMR to distinguish the
newly synthesized strand from the template strand. MutH nicks the unmethylated
strand at GATC sites and UvrD helicase then unwinds the nicked strand. SSB and
helicase II also interact with MutL and are recruited to the nicked strand. RecJ,
exoVil, exol, exoX excise past the mismatch and Polill is used to resynthesized
the DNA strand. Ligase then seals the nick.
In eukaryotes, Exol, RAD27 and DNA ploymerase y and y may provide the
exonuclease functions. RPA fills the role of SSB in prokaryotes. In eukaryotes,
there are no GATC hemimethylated sites that can be used to direct MMR to nick
the newly synthesized strand. No counterpart of MutH has been identified and no
nicking activity has been found to be associated with MMR in eukaryotes. It has
been suggested that PCNA might help MMR distinguish the newly synthesized
DNA strand in eukaryotes. Some studies have shown that MSH2 and MSH6
physically interact with PCNA and that PCNA help deliver MutS homologs to
newly replicated strands.
ru
Recent studies have shown that in addition to recognizing mismatched bases,
MMR may also recognize various base modifications caused by different
genotoxins, such as 8-oxo-guanine lesions caused by oxidative stress and O6
methyl guanine caused by alkylating agents. By recognizing 8-oxo-guanine
induced by oxidative stress, MMR might cooperate with base excision repair
(BER) to repair 8-oxo-G:A mismatches. In
Msh2-I-
mouse embryonic fibroblasts,
H202-induced 8-oxo-guanine was increased relative to MMR proficient cells [5].
MutSy is attracted by 8-oxo-G and binds preferentially to 8-oxo-G:A when
compared with 8-oxo-G:C [6]. Studies have suggested that MMR helps remove 8oxo-G opposite to A and that hMSH6 may work with hMYH to remove A
opposite 8-oxo-G [7]. In budding yeast, MSH2/MSH6 work with OGG1 to
remove A misincorporated opposite to 8-oxo-G, thus preventing G:C to T:A
transversions [8].
MMR also plays a role in suppressing mutations caused by alkylating agents.
Alkylating agents, like 1-Methyl-1-nitrosourea (MNU) and 1-methyl-3-nitro-1nitrosoguanidine (MNNG), can form 06-methylguanine, 04-methylthymine and
N-methyl bases. N-methyl bases are mainly repaired by BER. 0-methyl-modified
bases are repaired by methylguanine methyltransferase (MGMT). When damage
caused by alkylating chemicals exceeds the repair capability of MGMT, cells will
undergo cell cycle arrest often followed by apoptosis. However, MMR deficient
cell lines do not undergo cell cycle arrest alter exposure to alkylating agents and
are resistant to cytotoxicity, suggesting a role for MMR in this process [9]. Two
models have been proposed to explain these observations, the futile repair model
and the signaling model. The futile repair model proposes that MMR proteins
bind O6metGIT or O6metGIC during replication, remove the T or C base and then
add another C or T back again. This process does not remove O6metG because
O6metG is in the template strand. According to this model, multiple cycles of
excision/resynthesis will eventually arrest the replication fork [9]. The signaling
model proposes that it is not the arrest of the replication fork that finally leads to
cell cycle arrest and apoptosis, but instead it is the activation of the ATM/ATR
pathway that leads to arrest and apoptosis
1101.
In this model, futile repair of
O6metG leads to many double strand breaks activating the ATM/ATR pathways,
which lead to cell cycle arrest and apoptosis [11].
By discussing MMR proteins involvement in avoidance of mutations caused by
oxidative stress and alkylating agents, I have suggested that MMR proteins
function in these two cases is recognition of modified bases that can form
mismatches during replication. This leads to the suggestion that MMR proteins
interact with other DNA repair pathways to eliminate modified bases or to arrest
cells that will undergo apoptosis if lesions can't be repaired properly.
In addition to the functions discussed above, MMR is also involved in genetic
recombination. MMR may affect genetic recombination through two pathways,
one is through its ability to recognize mismatched bases and the other is
independent of error correction. Genetic recombination, more specifically
homologous recombination, can occur in somatic cells (mitotic recombination or
sister chromatid exchange), or in germ cells (meiotic recombination). MMR
proteins MSH4 and MSH5 affect meiotic recombination in a way that is believed
to be independent of error correction of mismatch repair. The influence of other
MMR proteins such as MSH2 and MLH1 on both mitotic and meiotic
recombination may stem from their function in repairing mismatches in
heteroduplexes arising during recombination, and suppression of recombination
between divergent sequences.
MSH4 and MSH5 form a heterodimer. They don't appear to function in MMR
because the mutations don't confer microsatellite instability, which is a marker for
genomic instability caused by MMR deficiency. Moreover, their mRNA
expression is low in tissues other than testis and ovary. Yeast Msh4 and Msh5
mutants showed wild type levels of gene conversion and postmeiotic segregation,
however they exhibit reduced crossing over rates in meiosis 11121. Loss of Msh4 or
Msh5 in mice leads to failure of normal meiotic pairing and synapsis. Studies
indicate that MSH4/MSH5 emerge on the intermediate meiosis nodule in
zygonema of prophase I, then decline in late pachynema or early diplonema.
Further studies are needed to clarify their specific function in meiosis 11131.
MMR proteins function in repairing mismatches in heteroduplexes during
genetic recombination may be similar to its function in postreplication repair. This
process also includes recognizing and binding to the mismatches. Heteroduplexes
can arise in four ways: 1) when the invading strand pairs with a complimentary
donor strand,
2)
when the displaced strand in the donor sequence pairs with the
7
single strand on the other side of DSB (double strand break), 3) through branch
migration in the Holliday junctions and 4) when the invading strand anneals back
to its original DNA strand [141 . In yeast tetrad analysis studies of meiotic
recombination, MMR deficiency results in an increase of postmeiotic segregation
and a decrease of gene conversion, which suggests a failure to repair the
mismatches that arise in the heteroduplex [15]. MMR proteins also suppress
homologous recombination between divergent sequences. Mitotic recombination
between similar sequences might lead to lethal chromosome translocations or the
conversion of heterozygous mutations to homozygous mutations.
In a recent review, the authors suggest that homologous recombination between
imperfect matches sequences can be suppressed via three mechanisms: 1) by
slowing strand exchange rates, 2) by blocking strand exchange, and 3) by
increasing the instability of the blocked heteroduplex intermediate [14]. MMR
proteins such as MutS and MutL homologs are found to promote the latter two
mechanisms. In prokaryotes, transformation, transduction and conjugation all
require HR to successfully transfer the introduced DNA sequence. MMR proteins
were shown to inhibit these processes because the inactivation of MMR proteins
increases the frequency of sequence transfer [161 [171. In yeast, MMR was also
shown to block branch extension in homologous recombination in the presence of
mismatches, and thus prevent HR between divergent sequences [14]. In E co/i and
yeast, there is evidence implying that helicases RecQ and SGS1 and MMR
repress homologous recombination between divergent sequences by unwinding
8
the invading strand [181. In mammalian cells, BLM, a RecQ family member,
colocalized with MSH6 in discrete nuclear foci after ionizing radiation [191. BLM
also have been reported to interact with MLH1 [20]. MMR proteins may also
directly interact with signaling pathways such as the physical interaction between
ATM and MSH2 after ionizing radiation exposure [21].
My thesis research is focused on how MMR affects ionizing radiation
mutagenesis. Ionizing radiation is a mutagen that induces a variety of DNA
lesions including DSBs, single strand breaks and base and sugar modifications. If
these lesions are not repaired correctly a variety of mutations can be induced that
can be characterized as large or small event mutations. Small event mutations
include base substitutions, small deletions, insertions and frameshifts. In a paper
studying JR-induced mutations in the APRT (adenine phosphoribosyltransferase)
gene in CHO cells, base substitutions were induced with no hot spots discovered
for these mutations. Unlike most mammalian cells, loss of APRTin CHO cells
can't occur readily via a large mutational event because it links to some critical
genes [22].
Most ionizing radiation induced mutations are large in size [23]. In studies
using human lymphoblasts and mouse embryonal carcinoma cell lines, large
events account for most ionizing radiation induced mutations [241 [25]. Large
events include chromosome loss, deletion and mitotic recombination. Studies in
human TK6 lymphoblasts using TK (thymidine kinase) or HPRT (hypoxanthine
phosphoribosyltransferase) genes as selectable markers showed that most X ray-
induce mutations arise from deletions [26] [27]. However at least one study has
suggested that mitotic recombination may also contribute to mutagenesis induced
by ionizing radiation (IR) [28].
DNA repair proteins may interact with ionizing radiation to activate cell
responses. This could affect JR-induced mutagenesis, as shown in a study in
which p53 null mice showed increased deletion and mitotic recombination
compared to p53 proficient mice after JR-exposure. The authors suggested that
this may be due to p53 protein involvement in homologous recombination and
nonhomologous end joining [29]. There are also studies about potential MMR
involvement in the cellular response to IR-exposure. In research using transgenic
mice with transgenic supFGl and lambda cli reporter genes, Pms2 deficiency was
shown to increase the frequency of IR-induced mutations when compared with
Pms2 proficient mice. This study suggested that MMR proteins' deficiency
conferred hypermutability to JR-exposure and the mutations are caused by
unrepaired oxidative lesions [30].
Various studies have investigated the role of MMR in IR-activated responses.
An early study showed that Mi/il deficient human colon carcinoma cells (HCT
116) and murine Mi/il knockout cells had transient G2-M cell cycle arrest or
inability to maintain the G2-M arrest after IR-exposure [311. They also showed
that Msh2 deficient cell lines show a similarly altered G2-M checkpoint. These
studies have suggested that this altered G2-M checkpoint may be due to a
defective maintenance of phospho-Tyr-cdc2 level in MMR deficient cells [32]. A
10
separate study also reported that Msh2 deficient cell lines showed an inefficient
G2/M checkpoint, that CHK1 activation was transient and that CHK2 was not
phosphorylated [33].
A recent study suggested that S-phase checkpoint activation in response to JR
also required MMR proteins, because Mlii] null cells showed RDS (radioresistant
DNA synthesis) after JR-exposure. In this study the authors also showed that
MSH2 binds to CHK2 and MLH1 binds to ATM, which suggested that MMR
affected the S-phase checkpoint by interacting with ATM pathway [21]. A
second study, however challenged these findings by showing normal S-phase
checkpoints in three Mihi null cell lines. They suggested that signaling defect to
JR exposure may be due to the experiment procedures and phenotypic traits of the
cells the other authors used [34]. The reply to this challenge was that the different
results from the studies may be due to mutations other than MMR deficiency in
the MMR deficient cells used by the different groups [341.
The primary damage JR causes is DSB (double strand break). DSB can be
repaired through homologous recombination and nonhomologous end joining. In
earlier paragraphs, I have introduced that MMR proteins can inhibit HR
(homologous recombination) between divergent sequence. It is rational, therefore,
to infer that in addition to the possibility that MMR exerts its influence by
interacting with signaling pathways, MMR may also affect the response to JR by
influencing correction of DSBs by homologous recombination repair. A study
using mouse embryonic fibroblasts showed that there was defect in localization of
11
recombination-related proteins MRE1 1 and RAD5 1 and increased chromosomal
damage in Msh2 deficient cells after IR-exposure [331.
My graduate thesis research continues the study of the role of MMR in the
response to JR-exposure. In contrast to other studies focused on cell cycle
signaling pathway affected by MMR in IR-exposed cells, my work is focused on
IR mutagenesis in an MMR deficient cell line. Through analyzing mutant
frequencies and mutational spectra in an JR-exposed MMR deficient cell line and
in MMR proficient cell lines, I investigated how IR-induced mutagenesis is
changed in MMR deficient cells.
12
Materials and Methods
Cell lines:
The three cell lines used for my thesis are Mihi null K634, K06 and K435.
K634 is a kidney epithelial cell line from mice null for Mihi. K06 and K435 are
kidney epithelial cell lines derived from wild type mice. All three cell lines are
heterozygous for Aprt: in these three cell lines, one copy of Aprt gene is intact and
the other copy is disrupted by an insertion of a DNA sequence that confers
neomycin resistance to the cells. All three cell lines are heterozygous for some
microstallite markers along chromosome 8, which harbors Aprt gene. K435 shows
a MMR-independent G: C to C:G transversion mutator phenotype [351. K06
exhibits a spontaneous mutational spectrum similar to diploid kidney cells in vivo
[35]. All these three cell lines were maintained in the Dulbecco's Modified
Eagle's Medium (DMEM, Gibco BRL) supplemented with heat-inactivated 10%
(vlv) fetal bovine serum in 5% CO2, at 37 °C.
JR Cell survival assay:
Cells were grown in T75 flasks, then collected and put into 15 ml conical tubes
at 106 cells per tube. After exposure to '37Cs-? at various doses (0 Gy, 1 Gy, 2 Gy,
4 Gy, 5 Gy, 6 Gy and 8 Gy ), the cells were plated at various densities: 200 and
400 cells per plate at 0 Gy and 1 Gy, 400 and 800 cells per plate at 2 Gy, 600 and
1200 cells per plate at 4 Gy and 5 Gy. 600 and 2000 cells per plate at 6 Gy and
13
1000 and 2500 cells per plate at 8 Gy. After 2 weeks, the plates were stained with
0.25% crystal violet and the number of surviving clones determined.
Determination
of mutant
frequency and mutant isolation:
Cells were plated at 400 cells per plate and clones allowed to form for 2 weeks.
Subclones were picked and grown to confluent T75 flasks. For each subclone, 106
cells were counted, put into 15 ml conical tube and then exposed to 6 Gy of 137Cs-
y radiation. Cells were then put back into T75 flasks and allowed to recover for 1
week. Untreated cells used for spontaneous mutagenesis analysis for each
subclone were collected and underwent the same procedure except for irradiation.
Both exposed and unexposed cells for each subclone were plated at 400 and
200 cells per plate to decide cloning efficiency for non-selected condition. Plates
of 5 X
iOn, 10 X iO, 15 X iO cells were set up at the same time and 2,6-
diaminopurine (DAP) was added at a concentration of 80 ug/mI the next day.
These plates were used to select Aprt deficient mutants and to determine the
mutant frequencies. After 2 weeks, the non-selected plates were stained with
0.25% crystal violet. After an additional 7-10 days, the DAP selection plates were
also stained with 0.25% crystal violet. DAP resistant clones were isolated from
some selection plates and expanded for a molecular analysis.
Stained plates were scored for colonies. Cloning efficiency was calculated by
the ratio of number of colonies counted to the number of cells plated. Mutant
14
frequency is the ratio of the cloning efficiency in DAP selected plates to that in
the non-selected plates.
Isolation of genomic DNA:
Aprt deficient mutant clones were expanded to confluent T25 flasks. After
rinsing with PBS, lOpl of 10pM proteinase K, 4Opl of 100 pm sodium lauryl
sulfate (SDS) and 500 pl of NLB solution (1 mM Tris, pH 8.0, 2.23 mM EDTA,
0.4 M NaCI) were added to each flasks. The flasks were incubated at 37°C
overnight and the lysates transferred to microcentrifuge tubes. Saturated NaCl 170
p1 was added, followed by vigorous shaking for 15 seconds. After centrifugation,
the supernatants were transferred to new tubes and two volumes 100% ethanol
were added. DNA was precipitated and after another centrifugation the DNA
pellet was washed with 70% ethanol. TE 200 pl was added to the tube and
incubated overnight at 37°C to dissolve DNA.
The next day, the solution was transferred to another tube, and 20 p1 7.5 M
ammonium acetate and two volumes of ethanol were added to precipitate DNA.
After being washed with 70% ethanol, the DNA pellet was dissolved and stored in
60 p1 TE.
15
Distinguishing between large and small Aprt mutations in mutant
cells:
When investigating the mutagenic effect of ionizing radiation, the mutational
spectrum also needs to be analyzed. To analyze the mutational spectrum, I first
distinguished between large and small event mutations for each mutant clone. In
later steps, the large event mutations were further analyzed through LOH analysis
and small event mutations were examined by DNA sequencing.
Parental cell lines had one copy of Aprt that was made nonfunctional by an
insertion of neomycin resistance sequence. Therefore for loss of Aprt function in
the mutant cells, the other functional copy of Aprt must have been inactivated by
a small event or large event mutation. The two types of events can be
distinguished through detection of Aprt by PCR. Large events would lead to loss
of the whole functional copy of Aprt gene, whereas small events would retain this
copy.
Three PCR primers were used: APRT-GA
(GTAAACCTGACCCAATGTCTC), APRT-GS
(AGCAAAGACCTAGTGTTCCTAGCAAG) and NEO-GS
(GATCAGGATGATCTGGAGGAA). APRT-GA and APRT-GS were used to
amplify exon 3 of the wild type copy of Aprt. APRT-GA and NEO-GS were used
to amplify part of the neomycin resistant sequence and part of exon 3 of the
knockout copy of Aprt.
16
PCR conditions were as followed: first denature at 94°C for 3 minutes,
followed by 30 cycles denature at 94°C for 30 seconds, annealing at 58°C for 30
seconds, DNA extentesion by Taq polymerase (Invitrogen) at 72°C for 30
seconds, and alter the final cycle, reaction left at 72°C for 3 minutes.
The PCR products were then separated in 1% agarose (Gibco BRL) For the
small event mutation, two bands (344 bps for wild type copy and 600 bps for the
knockout copy) would be expected. For large event mutation, the 344 bp band
was lost, with 600 bp band left, as Figure 1 shows.
LA)U LOU LOU
MlOhp
Knockout Aprt allele
Wild type .1prI allele
44Obp
ZOObp
Small event mutation
Large event mutation
Figure 1: Large and sinai! mutational events can be determined by amplifying
Aprt gene. Details were given in Materials and Methods. Knockout band of Aprt
gene is aproximately 600 bps, and wild type band is 344 bps. Small event
mutations would retain both bands, and large event retains the 600 bps knockout
band only.
LOH analysis for large mutational event:
After distinguishing between large and small event mutants, we further
characterized large event mutations by loss of heterozygosity (LOH) analysis.
17
Genetic polymorphism occurs when there are more than two variant alleles for
a single locus in the genome. Loss of heterozygosity at a polymorphic locus in the
genome is important in carcinogenesis. There are three types of large event
mutations that can lead to LOH: deletion, chromosome loss and mitotic
recombination. Distribution of L011 among polymorphic loci along one
chromosome can be used to characterize these three types of large event
mutations, as Figure 2 shows. A useful polymorphism for mouse genetics is the
dCA repeat microsatellite, which is scattered throughout the mouse genome, and
for which there are many strain specific polymorphisms. These polymorphic
microsatellite loci were used as markers to determine the distribution of LOH in
the Aprt mutant cells.
18
P
.
I
intragenic recombination
event
I
deletion
Chromosome
loss
ikterozgous mkrosateilite Joel
Figure 2: Large mutational event can be characterized by LOH patterns of
inicrosatellite markers along chromosome 8. LOH patterns for polymorphic
chromosome loci representing intragenic events, chromosome loss, mitotic
recombination, and deletions.
The mouse Aprt gene is located on chromosome 8. For the K634 cell line
(Mihi null) I used 11 polymorphic microsatellite markers along chromosome 8
(from centromere to the telomere, marker 124, 3, 125, 190, 100, 312, 166, aprt,
13, 93, 56) In this study, through investigation of LOH for these 11 polymorphic
microsatellite markers, I could detect distribution of LOH along chromosome 8,
and then distinguish deletion, chromosome loss and mitotic recombination, as
Figure 2 shows.
First I amplified the polymorphic microsatellite dCA repeat regions for each
locus along chromosome 8. All primers used were obtained from Research
Genetics (Huntsville, AL) except for primers for CA-APRT microsatellite marker.
19
This primer pair are T[TCATAACGGAGCITCCCTTFAGT (CA3) and
GGACCTTCCTGTGAGCCCGTG (CA4). PCR conditions for these markers are
the following. First denature at 94°C for 5 minutes, followed by 30 cycles
denature 94°C for 40 seconds and annealing and extension (Taq polymerase) both
at the same step at 55°C for 30 seconds. After the final cycle the reactions left
were left at 72°C for another 10 minutes.
After denaturing the PCR products at 95°C for 5 minutes, we separated PCR
products on 8% polyacrylamide gel at 80 watts.
After overnight transfer of DNA product from gel to Hybond N+ membrane
(Amersham), I did a southern hybridization, using DIG (digoxigenin) labeled
probe.
The
oligonucleotide(CA)15
probe was labeled by DIG through the following
protocol: Mix 8 /41 5X reaction buffer (made up by the manufacturer in the kit), 8
/41
25uM CoC12, 2 jil terminal transferase (all these three reagents are from
ROCHE), 2 jil DIG (digoxigenin)-1 1-dUTP (ROCHE), 4 jil 50 jiM
Oligonucleotide (CA)15, 2 jil 100 pM dATP and H20 14 p1. Then the reaction was
incubated at 37°C for 15 minutes and terminated by adding 2 p1 0.5 M EDTA
(pH=8.0).
After washing the membrane in 0.4 M NaOH for 20 minutes and 2XSSC for 20
minutes, I incubated the membrane in hybridization buffer for 2 hours at 42°C.
(100 ml hybridization buffer was made by mixing 25 ml 20X SSC, 10 ml 10%
nonfat milk dissolved in buffer 1 (see below), 200 p110% SDS, 1 ml 10% N-
20
Lauryl Sarcosine, 40 p1 DIG-labeled probe and 65 ml H20). I rinsed off unbound
probe by three washes in 6XSSC and 0.1% SDS solution for each for 5 minutes.
And after one minute wash in Buffer 1 (solution of 200 mmol maleic acid, 300
mmol NaCL, 400 mmol NaOH in 2 L H20 at pH 7.5) and 0.3% Tween 20, I
blocked the membrane in 10% nonfat milk dissolved in Buffer 1 for 30 minutes.
Then I incubated the membrane in 1:10000 Anti-DIG-AP (ROCHE) in 10%
nonfat milk Buffer 1 solution for 2 hours. After 2 washes in Buffer 1 for 15
minutes each and 1 wash in Buffer 3
(6
mmol TrisHCl, '14 mmol Trizma base, 50
mmol NaC1 in 400 ml H20) for 2 minutes, the membrane was developed
overnight in the dark in a solution of 400 p1 50 mg/ml NBT, 500
p1 50
mg/ml
BCIP in 60 ml Buffer3.
The next day, the membrane was fixed in TE for 15 minutes. A representative
analysis is shown in Figure 3.
21
Marker 56
aiLI
Bl. a!Lk
Retention of heterozygocity
N
1.011
Loll
i
ol Iwterozygosity
ele
Marker 190
tide
LOH
Figure 3: Retention of heterozyogsity or loss of heterozygosity for microsatellite
markers 56 and 190 shown in LOH analysis. LOH analysis was carried out for
each mutant with large event mutation as described in detail in Materials and
Methods section 'LOH analysis'. After separation on polyacrylamide gel and
bloting, the membrane was developed. Each lane represented a result from a
mutant DNA preparation. Retention of heterozygosity for a given microsatellite
marker is shown by two bands, and each of them represented one allele for the
locus. Loss of heterozygosity is demonstrated by loss of one band.
22
DNA sequencing for small mutational event:
1
Cuss
2
3
4
5
JIAI'RT5
APRT5A
............................................................
APRT4;s
QIAPRT5
QJ%PRT3'
.............................................................
.4
APItT-4
Figure 4: Primers used to amplify and sequence mouse Aprt gene. The mouse
Aprt gene is 2.3 kb long and contains five exons which are shown in box regions.
CH5S, QIAPRT3, APRT-GS, QIAPRT5 and QIAPRT3' were used for
amplification. The fragments amplified by each pair of primers are showed with
dashed lines. CH5S, APRT-4 and QIAPRT3' were used for sequencing. See
Materials and methods section' DNA sequence analysis' for detail.
The basic scheme for the amplification of Aprt regions for a sequence analysis
is shown in Figure 4. Exon 1 and 2 are amplified by primer pair: CH5S
(GCTTGTGTTTAGGCAGCTCAAG) and QIAprt3
(GAGCAGAGTTCGTCTCTAGGAAC). Exon 3 and exon 4 are amplified by
Aprt-GS (AGCAAAGACCTAGTGTTCCTAGCAAG) and Aprt-5A
(CGGTAGCTCACAAAGGTCACTTAG) . Exon 4 and exon 5 are amplified by
QiAPRT5 (GTAAATGTGGGTGCTCAGAGAG) and QiAPRT3'
(CTTGTCCCTGTAGTGTCACTCTG). PCR was conducted under the following
conditions. First denature at 94°C for 3 minutes, followed by 35 cycles of
denature at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at
72 °C for 1 minute by Taq, finally extension at 72 by additional 10 minutes.
23
The PCR products were separated on a 1.2% agarose gel, and purified with a
purification kit (Qiagen). DNA fragments were then sequenced by an automated
sequencer. The sequences for exon 1 and 2 were obtained with primer CH5S. The
sequences for exon 3 and 4 were obtained with primer Aprt-4
(CTTAGTCAGCACCCAGGACAG). The sequences of exon 5 were obtained
with QiAPRT3'.
Statistical analysis:
The difference between spontaneous and IR-exposed mutant frequencies (Table
1 & 2, Figure 6 & 7) was tested using the Wilcoxian signed-rank pair test for
paired data. A 90% confidence interval was found by first log-transforming the
data and then inverting the signed-rank test. All tests were performed at a
significance level of 0.05. One sided p-values were used due to the expected
ranking between spontaneous and IR-induced mutant frequencies.
To determine IR effects for specific mutational events, the number of
spontaneous mutations and those from the IR-exposed cells was tabulated for
each of the four separate classes of mutation (mitotic recombination, chromosome
loss, deletion, and intragenic). Fisher's exact test was then used to determine
whether the type of mutation was independent of how it came about (spontaneous
vs. IR-induced). When this overall test was significant, a separate Fisher's exact
test was performed for each mutational type (vs. all others combined) to isolate
the mutation(s) responsible for significance.
24
Results
Effect of Mlhl status on cell survival to ionizing radiation.
The influence of MMR status on cell viability after exposure to JR has been
examined by several groups. A group using Msh2 null primary mouse epithelial
cell lines showed hypersensitivity of these cells to X rays compared with Msh2
proficient cells, with relative reduction of cell survival compared to wild type
cells of approximately 1.5 fold [33]. Two other groups reported slight resistance
to IR for MMR deficient cells: one group used mouse fibroblast cells deficient for
Pms2, Mihi, or Msh2 [36], and the other group used mouse embryonic stem cells
exposed to low-level JR [37]. In contrast two other groups, one using HeLa and
Raji Cells and the other using human ovarian cancer, endometrial carcinoma and
colorectal carcinoma cell lines, found that MMR status does not affect cell
survival after exposure to IR. Jt has been suggested that the different results
obtained by these groups may be due to other factors other than MMR, since
clones from the same parental cells could acquire slightly different traits during
clonal selection in different labs. In a recent study, investigators switched MMR
status by regulation with doxycycline, and found that Mihi status had no effect on
cell survival to JR [38].
To determine JR resistance I irradiated the Mihi null cell line K634 and the
DNA repair proficient cell line K06 at '37Cs-y doses from iGy to 8 Gy. I found
cell survival for the Mihi null K634 similar to that for Mihi proficient K06
(Figure 5). K435 is a cell line with a G:C to C:G mutator phenotype. It displayed
25
normal sensitivity to JR killing when compared with wild type cells in a previous
study 11391. From the initial experiment, I can conclude that Mihi status did not
affect sensitivity to JR killing.
120%
100%
I
Survival
60%
40%
20%
0%
2
4
6
8
20%
137Cs-y radiation (Gy)
Figure 5 Cell survival to ionizing radiation. Mihi null K634 cells and the DNA
repair proficient K06 cells were exposed to various doses of '37Cs-y radiation
indicated in the figure. The relative cloning efficiencies were determined and
plotted.
Mutagenic effect from JR on Mihi null cells
Environmental mutagenesis can be studied by determining mutant frequencies
and mutational spectra induced by a given genotoxin. Any alteration in either of
these two endpoints demonstrates the mutagenic effects of the genotoxin on the
cell genome. J first studied the effect of JR on mutant frequencies by exposing the
Mihi null K634, K06 and K435 cells to 6 Gy radiation and scoring mutant
frequencies (Table 1, Figure 6).
Table 1. Mutant frequency X1Ofor JR-exposed and unexposed kidney cell line
subclone?
Mihi null K634
Spontaneous mutant
Subclonesb
3c
5b
3d
JR-exposed mutant freq.d
freq.c
3.0
4.2
3.5
28
30
23
lb
16
14
68
60
4c
Average (Stand. Dev.)
29
16 (11)
31
K435 subclones (G:C to
C:G mutator phenotype)
Spontaneous mutant freq.
JR-exposed mutant freq.
2.7
4.4
0.8
0.6
2.3
10
ic
6b
la
1
2
3
4
5
6
7
8
9
10
14
15
Average (Stand. Dev.)
1.0
2.2
9.6
2.2
0.8
9.8
0.5
3.1 (3.8)
16
19
62
13
37 (23)
3.0
6.0
0.8
1.6
2.3
5.8
9.0
13
1.5
1.5
1.6
4.5 (5.6)
27
K06 subclones (DNA
repair proficient)
Spontaneous Mutant
Freg.
204
3.1
10
205
206
207
221
0.3
0.2
0.1
0.3
0.03
0.5
0.03
0.08
0.46 (1.0)
5.3
0.6
0.6
224
225
226
230
Average (Stand. Dev.)
JR-exposed mutant freq.
1.5
0.03
0.7
0.7
0.2
2.1 (3.6)
a The data from the table are plotted in Fgure 6.
b Each subclone was expanded and split for determination of spontaneous and IRinduced mutant frequencies.
c Mutant frequencies for cells not exposed to JR
d Mutant frequencies for cells exposed to 6 Gy '37Cs-y radiation.
28
LOO4U
LQi-O3
I
1.ODE-DS
i .00E-C16
pIL
K6S4
IR
SJOIL
Xc
1k
So
K43
1k
Figure 6. Mutant frequencies for JR-exposed and unexposed subclones for
three kidney cell lines. The three cell lines tested were Mihi null K634, DNA
repair proficient K06 and K435 with a G:C to C:G mutator phenotype. Each
subclone of these cell lines was grown and split to two cultures. One was exposed
to 6 Gy 137Cs-? radiation, and the other was unexposed. Then the mutant
frequencies were determined and plotted, and each pair are connected by lines.
The average IR-induced mutant frequency for DNA repair proficient K06 is
2.1 X iO (Tablel), which is approximately 4.6 fold higher than the spontaneous
mutant frequency. This change was statistically significant ( p <0.015). The
calculated number of JR-induced mutations was approximately 1 in every 6000
cells. The result demonstrates a mutagenic response to JR for K06, which is
consistent with general knowledge that JR is a mutagen.
In a previous study in our lab 35], the G:C to C:G transversion phenotype in
the K435 cells was shown not to be due to a deficiency in MMR system. K634 is
an Mihi null cell line. Because these cell lines have a high spontaneous mutant
29
frequency, the next question I wanted to address was whether they would exhibit
a mutagenic response to JR. Addressing this question would allow me to
determine if the defects present in the K435 and/or K634 cells
(Mihi
null ) would
cause an unusual mutagenic response to JR. These defects could lead to an altered
cellular response to JR or a failure to repair the damage. If JR-induced repair and
cell defects were independent of each other, the mutagenic effect could be
cumulative. If they interacted with each other, the effects could be synergistic.
Alternatively, if there was no unusual response to JR-exposure, the high
spontaneous mutant frequency would mask the JR mutagenic effect.
The spontaneous mutant frequency of K435 was high (3.1 X 1O) (Table 1)
which is 6.7 fold higher than K06 cells. This is due to the high mutation rate for
G:C to C:G mutation in this cell line. After JR-exposure, the increase in mutant
frequency was not statistically significant (p <0.133). This didn't exclude the
possibility that there was a mutagenic effect of JR to K435, but instead suggests
that at best there was only an additive effect. If JR-induced mutations in 1 of
every 6000 K435 cells (the JR effect in DNA repair proficient cells K06 cells),
this would only add 1.7 X iO to the high spontaneous mutant frequency, which
would be masked by the high spontaneous background.
Consistent with the mutator phenotype conferred by Mihi deficiency, Mihi
null K634 had a high spontaneous mutant frequency (16 X 1 0) (Table 1). This
high spontaneous background could mask the mutagenic effects of genotoxins, as
it was difficult to consistently detect increased mutant frequencies after these cells
30
were exposed to ultraviolet radiation (UV) or hydrogen peroxide [40]. Yet this
was not the case for JR-exposure. The average mutant frequency for Mihi null
K634 exposure to JR was 37 X 10 (Table 1), which was about a 2.3 fold increase
over that for nonexposed cells (p < 0.024). This modest relative increase
translated to a very large absolute induction of 20 X iO above the spontaneous
background, or approximately one JR-induced mutation for every 500 MIhi null
K634 cells. This level of induction was approximately 12 fold higher than that in
the K06 cells (one induced mutant in every of 6000 cells). This difference
suggested a hypermutagenic effect of JR in the MI/il deficient K634 cells, and
that Mihi deficiency and JR-exposure have a synergistic effect, not an additive
effect. This interaction may play a significant role in prevention of JR caused
DNA damage leading to mutations.
The hypermutagenic response in the Mihi null cells is due to the
induction of mitotic recombinational events.
To determine the types of mutations induced by IR, I first distinguished
between large and small event mutations in the mutant Mihi null cells by
detection of loss or retention of the wild type Aprt alleles. In unexposed Mihi null
K634 cells, 81% of the spontaneous mutations were small events and 19% were
due to large events. After exposure to IR, large events accounted for 65% of all
the mutations, and small events decreased to 35%. This shift in mutational spectra
suggested IR-induced large event mutations in Mihi null cells.
31
To determine the types of large mutational events that were induced by JR in
the Mihi null cells, I analyzed the distribution of LOH for microsatellite markers
along chromosome 8 (Table 2). By multiplying the percentage of each type of
large and small mutations with the mutant frequency of the cells, I obtained
frequencies for each type of mutational events (Table 3).
Overall, the combined mutational spectra for the JR-exposed DNA repair
proficient K06 cells were statistically different than the spectra of non-irradiated
K06, although for any of the three types of large event mutations a statistical
difference between the non-irradiated and irradiated K06 can not be reached.
Nonetheless a 5-10 fold increase in the frequency for each of these three types of
large events was observed. (Table 3) This suggested that the increase in mutant
frequency for JR-exposed K06 was a result of a combined effect of the increase
for all three types of large event mutations (Figure 7).
32
Table 2. Spectrum of mutations for JR-exposed and unexposed cells.
K634 cell line (Mihi null).
Mutationa
Unexposed'
12 (17%)
JR-exposed"
Mitotic Recombination
Deletion
Chromosome Loss
Intragenic
(1.3%)
(1.3%)
27 (52%)
3 (5.3%)
5 (8.8%)
58 (81%)
22 (39%)
Total Samples
72
57
1
1
K435 cell line (G:C to C:G mutator phenotype)
Mutation
IR-exposed
Spontaneous
Mitotic Recombination
Deletion
Chromosome Loss
Intragenic
1 (3.7%)
1 (3.7%)
2 (7.4%)
2 (7.1%)
3 (11%)
7 (25%)
23 (85%)
16 (57%)
Total Samples
27
28
K06 cell line (DNA repair proficient)
Mutation
Spontaneous
Mitotic Recombination
Deletion
Chromosome Loss
Intragenic
5 (18%)
Total Samples
1
(3.6%)
IR-exposed
10 (40%)
2
(8.0%)
11(39%)
13 (52%)
8 (29%)
0
28
25
a The different classes of mutations identified with the molecular analysis
b The number of mutations identified for each mutational class from the total
number of samples examined.
33
Table 3 Frequency X1O of each mutational eventz
K634 cell line (Mihi null)
Mutation
Spontaneous
IR-exposed
Mitotic Recombination
Deletion
3.42
0.33
2.04
Chromosome Loss
Intragenic
0.33
12.0
18.5
3.45
12.5
K435 cell line (G:C to C:C mutator phenotyj)
Mutation
Spontaneous
IR-exposed
Mitotic Recombination
Deletion
Chromosome Loss
Intragenic
0.11
0.11
0.23
2.62
K06 cell line (DNA repair proficient)
Mutation
Spontaneous
Mitotic Recombination
Deletion
Chromosome Loss
Intragenic
0.10
0.01
0.21
0.13
a Data from this table are plotted in Figure 7.
0.39
0.57
1.34
3.05
JR-exposed
0.86
0.17
1.11
34
2x103
Mutant Frequency
1xIO
1nragenc
vfltS
hromome ks
)tk recombinabon
.cp
o'.
Figure 7. The frequencies of mutational events with or without JR-exposure.
The relative frequencies for each of the four mutational categories (intragenic
events, chromosome loss, deletion, mitotic recombination) are shown in Table 3
and plotted here. Spon, spontaneous mutant frequencies; IR, mutant frequencies
in IR-exposed cells.
Although most large spontaneous events examined (12 of 14) in the Mihi null
K634 cells were due to mitotic recombination (Table 2), these events represented
only 17% of all spontaneous mutations. Most large mutational events in the IRexposed K634 cells were also due to mitotic recombination (27 of 35),
representing nearly half of all mutational events (47%) in the IR-exposed cells. (p
<0.001). This led to a determination that one in every 670 JR-exposed Mliii null
cells had an induced mitotic recombination between chromosome 8 homologues.
This induced frequency is nearly 20 fold higher than that observed in DNA
proficient K06 cells, in which one in approximately 13000 JR-exposed K06 cells
had a mitotic recombinational event suggesting that JR-exposure had a synergistic
35
effect on the induction of mitotic recombination in Mihi null K634 cells. An
additive effect of JR exposure would have added just 0.76 X iO to the
spontaneous mitotic recombination frequency in Mihi null K634 cells, which
would have been masked by the high spontaneous background. This synergistic
induction of mitotic recombination by JR-exposure contributed to most of the IR-
induced mutations (75%) in the Mi/il null K634 cells. After JR-exposure, the
frequency of mitotic recombinational events (18.5 X 1 O) exceeded that of
intragenic events (12.5 X
10k)
(Table 3, Figure 7). Jncreased numbers of
deletional events and chromosome loss were also observed in the JR-exposed
Mihi null K634 cells, but these changes were not statistically significant (p <
0.32 1 and 0.087 respectively), or as dramatic as that of mitotic recombination.
No increase in intragenic mutational events was observed after Mihl null K634
was exposed to JR. Spontaneous frequency of small event mutations was 12.0 X
iO, and it was essentially the same in JR-exposed cells (12.5 X 10) (Table 3,
Figure 7). To determine if IR-exposure altered the types of base pair substitution,
J sequenced some Aprt mutants from unexposed and JR-exposed Mihi null K634
cells. My group has previously shown that treatment of the K634 cells with
hydrogen peroxide or UV induced alleles with multiple base-pair substitutions
[401 Only one such allele (6.7%) in the JR-exposed Mihl null K634 cells was
observed, which is at the background level in this cell line. There was also no
significant difference detected between unexposed and JR-induced Mihi null
K634 cells for other types of mutations (Table 4, 5). J found one complex
mutation in a 4 C repeat, which became a 6 C repeat, in one spontaneous mutant
and one JR
induced mutant from the same subclone. Therefore this was
considered a single spontaneous mutation. Overall I found no effect of IRexposure on small event mutations. As Figure 7 shows, the increased mutant
frequency of IR-exposed Mihi null K634 mainly stemmed from an increase in
mitotic recombination.
Table 4 Examples of alleles with mutations
Mutation events
Sefluence context
exon
A:T to C:G
CCGGCCCCACT
EXON 3 Gly to Ala
Thr to Pro
G:CtoA:T
G:CtoA:T
CGGAAAAGGGG
CCGACUCCCAA
CAGGTIAGACT
GTT'CAGTGCGG
CTAGETAGGAG
CGGAAAAGGGG
EXON 3 Stop
EXON 1 Phe to Ser
EXON 3 Leu to Arg
EXON 1 Arg
EXON3 Stop
EXON3 Stop
A:T to C:G
CCGGCCCCACT
(A) spontaneous
mutants
K634-13
G:CtoC:G
K634-1 1
G:CtoA:T
K634-14
K634-15
K634-16
K634-33
K634-35
A:T to G:C
A:TtoC:G
G:C to A:T
(B) Ionizing radiated
K634-5
G:CtoC:G
G:CtoT:A
G:CtoA:T
K634-1
K634-6
K634-2
K634-3
K634-22
K634-23
K634-24
K634-25
1(634-27
G:C to A:T
G:C DELETION
G:C DELETION
G:CtoA:T
G:C to A:T
GCtoC:G
A:TtoT:A
A:T to G:C
G:CtoA:T
EXON 3 Gly to Ala
Thr to Pro
AGGCCCCACACACA BEFORE FIRST SP1
EXON I
ACGTGATVFAG
before translation
EXON 1 Arg to Trp
GTGGCGçGGCGC
EXON 3
CCGGGCCCACT
EXON 1
CCGGGCTGCI'G
EXON 1 Pro to Leu
ACVFCCAATCC
EXON I LeutoVal
TGGTGGçGCGGC
EXON 5 Ala to Pro
CFCCGGCTGAA
EXON 3 Cys to Ser
GTGGGc[GTGTG
EXON 4 Arg
GCAGAGAGTGGT
EXON 4 Glu to Lys
GAGCTGiAAATC
a These two mutants were derived from the same subclone which was split for
being unexposed and exposed to IR. So they accounted for one spontaneous
mutation.
37
Table 5 Mutation distribution at the Aprt Locus of unexposed and JR-exposed
Mliii null K634
Mutation
Transition
A:TtoG:C
G:CtoA:T
Spontaneous K634
JR-exposed K634
1
1
4
6
Tansversion
A:TtoT:A
A:TtoC:G
G:CtoC:G
G:CtoT:A
0
2
0
2
2
Deletion
0
2
Cluster
Multiple mutations
la
1
0
1
1
1
a: These two mutants were derived from the same subclone which was split for
being unexposed and exposed to JR. So they accounted for one spontaneous
mutation.
The overall effect of JR on the mutational spectrum in the K435 cells was not
statistically significant (p < 0.121). This demonstrates that the defect underlying
the G:C to C:G mutator phenotype of K435 didn't lead to a hypermutagenic
increase in mitotic recombination or other mutational events after JR-exposure.
38
Discussion
In this study, I showed that Mliii null cells exhibit a hypermutagenic response
when exposed to IR and the hypermutagenic response in the Mliii null cells is due
to the induction of mitotic recombinational events. The results can further
interpreted as demonstrating that Mlhi suppresses JR-induced mutations.
Therefore in this discussion, I will explore how Mihi may fit into the JR-induced
cellular response to inhibit mitotic recombination.
Homologous recombination (HR) can occur in meiosis and in mitosis. In
mitosis, HR can use a sister chromatid as template, which is sister chromatid
exchange, or a homologous chromosome as template, which is mitotic
recombination. Sister chromatid exchange is accurate and can restore the original
sequence, whereas mitotic recombination can change a sequence because it uses a
heterologous substrate. In normal cells, sister chromatid exchange occurs at high
frequency because sister chromatids are in close proximity to each other for a
long period of time in S-phase and can readily be used as a template. Mitotic
recombination occurs at low frequency and requires three factors. The first is
physical proximity between homologs [411. The second is sufficient homology
between homologs [42]. The third is an intact recombinational repair machinery.
The physical proximity of homologs can occur during the cell cycle [43]. In
one system [41], LOH from mitotic recombination at the Apc locus in B6 APC/mice leads to intestinal adenomas. In this mouse model, homologous
recombination was the principal pathway leading to LOH. Investigators have used
39
a Robertsonian translocation fusing chromosomes 18 (containing Apc) and 7 to
suppress homologous recombination by eliminating the close proximity of
chromosome 18 homologs in the nucleus. This resulted in a reduction in LOH at
Apc locus on chromosome 18 and a reduced incidence of intestinal adenoma.
Although it is possible that MLH1 can increase mitotic recombination by moving
chromosome homologs closer together, there is no evidence that loss of MMR
protein affects chromosomal nuclear location.
Divergent sequence between homologs has also been shown to suppress mitotic
recombination. In one study, the progeny from crosses between two distantly
related strains was shown to have suppressed mitotic recombination.
Reintroducing sequence identity to regions of the homologous chromosome
restored mitotic recombination
[44j.
In a recent study from the same group, they
showed that sequence dependent suppression on mitotic recombination between
divergent sequences was modulated by Mi/il. In this study, mitotic recombination
in inter-strain mouse hybrids was suppressed in fibroblasts, and Mihi deficiency
could alleviate this suppression. Msh2 was reported to suppress homologous
recombination between divergent sequence 42I. This suggests that not only
MLH1 but other MMR proteins might play a role into this suppression.
The following may be a mechanism for the suppressive effect of MMR proteins
on mitotic recombination between divergent sequences. Mismatches arising
during the strand exchange could reduce the strand exchange in homologous
recombination. In an in vitro reaction with a 3% divergence in sequence, the
strand exchange rate was reduced 3 fold and it was suggested that this slowing
down provided time for MMR proteins to detect mismatches in this process 1451.
On recognition of mismatches, MMR may block ongoing strand migration and
inhibit strand transfer. In vitro experiments showed that addition of MutS
increased accumulation of strand transfer intermediates and addition of MutL
helped to destablize the intermediate in homologous recombination between
divergent sequences 1461 [451. In E coli, yeast, and mammalian cells, several
studies showed that MMR proteins suppressed or prevented homologous
recombination between divergent sequences
1171147114811491
[501. In my study,
a moderate increase of mitotie recombination in untreated Mihi null cell lines was
observed. This increase is not as large as the increase in base-pair substitution,
which may be due to the low occurrence of DSBs in untreated cells. Yet this is
not the case for the cells exposed to JR.
A predominant DNA lesion in JR-exposed cells is the double strand break
(DSB) 1511. DSBs can be repaired by non homologous end joining (NHEJ) and by
homologous recombination. In mammalian cells, NHEJ is used more frequently
than homologous recombination. However, recent experiments have shown that
homologous recombination is also a prominent pathway [52]. NHEJ could occur
in G1IGO phase and homologous recombination in S and G2 phase. There is
competition between NHEJ and homologous recombination. DNA-Pkcs
suppresses spontaneous and double strand break induced homologous
recombination [53]. The involvement of MMR proteins in NHEJ has not been
41
studied as much as in homologous recombination. One report suggested that
MLH1 may modulate NHEJ by inhibiting end annealing of DSB between
noncomplementary bases or promoting annealing between microhomologies [5411.
As mentioned above, homologous recombination could proceed through sister
chromatide exchange or mitotic recombination. The sister chromatid is used 1001000 times more frequently than a homologous or heterologous chromosome
[52]. Sister chromatid exchange is preferred to reduce the potential for genetic
alteration that can occur when homologous and heterologous chromosomes are
used as template. I propose that MMR proteins help to suppress mitotic
recombination between homologous chromsomes and shunt DSB repair to
homologous recombination between sister chromatids. If so, JR exposure and
Mihi deficiency have an effect on mitotic recombination induction because
mitotic recombinational events are not suppressed.
Some studies investigating MMR proteins have suggested an involvement in JR
activated cell cycle checkpoint pathways. One study showed that MMR deficient
cells have a defective S-phase checkpoint and the cells had radiation resistant
DNA synthesis [21]. However, another study using three different cell lines
showed that Mihi deficient cell lines exhibited a similar S-phase response to JR as
MMR proficient cell lines [34]. If a defect in the JR-induced S-phase checkpoint
exists in MMR deficient cells, it should lead to an increase in base substitution
after JR-exposure because replication would have occurred in the presence of
oxjdative base lesion and the absence of MMR correction of the mutations. Yet in
42
my study, I could not detect increased base substitution or multiple mutations,
which were observed when the Mihi null cells were exposed to hydrogen
peroxide. The high background of spontaneous base substitutions may have
masked a relatively low JR-induction of base substitutions. but regardless my data
are inconsistent with an S-phase checkpoint defect.
Studies showed IR-exposed MMR deficient human tumor cells arrested
normally in G2, but were released earlier than MMR proficient cells [31] [55].
Theoretically, since most mitotic recombination occurs in G2 phase, the shortened
G2 phase checkpoint caused by an earlier release in JR-exposed Mihi null cells
would have led to decreased mitotic recombination because there would be less
time for the recombination pathways to be initiated and resolved. However I
observed a dramatic increase in mitotic recombination.
The results from my study suggest that, rather than interacting with IR-
activated cell checkpoint pathway, MMR proteins might be involved in DNA
repair pathways after JR-exposure. My research further suggests that MMR
proteins suppress a mitotic recombination pathway used to repair IR-caused DSBs
and thus shunt DSBs to be repaired through sister chromatic exchange and
nonhomologous end joining.
The above discussion shows that JR-exposure can change Mihi null cells with
microsatellite instability to cells with both microstallite and chromosomal
instability because of the greatly increased mitotic recombination caused by IR.
Both types of genomic instabilities could play a role in tumor suppressor gene
43
inactivation. Some suppressor genes may be more readily affected by one type of
genomic instability than the other because of the different gene sequence and
contexts. For example, in colorectal carcinogenesis chromosome instability was
shown to be involved in inactivation of tumor suppressor genes, such as APC,
p53, DCC, SMAD2, and SMAD4 1561. In contrast, microsatellite instability in
colorectal cancer is involved in inactivation of TGFJJRJI,
hMSH6, and BAX because they have mononucleotide runs
IGFIIR, hMSH3,
11571111581.
The range of
suppressor genes that could be inactivated by JR-exposure would be significantly
increased in cells with both types of instabilities, and this would increase
malignant potential in tumor cells. Moreover, microstatellite instability would
induce point mutations in the genome and lead to increased heterozyogous
mutations in cells, while chromosome instability resulting LOH would convert
heterozygous mutations to homozygous mutations. My observation of this cellular
change from microsatellite instability to both microsatellite and chromosome
instabilities without a decrease in cellular survival raises concern about the use of
IR in cancer treatment because a significant percentage of some tumors
commonly treated with JR are MMR deficient 1141.
My research may also suggest cautions about the additional adverse effects of
other mutagens in MMR deficient mammals, such as the radiomimetic agent
bleomycin, which may induced double strand breaks, and thus may increase
mitotic recombination in Mi/il null cells and transform the cells to a more
malignant state.
Conclusion
Mismatch repair (MMR) proteins are involved in maintaining post replication
fidelity, recognition of DNA damage by ultraviolet radiation and DNA
methylating agents, and homologous recombination repair. Several articles have
also suggested that MMR proteins are also involved in JR-induced cellular
response by affecting cell cycle checkpoints. My graduate thesis work continues
the study of the role of MMR in the response to DNA damage by focusing on how
MMR proteins affect JR mutagenesis. J examined the frequency and spectra of
IR-induced autosomal mutations leading to loss of Aprt expression in a mouse
kidney cell line null for the Mihi gene. The increase of mutant frequency in Mihi
null cells after JR-exposure demonstrated a hypermutagenic response to JR
beyond the high spontaneous mutagenic trait of these cells. Mutational spectrum
analysis demonstrated that most of the response was due to the induction of
mitotic recombination. The high frequency induction of mitotic recombination
was not observed in a DNA repair proficient cell line or a cell line with an MMRindependent mutator phenotype. These results show that JR can induce mitotic
recombination in Mihi null cells and that the MLHJ protein plays an important
role in suppressing these induced events.
45
Bibliography
[1]
A.B. Buermeyer, S.M. Deschenes, S.M. Baker and R.M. Liskay
Mammalian DNA mismatch repair, Annu Rev Genet 33 (1999) 53 3-564.
[2]
B .D. Harfe and S. Jinks-Robertson DNA mismatch repair and genetic
instability, Annu Rev Genet 34(2000) 359-399.
[31
M.J. Schofield and P. Hsieh DNA mismatch repair: molecular
mechanisms and biological function, Annu Rev Microbiol 57 (2003) 579608.
[4]
J. Jiricny and M. Nystrom-Lahti Mismatch repair defects in cancer, Curr
Opin Genet Dev 10 (2000) 157-161.
[5]
C. Colussi, E. Parlanti, P. Degan, G. Aquilina, D. Barnes, P. Macpherson,
P. Karran, M. Crescenzi, E. Dogliotti and M. Bignami The mammalian
mismatch repair pathway removes DNA 8-oxodOMP incorporated from
the oxidized dNTP pool, Curr Biol 12 (2002) 9 12-918.
[6]
A. Mazurek, M. Berardini and R. Fishel Activation of human MutS
homologs by 8-oxo-guanine DNA damage, J Biol Chem 277 (2002) 82608266.
[7]
Y. Gu, A. Parker, T.M. Wilson, H. Bai, D.Y. Chang and A.L. Lu Human
MutY homolog, a DNA glycosylase involved in base excision repair,
physically and functionally interacts with mismatch repair proteins human
MutS homolog 2/human MutS homolog 6, J Biol Chem 277 (2002)
11135-11142.
[8]
T.T. Ni, G.T. Marsischky and R.D. Kolodner MSH2 and MSH6 are
required for removal of adenine misincorporated opposite 8-oxo-guanine
in S. cerevisiae, Mol Cell 4 (1999) 439-444.
[9]
P. Karran Mechanisms of tolerance to DNA damaging therapeutic drugs,
Carcinogenesis 22 (2001) 1931-1937.
[101
R. Fishel Signaling mismatch repair in cancer, Nat Med 5 (1999) 12391241.
[11]
L. Stojic, R. Brun and J. Jiricny Mismatch repair and DNA damage
signalling, DNA Repair (Amst) 3 (2004) 1091-1101.
[121
J.L. Argueso, J. Wanat, Z. Gemici and E. Alani Competing crossover
pathways act during meiosis in Saccharomyces cerevisiae, Genetics 168
(2004) 1805-1816.
[13]
N.K. Kolas and P.E. Cohen Novel and diverse functions of the DNA
mismatch repair family in mammalian meiosis and recombination,
Cytogenet Genome Res 107 (2004) 216-23 1.
[14]
J.A. Surtees, J.L. Argueso and E. Alani Mismatch repair proteins: key
regulators of genetic recombination, Cytogenet Genome Res 107 (2004)
146- 159.
[15]
J.L. Argueso, A.W. Kijas, S. Sarin, J. Heck, M. Waase and E. Alani
Systematic mutagenesis of the Saccharomyces cerevisiae MLH1 gene
reveals distinct roles for Mihip in meiotic crossing over and in vegetative
and meiotic mismatch repair, Mol Cell Biol 23 (2003) 873-886.
[161
I. Matic, M. Radman and C. Rayssiguier Structure of recombinants from
conjugational crosses between Escherichia coli donor and mismatch-repair
deficient Salmonella typhimurium recipients, Genetics 136 (1994) 17-26.
[17]
C. Rayssiguier, D.S. Thaler and M. Radman The barrier to recombination
between Escherichia coli and Salmonella typhimurium is disrupted in
mismatch-repair mutants, Nature 342 (1989) 396-401.
[18]
K. Myung, A. Datta, C. Chen and R.D. Kolodner SGS1, the
Saccharomyces cerevisiae homologue of BLM and WRN, suppresses
genome instability and homeologous recombination, Nat Genet 27 (2001)
113-116.
[191
G. Pedrazzi, C.Z. Bachrati, N. Selak, I. Studer, M. Petkovic, I.D. Hickson,
J. Jiricny and 1. Stagljar The Bloom's syndrome helicase interacts directly
with the human DNA mismatch repair protein hMSH6, Biol Chem 384
(2003) 1155-1164.
[201
G. Pedrazzi, C. Perrera, H. Blaser, P. Kuster, G. Marra, S.L. Davies, G.H.
Ryu, R. Freire, I.D. Hickson, J. Jiricny and I. Stagijar Direct association of
Bloom's syndrome gene product with the human mismatch repair protein
MLH1, Nucleic Acids Res 29 (2001) 4378-4386.
[211
K.D. Brown, A. Rathi, R. Kamath, D.I. Beardsley, Q. Zhan, J.L. Mannino
and R. Baskaran The mismatch repair system is required for S-phase
checkpoint activation, Nat Genet 33 (2003) 80-84.
47
[22]
A.J. Grosovsky, J.G. de Boer, PJ. de Jong, E.A. Drobetsky and B.W.
Glickman Base substitutions, frameshifts, and small deletions constitute
ionizing radiation-induced point mutations in mammalian cells, Proc Nat!
Acad Sci U S A 85 (1988) 185-188.
[23]
K. Sankaranarayanan Ionizing radiation, genetic risk estimation and
molecular biology: impact and inferences, Trends Genet 9 (1993) 79-84.
[241
A. Fujimori, A. Tachibana and K. Tatsumi Allelic losses in mutations at
the aprt locus of human lymphoblastoid cells, Mutat Res 269 (1992) 5562.
11251
M.S. Turker, M. Pieretti and S. Kumar Molecular evidence for the
induction of large interstitial deletions on mouse chromosome 8 by
ionizing radiation, Mutat Res 374 (1997) 201-208.
[261
C.Y. Li, D.W. Yandell and J.B. Little Molecular mechanisms of
spontaneous and induced loss of heterozygosity in human cells in vitro,
Somat Cell Mol Genet 18 (1992) 77-87.
[27]
C.Y. Bao, A.H. Ma, H.H. Evans, M.F. Horng, J. Mend, T.E. Hui and
W.D. Sedwick Molecular analysis of hypoxanthine
phosphoribosyltransferase gene deletions induced by alpha- and Xradiation in human lymphoblastoid cells, Mutat Res 326 (1995) 1-15.
[28]
M.B. Benjamin and J.B. Little X rays induce interallelic homologous
recombination at the human thymidine kinase gene, Mol Cell Biol 12
(1992) 2730-2738.
[29]
L. Liang, C. Shao, L. Deng, M.S. Mendonca, P.J. Stambrook and J.A.
Tischfield Radiation-induced genetic instability in vivo depends on p53
status, Mutat Res 502 (2002) 69-80.
[30]
X.S. Xu, L. Narayanan, B. Dunklee, R.M. Liskay and P.M. Glazer
Hypermutability to ionizing radiation in mismatch repair-deficient, Pms2
knockout mice, Cancer Res 61(2001) 3775-3780.
[311
T.W. Davis, C. Wilson-Van Patten, M. Meyers, K.A. Kunugi, S. Cuthill,
C. Reznikoff, C. Garces, C.R. Boland, T.J. Kinsella, R. Fishel and D.A.
Boothman Defective expression of the DNA mismatch repair protein,
MLH1, alters G2-M cell cycle checkpoint arrest following ionizing
radiation, Cancer Res 58 (1998) 767-778.
[32]
T. Yan, J.E. Schupp, H.S. Hwang, M.W. Wagner, S.E. Berry, S.
Strickfaden, M.L. Veigi, W.D. Sedwick, D.A. Boothman and T.J. Kinsella
Loss of DNA mismatch repair imparts defective cdc2 signaling and G(2)
arrest responses without altering survival after ionizing radiation, Cancer
Res 61(2001) 8290-8297.
[33]
A. Franchitto, P. Pichierri, R. Piergentili, M. Crescenzi, M. Bignami and
F. Palitti The mammalian mismatch repair protein MSH2 is required for
correct MRE1 1 and RAD5 1 relocalization and for efficient cell cycle
arrest induced by ionizing radiation in G2 phase, Oncogene 22 (2003)
2110-2120.
[34]
P. Cejka, L. Stojic, G. Marra and J. Jiricny Is mismatch repair really
required for ionizing radiation-induced DNA damage signaling?, Nat
Genet 36 (2004) 432-433; author reply 434.
[35]
C.Y. Shin, O.N. Ponomareva, L. Connolly and M.S. Turker A mouse
kidney cell line with a G:C --> C:G transversion mutator phenotype,
Mutat Res 503 (2002) 69-76.
[36]
J.A. Fritzell, L. Narayanan, S.M. Baker, C.E. Bronner, S.E. Andrew, T.A.
Prolla, A. Bradley, F.R. Jirik, R.M. Liskay and P.M. Glazer Role of DNA
mismatch repair in the cytotoxicity of ionizing radiation, Cancer Res 57
(1997) 5143-5147.
[37]
T.L. DeWeese, J.M. Shipman, N.A. Larrier, N.M. Buckley, L.R. Kidd,
J.D. Groopman, R.G. Cutler, H. te Riele and W.G. Nelson Mouse
embryonic stem cells carrying one or two defective Msh2 alleles respond
abnormally to oxidative stress inflicted by low-level radiation, Proc Nati
Acad Sci US A 95(1998)11915-11920.
[38]
E. Papouli, P. Cejka and J. Jiricny Dependence of the cytotoxicity of
DNA-damaging agents on the mismatch repair status of human cells,
Cancer Res 64 (2004) 3391-3394.
[39]
B.M. Gage, D. Alroy, C.Y. Shin, O.N. Ponomareva, S. Dhar, G.G.
Sharma, T.K. Pandita, M.J. Thayer and M.S. Turker Spontaneously
immortalized cell lines obtained from adult Atm null mice retain
sensitivity to ionizing radiation and exhibit a mutational pattern suggestive
of oxidative stress, Oncogene 20 (2001) 4291-4297.
[40]
C.Y. Shin, I. Mellon and M.S. Turker Multiple mutations are common at
mouse Aprt in genotoxin-exposed mismatch repair deficient cells,
Oncogene 21(2002)1768-1776.
[41]
K.M. Haigis and W.F. Dove A Robertsonian translocation suppresses a
somatic recombination pathway to loss of heterozygosity, Nat Genet 33
(2003) 33-39.
[42]
C. Shao, L. Deng, Y. Chen, R. Kucherlapati, P.J. Stambrook and J.A.
Tischfield Mihi mediates tissue-specific regulation of mitotic
recombination, Oncogene 23 (2004) 9017-9024.
[43]
A. Garcia-Bellido and F. Wandosell The effect of inversions on mitotic
recombination in Drosophila melanogaster, Mo! Gen Genet 161 (1978)
317-321.
[44]
C. Shao, P.J. Stambrook and J.A. Tischfield Mitotic recombination is
suppressed by chromosomal divergence in hybrids of distantly related
mouse strains, Nat Genet 28 (2001) 169-172.
[45]
L. Worth, Jr., T. Bader, J. Yang and S. Clark Role of MutS ATPase
activity in MutS,L-dependent block of in vitro strand transfer, J Biol
Chem 273 (1998) 23 176-23182.
[46]
L. Worth, Jr., S. Clark, M. Radman and P. Modrich Mismatch repair
proteins MutS and MutL inhibit RecA-catalyzed strand transfer between
diverged DNAs, Proc Nat! Acad Sci U S A 91(1994) 3238-3241.
[47]
A. Nicholson, M. Hendrix, S. Jinks-Robertson and G.F. Crouse Regulation
of mitotic homeologous recombination in yeast. Functions of mismatch
repair and nucleotide excision repair genes, Genetics 154 (2000) 133-146.
[48]
N. de Wind, M. Dekker, A. Berns, M. Radman and H. te Riele
Inactivation of the mouse Msh2 gene results in mismatch repair
deficiency, methylation tolerance, hyperrecombination, and predisposition
to cancer, Cell 82 (1995) 321-330.
149]
A. Abuin, H. Zhang and A. Bradley Genetic analysis of mouse embryonic
stem cells bearing Msh3 and Msh2 single and compound mutations, Mol
Cell Biol 20 (2000) 149-157.
[501
B. Elliott and M. Jasin Repair of double-strand breaks by homologous
recombination in mismatch repair-defective mammalian cells, Mo! Cell
Biol 21(2001) 2671-2682.
[511
F. Hutchinson Chemical changes induced in DNA by ionizing radiation,
Prog Nucleic Acid Res Mol Biol 32 (1985) 115-154.
L
50
[321
11531
11541
R.D. Johnson and M. Jasin Double-strand-break-induced homologous
recombination in mammalian cells, Biochem Soc Trans 29 (2001) 196201.
C. Allen, A. Kurimasa, M.A. Brenneman, D.J. Chen and J.A. Nickoloff
DNA-dependent protein kinase suppresses double-strand break-induced
and spontaneous homologous recombination, Proc Nati Acad Sci U S A
99 (2002) 3758-3763.
L.A. Bannister, B.C. Waidman and A.S. Waidman Modulation of errorprone double-strand break repair in mammalian chromosomes by DNA
mismatch repair protein Mihi, DNA Repair (Amst) 3 (2004) 465-474.
[55]
G. Aquilina, M. Crescenzi and M. Bignami Mismatch repair, G(2)IM cell
cycle arrest and lethality after DNA damage, Carcinogenesis 20 (1999)
2317-2326.
[56]
A. Goel, C.N. Arnold, D. Niedzwiecki, D.K. Chang, L. Ricciardiello, J.M.
Carethers, J.M. Dowell, L. Wasserman, C. Compton, R.J. Mayer, M.M.
Bertagnolli and C.R. Boland Characterization of sporadic colon cancer by
patterns of genomic instability, Cancer Res 63 (2003) 1608-1614.
11571
[58]
R. Parsons, L.L. Myeroff, B. Liu, J.K. Wilison, S.D. Markowitz, K.W.
Kinzler and B. Vogelstein Microsatellite instability and mutations of the
transforming growth factor beta type II receptor gene in colorectal cancer,
Cancer Res 55 (1995) 5548-5550.
J.R. Eshleman, G. Casey, M.E. Kochera, W.D. Sedwick, S.E. Swinler,
M.L. Veigi, J.K. Willson, S. Schwartz and S.D. Markowitz Chromosome
number and structure both are markedly stable in RER colorectal cancers
and are not destabilized by mutation of p53, Oncogene 17 (1998) 719-725.