Transgenic alfalfa : development and characterization
by Nancy KayBlake
A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in
Agronomy
Montana State University
© Copyright by Nancy KayBlake (1991)
Abstract:
Alfalfa (Medicago sativa L.) is the world's premier forage crop because of its nutritional quality,
performance and broad adaptation. Several problems exist in the production of alfalfa, including
disease and insect damage, herbicide sensitivity and limited nutritional quality.
Plant transformation (the introduction of foreign genes into a species) has been proposed as a potential
solution to each of these problems. One consideration in alfalfa transformation research which has not
been adequately addressed is the inheritance and expression stability of foreign genes in transgenic
alfalfa. This study is the initial phase of a project to examine this question.
Transgenic alfalfa plants were generated and characterized prior to the initiation of crossing studies.
In particular, the usefulness of polymerase chain reaction sequence amplification (PCR) in
characterizing transgenic alfalfa was examined.
Three Montana-adapted alfalfa cultivars were transformed using Agrobacterium-mediated
transformation.
The transformation vector used contained two linked genes: the NPT II gene conferring kanamycin
resistance and the GUS gene, a commonly used expression reporter gene. Contrary to expectations,
22% of the transgenic alfalfa plants failed to integrate the GUS gene into their genomes although they
did integrate the NPT II gene. Further, 29% of the transgenic alfalfa plants which contained GUS gene
failed to express it. This data was based on Southern blot analysis but similar results were obtained
using the more rapid PCR method.
The GUS reporter gene system functions in transgenic alfalfa and provides a rapid way to score
progeny. PCR also promises to be useful in the continuing inheritance studies of these transgenic
alfalfa. TRANSGENIC ALFALFA: DEVELOPMENT AND CHARACTERIZATION
by
Nancy Kay Blake
A thesis submitted in partial fulfillment
of the requirements for the degree
of
Master of Science
in
Agronomy
MONTANA STATE UNIVERSITY
Bozeman, Montana
August 1991
ii
APPROVAL
of a thesis submitted by
Nancy Kay Blake
This thesis has been read by each member of the thesis
committee and has been found to be satisfactory regarding
content, English usage, format, citations, bibliographic
style, and consistency, and is ready for submission to the
College of Graduate Studies.
Date
Chairperson, '"Graduate Committee
Approved for the Major Department
Head, 'Major Dep^yrffent
Date
Approved for the College of Graduate Studies
/ar; /ff/
Date
<7
Graduate t)ean
iii
STATEMENT OF PERMISSION TO USE
In presenting this thesis in partial fulfillment of the
requirements for a master's degree at Montana State
University, I agree that the Library shall make it available
to borrowers under rules of the Library. Brief quotations
from this thesis are allowable without special permission,
provided that accurate acknowledgment of source is made.
Permission for extensive quotation from or reproduction
of this thesis may be granted by my major professor, or in
his absence, by the Dean of Libraries when, in the opinion
of either, the proposed use of the material is for scholarly
purposes. Any copying or use of the material in this thesis
for financial gain shall not be allowed without my written
permission.
Signature
Date
AjQ/n£M_ k?, SX oJQJL^____________
I
iv
ACKNOWLEDGMENTS
I
wish to thank Drs. Ray Ditterline and Rich Stout for
their guidance and encouragement throughout the course of my
graduate study.
Thanks are extended to Pioneer Hi-Bred
International, Inc. for their generous financial support for
this research.
Special thanks and acknowledgment go to my husband,
Tom, and son, Robin.
Without their patience and support
many meals would have gone unprepared and the house
uhvacuumed.
V
TABLE OF CONTENTS
Page
LIST OF TABLES......................................... vii
LIST OF FIGURES....................................... viii
ABSTRACT................................................ ix
INTRODUCTION..................
I
LITERATURE REVIEW..................
3
CO
Alfalfa Genetics..........................
Tissue Culture of Alfalfa..*..............
Agrobacterium tumefaciens..................
Agrobacterium-mediated. Plant Transformation
/3-Glucuronidase Reporter Gene System............... 12
Polymerase Chain Reaction.......................... 15
VO CTl
EXPERIMENTAL PROCEDURES................................. 17
Plant Material.................
17
Plant Transformation............................... 17
DNA Extraction..................................... 19
Polymerase Chain Reaction.......................... 19
Southern Blot Analysis.........
20
GUS Histological Assay...........
21
NPT II Expression Assay.... ........................ 22
Pollen. Germination^.......
...22
Chromosome Counts.................................. 23
Crosses..........
23
RESULTS AND DISCUSSION.................................. 24
Plant Regeneration........
GUS Expression.....................................
NPT II Expression............
Southern Blot Analysis............
Polymerase Chain Reaction..........................
Fertility and Chromosome Studies...................
Progeny Study......................................
24
25
26
27
32
37
38
vi
TABLE OF CONTENTS— Continued
Page
SUMMARY........................
40
REFERENCES CITED........................................ 42
APPENDIX...............
50
vii
LIST OF TABLES
Table
Page
1
Genotypes regenerated within alfalfa cultivars
after Agrobacterium-mediated transformation........ 24
2
Percentage of transgenic alfalfa plants which are
derived from independent transformation events..... 27
3
The presence and expression of the NPT II and GUS
genes in transgenic alfalfa..............
30
4
A comparison of Southern blots and PCR for
detection of the NPT II and GUS genes.............. 36
5
Genetic ratios of the GUS gene in Fl progeny
determined by PCR and GUS expression assay......... 38
6
Pollen germination of control and transgenic
alfalfa............................................ 51
viii
LIST OF FIGURES
Figure
Page
1
Southern blot of FindIII digested genomic DNA of
transgenic and controlalfalfa plants................ 29
2
Estimation of copy number of NPT II gene in
transgenic alfalfaplants........................... 31
3
Agarose gel and Southern blot of PCR amplified
fragments.......................................... 34
ix
ABSTRACT
Alfalfa (Medicago sativa L.) is the world's premier
forage crop because of its nutritional quality, performance
and broad adaptation. Several problems exist in the
production of alfalfa, including disease and insect damage,
herbicide sensitivity and limited nutritional quality.
Plant transformation (the introduction of foreign genes into
a species) has been proposed as a potential solution to each
of these problems. One consideration in alfalfa
transformation research which has not been adequately
addressed is the inheritance and expression stability of
foreign genes in transgenic alfalfa. This study is the
initial phase of a project to examine this question.
Transgenic alfalfa plants were generated and
characterized prior to the initiation of crossing studies.
In particular, the usefulness of polymerase chain reaction
sequence amplification (PCR) in characterizing transgenic
alfalfa was examined.
Three Montana-adapted alfalfa cultivars were
transformed using Agrobacterium-mediated transformation.
The transformation vector used contained two linked genes:
the NPT II gene conferring kanamycin resistance and the GUS
gene, a commonly used expression reporter gene. Contrary to
expectations, 22% of the transgenic alfalfa plants failed to
integrate the GUS gene into their genomes although they did
integrate the NPT II gene. Further, 29% of the transgenic
alfalfa plants which contained GUS gene failed to express
it. This data was based on Southern blot analysis but
similar results were obtained using the more rapid PCR
method.
The GUS reporter gene system functions in transgenic
alfalfa and provides a rapid way to score progeny. PCR also
promises to be useful in the continuing inheritance studies
of these transgenic alfalfa.
I
INTRODUCTION
Alfalfa, Medicago sativa L., is the premier forage crop
in the world because of its wide adaptation, high yield and
superior nutritional quality. It is grown on approximately
32 million ha in the world, about 12 million ha of which are
in North America (Hill 1987).
Like any major crop, however,
there are some problems associated with alfalfa cultivation
and utilization.
Among these are disease, insect damage,
herbicide sensitivity, and undesirable nutritional factors.
Many problems are being addressed by classical breeding
methods.
However, attention has recently been focused on
plant transformation as a means of moving foreign genes into
alfalfa, which would otherwise not be possible using
traditional methods.
These include genes for disease
resistance, herbicide resistance, condensed tannin
production, and insect resistance.
An essential component of a successful plant
transformation project using Agrobacterium tumefaciens is
the ability to grow the plant in culture and regenerate
whole plants.
Alfalfa tissue culture, including
regeneration, has been possible for more than a decade.
Alfalfa genotypes with high regenerability were selected and
have been used extensively.
However, these genotypes are
2
poor agroriomically and would be undesirable in a breeding
project.
It is desirable to be able to transform and
regenerate alfalfa which is already agronomically adapted.
A second consideration in a long-term transformation
project is identifying and characterizing transformed plants
as well as determining the inheritance and stability of the
introduced genes through several generations.
While assays
for gene expression are useful for this purpose, it is also
necessary to have a method for screening for the specific
gene in the plant genome.
Southern blots have permitted the
accurate identification o^ plants containing introduced
genes for over a decade (Thomashow et al. 1980).
Polymerase
chain reaction (PCR) sequence amplification (Sakai et al.
1988) provides an alternative technique which is more rapid
and possibly more efficient at determining which plants
contain accurately integrated target genes.
undertaken to answer two questions.
This study was
First, is it possible
to create transgenic plants from alfalfa cultivars
agronomicalIy adapted to Montana?
Second, can PCR be used
as a replacement for Southern blot analysis to evaluate
transgenic alfalfa and its progeny?
3
LITERATURE REVIEW
Alfalfa Genetics
Cultivated alfalfa is an autotetraploid, 2n = 4x = 32,
with tetrasomic inheritance (Stanford 1951).
The alfalfa
In = lx haploid genome is 1.0 x IO9 base pairs (bp), with
22% highly repetitive, 42% mid repetitive, and 36% single
copy sequences (Winicov et al. 1988).
Compared to other
plant species, e.g., Arabidopsis thaliana L. (7 x IO7 bp)
and Vicia faba L. (4.4 x IO10 bp), this is an average genome
size (Blake and Kleinhofs 1988).
Alfalfa is a naturally cross-pollinating crop.
Alfalfa
plants exhibit self-incompatibility to a greater or lesser
degree, making production of selfed seed difficult.
Alfalfa
can usually be clonally propagated by stem cuttings,
allowing the production of identical plants for genetic
studies.
Alfalfa cultivars are heterogeneous populations,
because of alfalfa's cross-pollinating nature.
As with
other cross pollinated crops, alfalfa exhibits inbreeding
depression, resulting in yield and vigor loss.
Heterosis,
the opposite of inbreeding depression, is the aim in the
creation of new alfalfa cultivars.
Heterosis is the
4
postulated consequence of maximum heterozygosity in a
polyploid species (Bingham 1980).
To approximate the state
of maximum heterozygosity, the breeder must create the
population from unrelated parents.
The greater the number
of unrelated parents within the initial population, the
greater the heterozygosity (Hill 1987) .
Another pertinent
characteristic of alfalfa genetics is its tetrasomic
inheritance.
Consequences of tetrasomic inheritance include
a slower change in gene frequency under selection, the
masking of recessive alleles and difficulty in obtaining
populations uniform for dominant alleles.
Heterosis and tetrasomic inheritance pose a problem for
the successful introduction of a novel gene into a new
alfalfa cultivar.
It is not possible to modify a single
plant and create a cultivar from it alone as in selfpollinated species.
In alfalfa it is most desirable to
start with several unrelated parents each with the novel
gene as the initial population in creating a new cultivar.
Alfalfa Tissue Culture
Alfalfa tissue culture work began in the 1970's with
Saunders and Bingham (1972) developing the first system to
take alfalfa from callus through regeneration into a whole
plant.
Through selection, Bingham et al. (1975) developed
an alfalfa germplasm, Regen S, which had enhanced capability
for regeneration.
Other researchers, (Walker et al. 1978,
5
1979, Walker and Sato 1981, Stuart ,and Strickland 1984ab)
have refined the media and conditions for regeneration and
expanded the number of alfalfa germplasms which,have been
successfully regenerated.
Alfalfa has been regenerated from
callus derived from immature anthers, immature ovaries,
hypocotyl, internodes, stem, petiole, sepal, petal and leaf
(Bingham et al. 1988).
Alfalfa protoplasts have also been
regenerated into whole plants (Kao and Michayluk 1980,
Johnson et al. 1981).
Based on this accumulated research, a consensus
protocol for alfalfa culture and regeneration has developed.
Callus formation is promoted by auxin-cytokinin media.
Somatic embryogenesis induction is triggered by a short (3-4
day) pulse of high concentration 2,4-D (2,4-dichlorophenoxyacetic acid), low concentration kinetin exposure, followed
by growth on media with high reduced nitrogen, proline and
no hormones (McCoy and Walker 1984, Stuart and Strickland
1984ab).
After shoot formation, growth on basal media
promotes root formation.
Regeneration is by somatic
embryogenesis not organogenesis (Stuart et al. 1985).
Variations on this protocol abound and usually reflect the
use of different alfalfa cultivars.
Studies on the inheritance of regeneration capability
have found it to be controlled by two dominant genes in
diploid alfalfa (Reisch and Bingham 1980).
Wan et al.
(1988) also found two dominant genes in tetraploid alfalfa.
6
Allelism tests have not been done to determine if the genes
controlling regeneration are the same in diploid and
tetraploid alfalfa.
Variation for regenerability in alfalfa has been
observed and falls into three categories.
The first is
variation among genotypes within a cultivar.
In a review
article, Bingham et al. (1988) stated that approximately 10%
of the genotypes within a cultivar have regeneration
capability.
The second type is variation among cultivars.
Brown and Atassnov (1985) tested 76 alfalfa cultivars,
representing the nine alfalfa germplasm sources, for
embryogenesis and regenerability.
They found significant
differences among cultivars and that the best regenerating
cultivars had a genetic background which included 1Ladak'
and Medicago falcata L., a close diploid relative of M.
sativa.
The third category of variation is the interaction
between genotype and culture media.
Seitz Kris and Bingham
(1988) reported statistically significant interaction among
genotypes of two unrelated alfalfa cultivars and culture
media in regeneration ability.
Chen et al. (1987) tested
three alfalfa cultivars with six media regimens.
They found
genotype x medium interaction both for somatic embryogenesis
and regeneration.
Aorobacterium tumefaciens
Agrobacterium tumefaciens is a gram negative bacteria,
7
which is pathogenic on many dicotyledonous plant species.
It causes crown gall disease characterized by the formation
of a tumorous mass at the infection site.
Infection is
through wounds in plant tissue, generally the stem.
The molecular mechanism of Agrobacterium tumefaciens
infection of plants has been extensively studied.
Agrobacterium tumefaciens contains a 200 kilobases (kb)
plasmid called the Ti plasmid.
DNA termed the T-DNA.
This plasmid has a region of
T-DNA is delineated by 25 base pair
(bp) direct repeat sequences on the left and right borders
which are required for T^DNA transfer.
T-DNA is transferred
from the bacteria to the plant, where it is incorporated
into the plant cell's nuclear genome.
Once incorporated,
genes in the T-DNA are expressed by the plant.
These genes
are involved in the synthesis of phytohormones, the auxin,
indoleacetic acid and the cytokinin, isopentyl adenosine
(Klee et al. 1987), which lead to tumor formation in
infected plant tissue.
Transfer of the T-DNA to the plant cell is controlled
by six virulence (vir) genes encompassing 35 kb of the Ti
plasmid but not within the T-DNA borders." The vir genes are
inducible by bacterial exposure to plant cell exudates,
hence the requirement for wounded plant tissue.
The
induction process takes 8-16 hours (Stachel et al. 1985) .
The vir gene proteins act in trans to catalyze T-DNA
movement.
Protein products of virD nick the T-DNA borders.
8
The nicked bottom strand unwinds, giving rise to a linear
single strand T-strand.
Repair and polymerase enzymes
replace the bottom T-DNA strand.
The T-strand is postulated
to be the intermediate transfer molecule, with transfer into
the plant cell being similar to bacterial conjugation
(Zambryski et al. 1988).
Once the T-DNA is transferred into the plant cell,
integration into the nuclear genome must occur.
is known about this process.
Very little
T-DNA integration into the
genome appears to be at random, except the sites are
enriched for adenine and thymine.
Multiple T-DNA copies are
postulated to occur after T-DNA transfer, as there is no
evidence of multiple transferable T-DNA1s in Agrobacterium
(Zambryski et al. 1988).
Multiple integration can occur
either in tandem array or unlinked at different chromosomal
locations.
The tandem arrays can be direct or indirect
repeats but are usually expressed as a single, dominant
Mendelian trait (Jorgenson et al. 1987).
Multiple
insertions into different chromosomal locations can lead to
distinct genes which segregate in the F1 generation.
There
is no apparent correlation between the copy number and
expression level.
Rather, variation in expression is
affected by chromosomal location, termed position effect
(Jones et al. 1987).
Integration of T-DNA into the plant genome is an
efficient process when compared to other DNA insertion
9
methods into eukaryotic genomes (Gheysen et al. 1987).
Despite the efficiency of T-DNA integration, deletions and
rearrangements may occur, particularly near the border
sequences (Jones et al. 1987, Spielmann and Simpson 1986).
One detailed study (Deroles and Gardner 1988b) showed the
loss of one or the other chimeric gene, where two genes were
present in the original T-DNA.
Foreign genes can undergo
rearrangements, including truncation, deletions, or
tandemization, leading to loss of function (Weising et al.
1988) .
These rearrangements appear to occur during the
integration process since after integration, foreign gene
stability is generally maintained through meiosis (Deroles
and Gardner 1988a).
Acrrobacterium-mediated Plant Transformation
Agrobacterium tumefaciens' ability to transfer DNA into
plant cells and the subsequent incorporation of that DNA
into the plant genome makes it a near ideal candidate as a
plant transformation vector.
Researchers began to
experiment with Agrobacterium strains, in 1980, to
incorporate foreign genes into plant cells (Hernalsteens et
al. 1980).
The initial problem with Agrobacterium vectors
was that phytohormone synthesis genes, which cause tumor
formation, were incorporated along with the desired foreign
DNA.
This resulted in plant tissue which grew as callus but
failed to regenerate into whole plants.
The genes necessary
10
to transfer the T-DNA were located on the Ti plasmid but not
within the T-DNA borders.
Bevan et al. (1983) demonstrated
that any DNA within the T-DNA borders can be transferred and
that the phytohormone synthesis genes are not necessary.
This lead to the creation of 1disarmed1 Agrobacterium
strains.
The hormone genes of the Ti plasmid are removed by
homologous recombination leaving an Agrobacterium incapable
of causing tumor formation.
Often the entire T-DNA is
removed from Agrobacterium strains for use with binary
vectors (Ooms et al. 1981).
In 1983, Hoekema et al. proposed the use of a binary
vector system and Sevan published the first report of a
binary Agrobacterium vector in 1984.
This vector separates
the virulence region and the T-DNA 25 bp borders onto two
plasmids.
The vir region, because of its size, is left on
the Ti plasmid (of a disarmed strain) and the T-DNA borders
are placed on a smaller, autonomously replicating plasmid,
which is easier to manipulate.
This vector plasmid contains
the origin of replication of a broad host-range plasmid
allowing autonomous replication in Agrobacterium.
In
addition to the 25 bp border repeats necessary for T-DNA
transfer, there is an enhancer element, 1overdrive1, which
stimulates transfer (Peralta et al. 1986).
Many binary
vectors now incorporate the overdrive enhancer as well as
the T-DNA borders, though the older vectors function
adequately without it.
11
Within the binary vector *s T-DNA borders there is a
selectable marker gene as well as the other genes being
transferred into the plant.
The selectable marker gene
(e.g., antibiotic resistance gene) is used in plant
transformation to select potentially transformed call! from
untransformed calli.
Plant material without resistance is
killed or growth is arrested in the presence of the
antibiotic.
Selectable genes used in plant transformation
studies include: neomycin phosphotransferase type II (NPT
II) conferring kanamycin and G418 resistance; another
bacterial phosphotransferase conferring hygromycin
resistance, the mutant dihydrofolate reductase enzyme
conferring methotrexate resistance; and
herbicide
resistance genes for chlorsulfuron, biapholos,
phosphinothricin and glyphosate (Klee et al. 1987, Weising
et al. 1988).
These genes are placed into the T-DNA by triparental
mating (Ditta et al. 1980).
The genes to be transferred are
placed on a Escherichia coll plasmid and maintained in an E.
coll strain.
It can then be moved into the disarmed
Agrobacterium strain with the help of a second E. coll
strain containing a RK2 plasmid which facilitates wide
matings among bacteria.
Using appropriate antibiotic
selection media, the Agrobacterium cells which contain the
new plasmid can be preferentially selected.
This new strain
can be used as the vector in plant transformation studies.
12
Cocultivation of Agrobacterium with regenerating
protoplasts was the original method of Agrobacterium
transformation (Marton et al. 1979).
However, many plant
species are not easily regenerable from protoplasts.
For
these species, the leaf disc or explant method is preferred
(Horsch et al. 1985).
Sterile explants are cocultured for
2-3 days with Agrobacterium.
Usually a nurse cell culture
is included to increase induction of the virulence genes.
Agrobacterium tumefaciens has been used to transform many
plant species, including tobacco (Nicotiana tabacum L.),
tomato (Lycopersicum esculentum Mill), Arapidopsis thaliana,
and Brassica napus L. (Klee et al. 1987).
Agrobacterium
tumorigenesis in Medicago sativa was first performed by
Mariotti et al. (1984) , demonstrating that T-DNA could be
transferred and expressed in alfalfa.
Agrobacterium-
mediated transformation of alfalfa and its close relatives
has previously been reported (Schreier et al. 1985, Deak et
al. 1986, Shanin et al. 1986, Chabaud et al. 1988, Halk et
al. 1989, D 1Halluin et al. 1990,
McCoy pers. comm.) with
the introduction of kanamycin resistance, alfalfa mosaic
virus resistance, hygromycin resistance, herbicide
resistance, and proteinase inhibitor genes.
6-Glucuronidase Reporter Gene System
A reporter gene, also termed a scorable gene, allows
identification of those plants which have incorporated the
13
foreign gene into their genome and are expressing the gene.
This should be distinguished from a selectable marker gene,
although it is possible for the selectable gene to also
function as the reporter gene.
Reporter genes used in plant transformation have
included octopine synthase and nopaline synthase, encoded on
the T-DNA, chloramphenicol acetyltransferase, neomycin
phosphotransferase type II, and both bacterial and firefly
luciferase (Weising et al. 1988).
One of the more recent
reporter genes is the /3-glucuronidase (uidA) gene of E.
coll.
Jefferson et al. (1986) cloned uidA from E. coli and
fused it to plant promoter sequences which allow for its
expression in plants.
j0-glucuronidase is an acid hydrolase enzyme which
cleaves /3-glucuronides at the /3-linkage between glucuronic
acid and the R group.
When a glucuronide substrate with an
indoxyl group is cleaved, the indoxyl dimerizes to indigo
which is insoluble in aqueous solution.
Tissue expressing
glucuronidase activity is marked.by blue staining in the
cells.
Jefferson et al. (1987) assayed tissues of several
plant species: wheat (Triticum aestivum L.), tobacco,
tomato, potato (Solanum tuberosum L.), Brassica napus, and
Arabidopsis thaliana.
They found no detectable endogenous
/3-glucuronidase activity in any of these species.
/3-glucuronidase (GUS) has been transformed into several
plant species including tobacco, tomato, potato, and rice
14
(Oryza sativa L.), with concomitant expression (Jefferson et
al. 1987, Plegt and Bino 1989, Terada and Shimamato 1990).
It was originally thought that, fused to the CaMV35S
promoter, /3-glucuronidase would be constitutively expressed.
However further studies have shown the CaMV35S is not a
constitutive promoter in plants and GUS expression is found
in specific locations, such as the phloem tissue around the
vascular ring, parenchyma cells in the cortex and trichomes
on the epidermis (Jefferson et al. 1987, Williamson et al.
1989) .
Plegt and Bino (1989) found endogenous GUS activity
in the mature pollen of untransformed plants with binucleate
pollen.
Conversely, plants with trinucleate pollen exhibit
no endogenous GUS activity.
This renders the GUS assay of
pollen from transformed plants useless for species with
binucleate pollen, such as alfalfa.
The GUS assays are easy and versatile.
Several
substrates may be used, allowing histochemical,
spectrometric and fluorometric assays.
The histochemical
assay is useful both as a qualitative assay and to localize
expression.
It works well for screening many plants or
calli, requiring only a small tissue sample and leaving most
of the plant or callus intact.
Fluorometric assays are very
sensitive and allow for expression quantification (Jefferson
et al. 1987).
15
Polymerase Chain Reaction
Polymerase chain reaction (PCR) amplifies distinct DNA
sequences.
As originally described (Saiki et al. 1985,
Mullis and Faloona 1987), it used the E. coli DNA polymerase
I - Klenow fragment.
This enzyme denatures at the high
temperatures necessary for the reaction.
Fresh enzyme had
to be added throughout the 4-5 hour reaction and limited the
utility of PCR.
Using the DNA polymerase from Thermus
aquaticus, Taq polymerase,
(Saiki et al. 1988) has made PCR
a practical and extremely useful technique for molecular
biology.
The temperature optimum for DNA synthesis using
Taq polymerase is 75-80°C, and the enzyme can repeatedly
withstand temperatures of 94-95°C without denaturing
(Gelfand 1989).
These enzyme properties allow repeated
cycles of DNA denaturation, annealing and replication,
leading to the amplification of specific DNA sequences.
Starting with nanogram amounts of genomic DNA, a single copy
gene can be amplified sufficiently to be visualized on an
agarose gel.
A pair of oligonucleotide primers complementary to the
right and left border are needed to target a specific DNA
sequence.
Genomic sequences of up to 3 kb have been
successfully amplified (Saiki 1990).
DNA is first denatured
at 94-95°C, then cooled to 40-60°C to allow the primers to
anneal to the target sequence, and finally heated to 70-75°C
for the Taq polymerase to synthesize copies of the target
16
sequence.
This process is repeated 30-40 times, leading to
a geometric increase in the copies of the target sequence.
A variation on the standard PCR protocol, simultaneous
or multiplex amplification, has been used in a variety of
applications.
Primer sets specific for two or more
fragments of distinguishable sizes are used in one reaction
mixture.
Up to nine primer sets, amplifying nine distinct
fragments have been used in a single PCR (Chamberlain et al.
1988).
Lassner et al. (1989) proposed simultaneous PCR as a
means of rapid screening of transgenic plants.
17
EXPERIMENTAL PROCEDURES
Plant Material
Alfalfa cultivars 'Spredor II1, 'Ladak 651 and
1Rangelander1 and a Pale leafed germplasm developed from
Ladak 65 are well adapted to Montana and were used for
transformation studies.
Transformation experiments were
performed on identified, individual plants within each
cultivar.
Parents in each cultivar were normal,
unregenerated plants with the exception of two untransformed
regenerated Pale plants.
Plant Transformation
The Agrobacterium binary vector, pBI121, containing the
CaMV35S-GUS fusion gene linked to the Nos-NPT II gene
(Jefferson et al. 1987; obtained from Clontech, Inc.) was
the transformation vector.
It was mobilized into the
disarmed Agrobacterium tumefaciens strain LBA4404 (Corns et
al. 1981) by a triparental mating between LBA4404, the E.
coli strain HBlOl with pBI121 and HBlOl with the helper
plasmid RK2013 (Bevan 1984, Ditta et al. 1980).
Alfalfa
transformation followed the explant method of Horsch et al.
(1985), using young stem sections as explants.
Explants
18
were sterilized in 10% bleach (5.25% sodium hypochlorite),
0.1% SDS (sodium dodecylsulfate) for 15 minutes with
stirring, rinsed three times with sterile water for 30
seconds with stirring, rinsed once with 95% ethanol for 10
seconds and then rinsed twice with sterile water.
Stem
sections were then cut into 2-3 mm lengths and inoculated
for five minutes with LBA4404/pBI121 grown in TY media
(White and Greenwood 1987) supplemented with 25 mg/L
streptomycin and 50 mg/L kanamycin and diluted to 5 x IO7
cells/ml.
Explants were cocultivated for two days on MS
media (Sigma M 5524 MS Basal Salt Mixture and N 0390 Nitsch
and Nitsch vitamin mixture) supplemented with 9 /liM 2,4-D and
1.1 /iM benzyl-amino purine (BAP) with the surface of the
media covered with sterile filter paper.
Selection of
transformed callus was on the same media supplemented with
50 mg/L kanamycin and 300 mg/L carbenicillin.
The kanamycin
selection killed all uhtransformed callus within eight
weeks.
Whole plant regeneration from selected calli followed
the protocol of Redenbaugh et al. (1986).
Callus was placed
on SH media (Sigma S 6765 Basal Salt Mixture and N 0390
Nitsch and Nitsch vitamin mixture) supplemented with 50 juM
2,4-D and 5 juM kinetin for a 3-4 day induction period.
It
was transferred to hormone-free SH media supplemented with
25 mM ammonium nitrate and 50 mM proline for embryogenesis.
Embryos usually developed in 4-6 weeks.
Embryos were
19
converted to whole plants on half-strength SH media
supplemented with 25 /zM gibberellic acid (GA3) and
0.25 /zM NAA (a-naphthalene-acetic acid).
Kanamycin was not
included in the regeneration media as it retarded
regeneration.
Whole plants were regenerated 4-6 months
after the initial inoculation with Agrobacterium.
DNA Extraction
Tissue was collected from mature plants which had been
cut back and allowed to regrow at least once prior to
collection.
DNA was extracted from plants as described by
Lassner et al. (1989).
Generally a minimum of 50 mg leaf
tissue was ground with extraction buffer heated to 65°C and
2 g sand in a mortar and pestle.
For PCR analysis of Fl
progeny, DNA was extracted from a single trifoliolate leaf.
The sample was ground in a microfuge tube, using a glass
rod, with heated extraction buffer and 100 mg sand and
processed the same as for larger extractions.
Polymerase Chain Reaction
Amplification by PCR was performed according to
manufacturer's instructions using Perkin Elmer/Cetus
(Norwalk, CT) AmpliTaq Recombinant Taq DNA polymerase.
The
NPT II primers GAACAAGATGGATTGCACGC and GAAGAACTCGTCAAGAAGGC
border a 785 bp DNA fragment from the NPT II gene
(nucleotides 157 to 942 according to Beck et al. 1982).
The
20
GUS primers ACGTCCTGTAGAAACCCCAA and CCCGCTTCGAAACCAATGCC
border a 1097 bp DNA fragment from the GUS gene (nucleotides
23 to 1120 according to Jefferson et al. 1986).
Reactions
were performed using 10-20 ng plant DNA or 0.01 ng pBI121
DNA in 25 fil volumes.
DNA concentration was determined by
ethidium bromide fluorescence in an agarose gel.
Samples
were heated to 94°C 10 min, followed by 3,0 cycles of 94°C
I min, 50°C I min, 72°C 3 min, with a final extension step
of 72°C 7 min in a Coy tempcycler (Model #50, Coy Laboratory
Products, Inc., Ann Arbor, MI).
Simultaneous amplification
using NPT II and GUS primers was performed as described by
Lassner et al. (1989).
Southern Blot Analysis
Southern blot analysis was of two types: genomic blots
and PCR blots.
For genomic blots, five micrograms genomic
DNA were digested with restriction enzymes according to
manufacturer's directions, electrophoresed on 0.8% agarose
gel, and blotted to Zetaprobe nylon membrane (BioRad) using
the alkaline transfer method of Reed and Mann (1985).
The
membranes were hybridized with probes radioactively labeled
using BRL Random Primers DNA Labeling System according to
manufacturer's directions.
Radioactive probes were purified
using the BioRad Prep-a-Gene Kit according to manufacturer's
directions.
Hybridization followed the protocol of
Sambrook et al. (1990) at 65°C in a Robbins Scientific
21
hybridization incubator.
DNA double digested with
SstI/SphXl was probed with pBI121 linearized with SstI to
verify incorporation of the T-DNA.
DNA digested with ScoRl
or Hind III was probed with the 3 kb Sstl/SphI GUS fragment
and the 1.7 kb SphX NPT II- fragment of pBI121, corresponding
to the CaMV35S-GUS gene and a portion of the NPT II gene
.
I*
respectively, for copy number determination and verification
of insertion of both genes.
Blots of PCR gels were made from amplified samples
electrophoresed on a 1.4% agarose gel and blotted to
Zetaprobe.
The 3 kb SstX/SphX fragment and
1.7 kb SphX
fragment, described above, were used as probes.
were labeled and purified as described above.
Fragments
Each PCR blot
was probed first with the 3 kb SstX/SphX fragment and then
with the 1.7 kb SphX fragment, with the probe being removed
from the filter after the first hybridization as described
by Sambrook et al. (1989).
GUS Histological Assay
/3-glucuronidase expression was qualitatively assayed
using the procedure of Jefferson et al. (1987).
Hand
sectioned tissue was stained with 2 mM X-gluc
(5-bromo-4-chloro-3-indolyl-j0-D-glucuronide) in 0.1 M NaPO4
buffer pH 7, 0.5 mM potassium ferricyanide, 0.5 mM potassium
ferrocyanide, 0.01 M NaEDTA overnight at 37°C.
Tissue
sections were then placed in 95% ethanol to remove plant
22
pigments which interfere with seeing the stain.
Pollen was
stained according to Plegt and Bino (1989) with I mM X-gluc
in 50 mM NaPO4 buffer pH 7, 10% sucrose, 50 mg/L boric acid
overnight at room temperature.
NPT II Expression
Expression of the NPT II gene, measured as kanamycin
resistance, in regenerated putative transgenic plants and
their progeny was determined as described by De Block et al.
(1989).
Sterile explants (usually 5-10 leaf and stem
pieces) from an individual plant were placed on the
callusing media described previously and supplemented with
50 mg/L kanamycin.
The explants were grown for four weeks
under previously described conditions.
Callus from each
explant was subdivided and transferred to fresh media for an
additional 2-3 weeks.
Each callus was then scored as
either: green, actively growing or brown, non-growing.
The
green, growing callus indicated the expression of kanamycin
resistance.
Pollen Germination
Male fertility of transformed plants and progeny was
determined by germinating fresh pollen in 10% sucrose,
50 mg/L boric acid for three hours and then staining with
acetocarmine.
Pollen was scored as sterile (nongerminating)
if pollen tube length was less than the diameter of the
23
pollen grain.
Germination percentage was compared to pollen
from untransformed plants.
Chromosome Counts
Mitotic chromosome counts on transgenic plants
were
performed as described by Blake and Bingham (1986).
■Crosses
Transgenic plants were used as female parents in
crosses to wild type alfalfa and as male parents in crosses
to male sterile alfalfa.
greenhouse conditions.
genetic ratios.
Hand crosses were made under
Chi-square test was used to test
24
RESULTS AND DISCUSSION
Plant Regeneration
Genotypes within Ladak-65, Spredor II7 Rangelander and
Pale were inoculated with the Agrobacterium binary vector
pBI121.
Approximately 20% of the inoculated genotypes were
regenerated into putative transgenic plants (Table I).
This surpasses the published average regeneration capability
(Bingham et al. 1988).
However, creeping rooted cultivars,
including Ladak7 Spredor II7 and Rangelander7 have been
identified as having greater than average regeneration
capability (Bingham et al. 1988).
Ladak and Rangelander
have been regenerated previously, but this, is the first
report of regeneration of Spredor II.
Table I. Genotypes regenerated .within alfalfa cultivars
after Agrobacterium-Taediated transformation.
Cultivar
Ladak 65
Spredor II
Rangelander
# Genotypes
Inoculated
# Genotypes
Regenerated
67
30
26
9
6
8
% Regeneration
13.4
20
30.8
Data from Pale is not shown (Table I) as it was treated
in a different manner.
Two Pale genotypes were previously
25
regenerated from callus tissue culture without Agrobacterium
inoculation.
Since these had proven regeneration
capability, they were the only two Pale genotypes used in
the transformation experiments.
The regenerated plants were designated as putative
transgenic alfalfa. A total of 181 putative transgenic
alfalfa were regenerated from all genotypes.
plants survived for further testing.
Eighty-seven
It was assumed,
because of the regeneration method employed, that many of
these 87 plants were "clones" of each other and not
independently derived transformation events. The remainder
of the study entailed the verification and characterization
of these plants.
GUS Expression
The histological GUS assay was performed at a very
early age as only a small leaf portion was needed and it did
not interfere with further plant development.
This initial
screening showed 58 of 87 plants expressed GUS, as indicated
by blue-staining cells.
The remaining 29 plants never
exhibited GUS expression even after repeated assays.
The initial GUS assay was performed on leaf tissue.
Several GUS positive plants thus identified were studied for
tissue specific expression.
Stem cross-sections showed blue
staining in the phloem tissue and blue staining was seen in
a developing ovule in an ovary (pers. comm. R.G. Stout).
v
26
Leaves showed GUS expression in the parenchyma cells and the
vascular bundles of roots also stained blue.
Results with
pollen paralleled those published by Plegt and Bino (1989)
for binucleate pollen of other species.
Pollen from both
transgenic and normal alfalfa stain blue, rendering this an
unsuitable tissue for assay.
Plegt and Bino (1989) suggest
that an endogenous /3-glucuronidase gene exists which is
highly tissue and developmentalIy specific.
However, if
such a gene exists in alfalfa, it probably has limited
homology to the bacterial gene, as cross-hybridization is
not seen with normal, non-transgenic alfalfa.
This pattern
of expression throughout the plant is similar to other
published studies (Jefferson et al. 1987, Terada and
Shimamoto 1990).
NPT II Expression
Forty-seven putative transgenic plants were tested for
kanamycin resistance.
Explants from 46 of 47 plants formed
callus and grew on 50 mg/L kanamycin.
Control,
untransformed plants died at this concentration.
The one
regenerated plant which failed to express kanamycin
resistance was later classified as an escape.
Fewer plants
were tested for kanamycin resistance than for GUS
expression.
Some plants died and some were prematurely
disposed of because they did not exhibit GUS expression.
27
Southern Blot Analysis
Southern blot analysis is the standard method of
demonstrating that plants contain foreign genes in their
genomes, as well as estimating gene copy number, and
discerning independently derived transgenic plants from
sibling transgenic plants.
Thirty-five (40%), of the
original 87 putative transgenic plants, are derived from
independent transformation events (Table 2).
Table 2. Percentage of transgenic alfalfa plants which are
derived from independent transformation events.
Cultivar
Ladak 65
Spredor II
Rangelander
Pale
Total
# Transgenic
Alfalfa
21
33
24
9
87
# Independent
Transgenic
Alfalfa
% Independent
Transgenic
Alfalfa
12
7
12
4
35
57
21
50
44
40
DNA of the first regenerated transgenic plants were
probed with the entire pBI121 plasmid.
Hybridization
occurred with all putative transgenic plants tested and no
hybridization occurred with control, untransformed plants.
To address why some transgenic plants failed to express
GUS, separate hybridizations were done with the 3 kb
SstT/SphT GUS fragment and the 1.7 kb SphT NPT II fragment
as probes.
Genomic DNA was digested with HindIII, which
cuts between the GUS and NPT II genes of pBI121.
The
Southern blot in Figure IA was hybridized with the 1.7 kb
28
SphI NPT II fragment and then hybridized with the 3 kb
Sstl/SphI GUS fragment (Figure IB).
Lanes 4, 5, and 6 show
hybridization to only the NPT II fragment while lanes I, 3,
6, 9 show hybridization to both the GUS and NPT II
fragments.
Lanes 2 and 8 represent control, untransformed
plants which show hybridization to neither fragment.
The presence of the NPT II and GUS genes and their
expression in regenerated plants was determined on 30 plants
including 29 of the 35 independent transgenic plants (Table
3).
Seventeen plants (59%) contained and expressed both the
NPT II and GUS genes.
Five plants (22%) contained and
expressed the NPT II gene but were missing the GUS gene.
All plants expressed the NPT II gene when present and none
contained only the GUS gene.
This is not unexpected as
selection was based on kanamycin resistance.
One
regenerated plant did not contain or express either gene.
It is probably an escape as described by Klee et al. (1987).
The seven plants (29%) which contained both genes but failed
to express GUS are more difficult to explain.
The often
cited "position effect" may not apply in these cases, since
the NPT II gene is being expressed and the two genes should
be linked.
The GUS gene may have been partially deleted or
rearranged leading to non-expression. An alternative
hypothesis is that the GUS gene has been inactivated by the
plant, possibly by methylation (Amasino et al. 1984) .
could be determined by sequencing of the genes in these
This
29
Figure I. Southern blot of JfindIII digested genomic DNA of
transgenic and control alfalfa plants. A: Blot
probed with radioactively labeled 1.7 kb SphI NPT
II fragment. B: Same blot, stripped of NPT II
probe, and then reprobed with radioactively
labeled 3 kb Sstl/SphI GUS fragment.
30
plants and comparing the sequences to the original
sequences.
Table 3. The presence and expression of the NPT II and GUS
genes in transgenic alfalfa.
NPT II
gene
GUS
gene
+
+
+
+
+
+
+
+
-
-
+
-
"
Kanamycinji
“
GUS
expression
+
-
# Plants
17
5
7
0
I
"
These data have implications for those transformation
projects where the gene(s) of primary interest is not
directly selected for during tissue culture.
Based on these
results, a significant proportion of the transgenic plants
could either not contained the unselected gene or fail to
express it.
Copy number was estimated concurrently with testing for
the presence of each gene on the independent transgenic
plants.
Copy number ranged from 1-5 in 33 transgenic plants
(Figure 2).
In Figure I each band for a particular plant
theoretically represents one copy of the GUS gene or NPT II
gene. The exception is if tandem repeats have occurred, in
which case, a single band might represent several tandem
copies of a gene.
Therefore, the copy number estimation
represents the minimum number of copies present in the plant
genome. Jorgenson et al. (1987) gave evidence that within a
tandem array of inserted genes, there is often only one copy
NO. OF PLANTS
7
LADAK
SPREDOR Il
RANGELANDER
PALE
6
5
4
3
W
H
2
I
0
1 2 5
1 2 3 4
1 2 3 4
5
COPY NUMBER
Figure 2. Estimation of copy number of NPT II gene in transgenic
alfalfa plants.
2 3 4
32
of the gene which is expressed.
Determining the number of
expressed genes is best made by crosses with the transgenic
plant and subsequent progeny inheritance analysis.
Polymerase Chain Reaction
Southern blots have permitted the accurate
identification of plants containing introduced genes for
over a decade (Thomashow et al. 1980).
Polymerase chain
reaction sequence amplification provides an alternative
technique which is more rapid and possibly more efficient at
determining which plants contain accurately integrated
foreign genes.
This is a particularly important
consideration for analyzing hundreds of transgenic progeny.
Establishing a specific protocol for simultaneous
amplification of NPT II and GUS genes was undertaken.
Determination of optimal annealing temperature for specific
primer sets and target sequences is necessary to eliminate
artifacts due to nonspecific amplification.
An annealing
temperature of 50-55° C gave good amplification with minimum
nonspecific amplification products using the GUS and NPT II
primers and target sequences.
A 25 /xl reaction, rather than
the standard 100 jul reaction, was adopted for cost savings.
This reaction volume reduction required accurate
determination of template DNA concentration for each
reaction.
PCR failures were commonly due to either excess
or insufficient template DNA.
This problem was solved by
33
careful DNA concentration determination as described
previously.
A single leaf yielded enough DNA several PCR
reactions.
Simultaneous PCR amplification of the NPT II and GUS
fragments was performed on the independent transgenic
alfalfa plants.
Transgenic plants, known to express GUS,
contained both the NPT II and GUS genes based oh the
presence of PCR amplified fragments from both genes (Figure
3A, lanes 4,7,10,12).
Transgenic plants which did not
express GUS, apparently contained only the NPT II gene since
only this fragment was amplified by PCR (Figure 3A, lanes
3,6,9,11,13).
Non-transformed, non-regenerated control
plants displayed neither amplified fragment (Figure 3A,
lanes 2,5,8,14), although nonspecific amplification is seen
in lane 2.
control.
DNA from pBI121 was included as a positive
The control reactions were done using GUS and
NPT II primers separately (Figure 3A, lanes 15 and 16,
respectively), as well as simultaneously (lane I), and the
expected fragments were amplified in each.
Differences in
band intensities seen in Figure 3A are probably due to
differences in template DNA concentration between reactions
and/or differences in copy number of the introduced genes
among transformed plants.
To assure that the amplified 785 bp and 1097 bp
fragments corresponded to the NPT II and GUS genes,
respectively. Southern analysis was performed on the blotted
34
C
+
«#*
NPTII
Figure 3. Agarose gel and Southern blot of PCR amplified
fragments. A: Agarose gel showing 785 bp NPT II
and 1097 bp GUS PCR amplified fragments. Lane
17 is IfindIII digested lambda DNA as molecular
weight markers. Lanes 1,15 and 16 contain pBI121
DNA and lanes 2-14 contain DNA from transgenic and
control alfalfa plants. B: Southern blot of PCR
gel probed with radioactively labeled 3 kb
Sstl/SphI GUS fragment. C: Same blot, stripped of
GUS probe, then reprobed with radioactively
labeled 1.7 kb SphI NPT II fragment.
35
PCR gels.
The filters were probed first with the 3 kb
Sstl/SphI GUS fragment and then with the 1.7 kb SphI NPT II
fragment.
The 3 kb GUS fragment hybridized only to the
1097 bp amplified fragments (Figure 3B) and the 1.7 kb
NPT II fragment hybridized only to the 785 bp amplified
fragments (Figure 3C).
Non-specific amplification was
present in some control plants (Fig 3A, lane 2).
However,
there was no hybridization of these bands with the NPT II or
GUS fragments (Fig 3B, 3C, lane 2).
All 35 independent transgenic plants were tested with
PCR for the presence of GUS and NPT II amplified fragments.
Twenty-six (74%) contained both GUS and NPT II fragments,
nine (26%) contained only the NPT II fragment and one
contained neither fragment (the same plant previously
identified as an escape). As with Southern blot analysis,
none of the plants contained only the GUS fragment.
For 32 plants tested by both methods, PCR data agrees
with Southern blot data except in one case (Table 4).
This
plant hybridized to the 3 kb GUS fragment in a Southern blot
but PCR failed to amplify the 1097 bp GUS fragment.
It is
possible that the GUS gene sequences which the primers
anneal to are rearranged or deleted so that annealing fails
to occur.
Enough homology may remain for hybridization of
the GUS gene in a Southern blot.
exhibit GUS expression.
This plant also did not
In this case, PCR failed to
identify one plant with the GUS gene, which since it does
36
not express GUS, would not be used for further study.
Table 4. A comparison of Southern blots and PCR for
detection of the NPT II and GUS genes.
NPT II
Southern blot
PCR
GUS
32
32
25
24
Many Agrobacterium-mediated plant transformation
systems now employ a NPT II gene as the selectable marker
along with a second gene of primary interest, whose gene
product may not be easily assayed.
PCR provides a rapid
method to distinguish those putative transgenic plants which
are escapes from plants which contain only the NPT II gene
and those which contain both foreign genes.
Since only
nanogram amounts of DNA are required PCR, this assay could
be performed much earlier in the regeneration process than
is feasible for Southern analysis.
PCR has limitations for genetic analysis.
It is unable
to give copy number estimates and also fails to distinguish
those plants which have identical insertion sites from those
with different insertion sites.
However, these data do show
that PCR can be a useful technique for evaluating the
integrity of multiple foreign genes introduced into plants.
The primer set used for the GUS fragment delineated
approximately one-third of the total CaMV35S-GUS fusion
sequence.
For a more complete analysis, another primer set
encompassing a different portion of the gene could be used.
37
Fertility and Chromosome Studies
One of the first plants to be regenerated and shown to
be transgenic was derived from Spredor II and designated
Sll.
Nineteen plants were regenerated from this line and,
based on Southern blot analysis, they were all sibling
clones, derived from a single transformation event.
When
crosses were made with these plants some plants appeared to
be male sterile.
Pollen germination Of these and other
transgenic plants was performed.
Data from the Sll plants
show a great variation in pollen germination counts from
completely male sterile to normal male fertility compared to
normal untransformed plants (Appendix A).
Since all the Sll
plants are genetically clones for the GUS and NPT II genes,
the variation in male fertility is most easily explained by
somaclonal variation.
Somaclonal variation is a commonly
seen phenomenon in alfalfa (and other plant species)
associated with regeneration from tissue culture (Bingham et
al. 1988).
Changes in fertility, both male and female, as
well as other morphological changes have been attributed to
somaclonal variation, independent of Agrobacterium-mediated
transformation.
Other examples of postulated somaclonal
variation in the transgenic alfalfa are different leaf
morphology, dwarfness and chlorophyll deficiency.
Another possible consequence of somaclonal variation is
aneuploidy.
Mitotic chromosome counts were performed on six
38
transgenic plants, particularly those with impaired male
fertility.
2n=32.
All had the normal euploid chromosome number,
In this small sample of. transgenic alfalfa there is
no evidence of aneuploidy or polyploidy.
Progeny Studies
Preliminary reciprocal crosses using transgenic plants
were analyzed with GUS assay and PCR (Table 5).
Normal
inheritance of the GUS gene from the maternal parent was
observed, using both tests.
However, inheritance of the GUS
gene from the paternal parent, particularly P5, appeared
abnormal with a decrease in the number of expected GUS+
progeny by PCR and a total lack of GUS expression in the
progeny of P5.
More crosses need to be made to confirm this
initial trend in the data.
Table 5. Genetic ratios of the GUS gene in Fl progeny
determined by PCR and GUS expression.
Cross
Test
S-Il2 x wt
ms3 x S-Il
ms
x P-5
GUS assay
PCR
GUS assay
PCR
GUS assay
PCR
Progeny
GUS+ GUS21
21
2
2
O
24
23
23
7
7
36
12
Expected
Ratio
1:1
1:1
1:1
1:1
3:1
3:1
P-Value1
.88
.88
.18
.18
.00
.34
1 P-values are based on chi square test with I df.
2 S-Il contains one copy of the GUS gene and P-5 contains
two copies of the GUS gene by Southern blot analysis.
3 Female plants used in this cross are male sterile.
Inheritance studies require the analysis of many
39
progeny.
Based on the preliminary data in Table 5, analysis
of progeny by only the GUS expression assay may not provide
data to adequate evaluate the inheritance of the GUS gene.
DNA analysis will be necessary for evaluating progeny which
do not exhibit normal expression. Because it is simple and
rapid, PCR would appear to be an ideal method for DNA
analysis of progeny of transgenic alfalfa.
40
SUMMARY
One consideration which has not been adequately
addressed in alfalfa transformation research, is the
inheritance and expression stability of foreign genes
through several generations.
These data are essential for
the creation of new alfalfa cultivars based on plant
transformation.
The research described is preliminary work
for a project to obtain data of this nature.
The first objective of this research was to generate
transgenic alfalfa plants from Montana-adapted germplasm
using Agrobacterium-mediated transformation.
Using
established transformation and regeneration protocols,
transgenic alfalfa plants were developed from three Montanaadapted cultivars.
This is the first report of
transformation of these cultivars and of regeneration from
tissue culture of Spredor II.. The GUS reporter gene was
expressed in some transgenic alfalfa plants and is providing
a useful method for tracking expression stability in
progeny.
The second objective was to ascertain if polymerase
chain reaction can replace Southern blot analysis to
characterize transgenic alfalfa and its progeny.
Optimizing
annealing temperature allowed reliable verification of the
41
integration of the NPT II and GUS genes in transgenic
plants, using PCRi
Small reaction volumes were cost
effective and reliable.
However, PCR was unable to provide
copy number data or identify transgenic plants derived from
independent transformation events.
PCR promises to be
useful in the continuing inheritance studies of these
transgenic alfalfa.
Based on both Southern blot and PCR data, 20-25% of the
transgenic alfalfa plants failed to integrate the GUS gene
into their genomes although they did integrate the NPT II
gene.
Further, 29% of the transgenic alfalfa plants which
contained the GUS gene failed to express it.
This indicates
that foreign genes which are not actively selected for may
fail to be integrated properly or at all into a plant
genome.
Preliminary crosses with these transgenic alfalfa
plants indicate that inheritance and/or expression stability
may not be as expected.
Further crosses are planned to see
if this trend continues in the F2 generation.
REFERENCES CITED
43
REFERENCES CITED
Amasino, R.M., A.L.T. Powell, and M.P. Gordon. 1984. Changes
in T-DNA methylation and expression are associated
with phenotypic variation and plant regeneration in a
crown gall tumor line. Mol. Gen. Genet. 197:437-446.
Beck, E., G . Ludwig,
Schaller. 1982.
localization of
from transposon
E.A. Auerswald, B. Reiss, and H.
Nucleotide sequence and exact
the neomycin phosphotransferase gene
Tn5. Gene. 19:327-336.
Bevan, M. 1984. Binary Agrobacterium vectors for plant
transformation. Nucleic Acid Res. 12:8711-8721.
Sevan, M.W., R.B. Flavell and M-D. Chilton. 1983. A
chimaeric antibiotic resistance gene as a selectable
marker for plant cell transformation. Nature 304 :184187.
Bingham, E.T. 1980. Maximizing heterozygosity in
autopolyploids, p. 471-489. In W.H. Lewis (ed.)
Polyploidy: Biological Relevance, Plenum Press, New
York.
Bingham, E.T., L.V. Hurley, D.M. Kaatz, and J.W. Saunders.
1975. Breeding alfalfa which regenerates from callus
tissue in culture. Crop Sci. 15:719-721.
Bingham, E.T., T.J. McCoy, K.A. Walker. 1988. Alfalfa
tissue culture, p. 903-927. In A.A. Hanson (ed.)
Alfalfa and Alfalfa Improvement. Agron. Monograph No.
29. ASA, CSSA, and SSSA, Madison, WI.
Blake, N.K. and E.T. Bingham. 1986. Alfalfa triploids with
functional male and female fertility. Crop Sci. 26:643645.
Blake, T.K. and A. Kleinhofs. 1988. Applications of
molecular genetics to crop improvement, p. 989-999. In
R.J. Summerfield (ed.) World Crops: Cool Season Forage
Legumes. Proceedings of the International Food Legume
Research Conference on Pea, Lentil, Faba bean and
Chickpea. Kluwer Academic Publishers, Boston.
44
Brock, T.D. and H. Freeze. 1969. Thermus aquaticus gen.n.
and sp.n. a non-C speculating extreme thermophile. J.
Bacteriol. 98:289-297.
Brown, D.C.W. and A. Atanassov. 1985. Role of genetic
background in somatic embryogenesis in Medicago. Plant
Cell Tiss. Org. Cult. 4:111-122.
Chabaud, M., J.E. Passiatore, F. Cannon, and V. BuchananWollaston. 1988. Parameters affecting the frequency of
kanamycin resistant alfalfa obtained by Agrobacterium
tumefaciens mediated transformation. Plant Cell Rep.
7:512-516.
Chamberlain, J.S., R.A. Gibbs, J.E. Ranier, P.N. Nguyen, and
C.T. Caskey. 1988. Deletion screening of the Duchenne
muscular dystrophy locus via multiplex DNA
amplification. Nucleic Acids Res. 16:11141-11156.
Chen, T.H.H., J. Marowitch, and B.G. Thompson. 1987.
Genotypic effects on somatic embryogenesis and plant
regeneration from callus cultures of alfalfa. PI. Cell
Tiss. Org. Cult. 8:73-81.
Deak, M., G.B. Kiss, C. Konz, and D. Dudits. 1986.
Transformation of Medicago by Agrobacterium mediated
gene transfer. Plant Cell Rep. 5:97-100.
De Block, M., D. De Brouwer, and P. Tenning. 1989.
Transformation of Brassica napus and Brassica oleracea
using Agrobacterium tumefaciens and the expression of
the bar and neo genes in the transgenic plants. Plant
Physiol. 91:694-701.
Deroles, S.C., and R. C. Gardner. 1988a.
inheritance of kanamycin resistance
of transgenic petunias generated by
mediated transformation. Plant Mol.
Expression and
in a large number
AgrobacteriumBiol. 11:355-364.
Deroles, S.C., and R. C. Gardner. 1988b. Analysis of the TDNA structure in a large number of transgenic petunias
generated by Agrobacterium-mediated transformation.
Plant Mol. Biol. 11:365-377.
D'Halluin, K., J. Botterman, and W. De Greef. 1990.
Engineering of herbicide-resistant alfalfa and
evaluation under field conditions. Crop Science 30:866871.
45
Ditta, G., S . Stanfield, D. Corbin, and D.R. Helinski. 1980
Broad host range DNA cloning system for gram-negative
bacteria: construction of a gene bank of Rhizobium
meliloti. Proc. Natl. Acad. Sci. USA 77:7347-7351.
Gelfand, D.H. 1989. Thermus aquaticus DNA polymerase, p. 11
17. In H.A. Erlich et al. (ed.) Current Communications
in Molecular Biology: The Polymerase Chain Reaction.
Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.
Gheysen, G., M. Van Montagu, and P. Zambryski. 1987.
Integration of Agrobacterium tumefaciens transfer DNA
(T-DNA) involves rearrangements of target plant DNA
sequences. Proc. Natl. Acad.Sci. USA. 84:6169-6173.
Halk, E.L., D.J. Mewrlo, L.W. Liao, N.P. Jarvis, S.E.
Nelson, K.J. Krahn, K.K. Hill, K.E. Rashka, and L.S.
Loesch-Fries. 1989. Resistance to alfalfa mosaic virus
in transgenic tobacco and alfalfa, p. 283-296. In
B.J. Stakawicz et al. (ed.) Molecular Biology of Plant
Pathogen Interactions. Alan R. Liss, Inc., New York.
Hernalsteens, J.P., F. Van Vliet, M. De Beuckeleer, A.
Depicker, G. Engler, M. Lemmers, M. Holsters, M. Van
Montague, and J. Schell. 1980. The Agrobacterium
tumefaciens Ti plasmid as a host vector system for
introducing foreign DNA in plant cells. Nature.
287:654-656.
Hill. R.R. 1987. Alfalfa, p. 11-39 In W.R. Fehr (ed.)
Principles of Cultivar Development vol 2. Macmillan
Publishing Company, New York.
Hoekema, A., P.R. Hirsch, P.J.J. Hooykaas, and R.A.
Schilperoort. 1983. A binary plant vector strategy
based on separation of vir- and T-region of the
Agrobacterium tumefaciens Ti plasmid. Nature 303:179180.
Horsch, R.B., J.E. Fry, N.L. Hoffmann, D. Eichholtz, S.G.
Rogers, and R. T. Fraley. 1985. A simple and general
method for transferring genes into plants. Science.
227:1229-1231.
Jefferson, R.A., S.M. Burgess, and D. Hirsh. 1986. /8glucuronidase from Escherichia coli as a gene-fusion
marker. Proc. Natl. Acad. Sci. USA. 83:8447-8451.
Jefferson, R.A., T.A. Kavanagh, and M. W. Bevan. 1987. GUS
fusions: /3-glucuronidase as a sensitive and versatile
gene fusion marker in higher plants. EMBO 6:3901-3907.
46
Johnson, L.B., D.L. Stuteville, R.K. Higgins, and D.Z.
Skinner. 1981. Regeneration of alfalfa plants from
protoplasts of selected Regen S clones. Plant Sci Lett.
20:297-304.
Jones, J.D.G., D.E. Gilbert, K.L. Grady, and R.A. Jorgensen.
1987. T-DNA structure and gene expression in petunia
plants transformed by Agrobacterium tumefaciens C58
derivatives.
Mol. Gen. Genet. 207:478-485.
Jorgensen, R., C. Snyder, and J.D.G. Jones. 1987. T-DNA is
organized predominantly in inverted repeat structures
in plants transformed with Agrobacterium tumefaciens
C58 derivatives. Mol Gen Genet 207:471-477.
Kao, K.N., and M.R. Michayluk. 1980. Plant regeneration from
mesophyll protoplasts of alfalfa. Z. Pflanzenphysiol.
96:135-141.
Klee, H., R. Horsch, and S . Rogers. 1987. Agrobacteriummediated plant transformation and its further
applications to plant biology. Ann. Rev. Plant Physiol.
38:467-486.
Lassner, M.W., P. Peterson, and J.I . Yoder. 1989.
Simultaneous amplification of multiple DNA fragments by
polymerase chain reaction in the analysis of transgenic
plants and their progeny. Plant Mol. Biol. Rep. 7:116128.
Mariotti, D., M.R. Davey, J. Draper, J.P. Freeman, and E.C.
Cocking. 1984. Crown gall tumorigenesis in the forage
legume Medicago sativa L. Plant & Cell Physiol. 25:473482 .
Marton, L., G.J. Wullems, L. Molendijk, and R.A.
Schilperoort. 1979. In vitro transformation of cultured
cells from Nicotiana tabacum by Agrobacterium
tumefaciens. Nature 277:129-131.
McCoy, T., and K. Walker. 1984. Alfalfa, p. 171-192. In D.A.
Evans et al. (ed) Handbook of Plant Cell Culture vol 3.
McMillan Publ. Co., New York.
Mullis, K.B. and F.A. Faloona. 1987. Specific synthesis of
DNA in vitro via a polymerase-catalyzed chain reaction.
Methods Enzymol. 155:335-350.
47
Ooms, G., P.J. Hooykaas, G. Moolenaar, and R.A.
Schilperoort. 1981. Crown gall plant tumors of abnormal
morphology, induced by Agrobacterium tumefaciens
carrying mutated octopine Ti plasmids; analysis of TDNA functions. Gene 14:33-50.
Peralta, E.G., R. Hellmiss, and W. Ream. 1986. Overdrive, a
T-DNA transmission enhancer on the A. tumefaciens
tumor-inducing plasmid. EMBO J. 5:1137-1142.
Plegt, L. and R.J. Bino. 1989. j6-glucuronidase activity
during development of the male gametophyte from
transgenic and non-transgenic plants. Mol Gen Genet
216:321-327.
Redenbaugh, K., B.D. Paasch, J.W. Nichol, M.E. Kossler, P.R.
Viss, and K.A. Walker. 1986. Somatic seed:
encapsulation of asexual plant embryos. Biotechnology
4:797-801.
Reed, K.C. and D.A. Mann. 1985. Rapid transfer of DNA from
agarose gels to nylon membranes. Nucleic Acids Res.
13:7207-7221.
Reisch, B . and E .T . Bingham. 1980. The genetic control of
bud formation from callus cultures of diploid alfalfa.
Plant Sci. Lett. 20:71-77.
Saiki, R.K. 1990. Amplification of genomic DNA. p. 13-20. In
Innis, M.A., et al. (ed) PCR Protocols. Academic Press,
New York.
Saiki, R.K., D.H. Gelfand, S . Stoffel, S.J. Scharf, R.
Higuchi, G.T. Horn, K.B. Mullis, and H. A. Erlich.
1988. Primer-directed enzymatic amplification of DNA
with a thermostable DNA polymerase. Science 239:487491.
Saiki, R.K., S . Scharf, F. Faloona, K.B. Mullis, G.T. Horn,
H.A. Erlich, and N. Arnheim. 1985. Enzymatic
amplification of /3-globin genomic sequences and
restriction site analysis for diagnosis of sickle cell
anemia. Science 230:1350-1354.
Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular
Cloning A Laboratory Manual. Cold Spring Harbor
Laboratory, New York.
Saunders J.W., and E.T. Bingham. 1972. Production of alfalfa
plants from callus tissue. Crop Sci. 12:804-808.
48
Schreier, P.H., M. Kuntz, S. Lipphardt, H. Lorz, B. Baker,
A. Simons, F . de Bruijn, J. Schell, J.J. Bohnert, B.
Reiss, and C.C. Wasmann. 1985. New developments in
plant transformation technology: its application to
cellular organelles, cereals, and dicotyledonous crop
plants, p. 237-246. In M. Zaitlin et al. (ed.)
Biotechnology in Plant Science. Academic Press, New
York.
Seitz Kris, M.H. and E.T. Bingham. 1988. Interactions of
highly regenerative genotypes of alfalfa (Medicago
sativa) and tissue culture protocols. In Vitro Cell. &
Dev. Biol. 24:1047-1052.
Shanin, E.A., A. Spielmann, K. Sukhapinda, R.B. Simpson, and
M. Yashar. 1986. Transformation of cultivated alfalfa
using disarmed Agrobacterium tumefaciens. Crop Science
26:1235-1239.
Spielmann, A., and R.B. Simpson. 1986. T-DNA structure in
transgenic tobacco plants with multiple independent
integration sites. Mol. Gen. Genet. 205:34-41.
Stachel, S.E., E . Messens, M. Van Montagu, and P. Zambryski.
1985. Identification of the signal molecules produced
by wounded plant cells that activate T-DNA transfer in
Agrobacterium tumefaciens. Nature 318:624-629.
Stanford, E .H . 1951. Tetrasomic inheritance in alfalfa.
Agron. J. 43:222-225.
Stuart, D.A. and S.G. Strickland. 1984. Somatic
embryogenesis from cell cultures of Medicago sativa L.
I . The role of amino acid additions to the regeneration
medium. Plant Sci Lett. 34:165-174.
Stuart, D .A . and S.G. Strickland. 1984. Somatic
embryogenesis from cell cultures of Medicago sativa L.
II. The interaction of amino acids with ammonium. Plant
Sci. Lett. 34:175-181.
Stuart, D.A., J. Nelson, C.M. McCall, S.G. Strickland and
K.A. Walker. 1985. Physiology of the development of
somatic embryos in cell cultures of alfalfa and celery,
p. 35-47. In M. Zaitlin et al. (ed.) Biotechnology in
Plant Science. Academic Press, New York.
Terada, R. and K. Shimarnato. 1990. Expression of CaMV35S-GUS
gene in transgenic rice plants. Mol. Gen. Genet.
220:389-392.
49
Thomashow, M.F., R. Nutter, A.L. Montoya, M.P. Gordon, and
E .W. Nester. 1980. Integration and organization of Ti
plasmid sequences in crown gall tumors. Cell 19:729739.
Walker, K.A. and S.J. Sato. 1981. Morphogenesis in callus
tissue of Medicago sativa: the role of ammonium ion in
somatic embryogenesis. Pit. Cell Tiss. Org. Cult.
1:109-121.
Walker, K.A., M.L. Wendelh, and E.G. Jaworski. 1979.
Organogenesis in callus tissue of Medicago sativa. The
temporal separation of induction processes from
differentiation processes. Plant Sci Lett. 16:23-30.
Walker, K.A., P.C. Yu, S.J. Sato, and E.G. Jaworski. 1978.
The hormonal control of organ formation in callus of
Medicago sativa L. cultured in vitro. Am. J. Bot.
6 5 :6 5 4 — 6 5 9 .
Wan, Y., E.L. Sorensen, and G.H. Liang. 1988. Genetic
control of in vitro regeneration in alfalfa (Medicago
sativa L.). Euphytica 39:3-9.
Weising, K., J. Schell, and G. Kahl. 1988. Foreign genes in
plants: transfer, structure, expression, and
applications. Ann. Rev. Genet. 22:421-477.
White, D.W.R. and D. Greenwood. 1987. Transformation of the
forage legume Trifolium repens L. using binary
Agrobacterium vectors. Plant Mol. Biol. 8:461-469.
Williamson, J.D., M.E. Hirsch-Wyncott, B.A. Larkins, and
S.B. Gelvin. 1989. Differential accumulation of a
transcript driven by the CaMV 35S promoter in
transgenic tobacco. Plant Physiol. 90:1570-1576.
Winicov, I., D.H. Maki, J.H. Waterborg, M.R. Riehm, and R.E
Harrington. 1988. Characterization of the alfalfa
(Medicago sativa) genome by DNA reassociation. Plant
Mol. Biol. 10:369-371.
Zambryski, P. 1988. Agrobacterium-plant cell DNA transfer,
p. 309-333. In D. Berg and N. Howe (ed.) Mobile DNA.
Am. Soc. of Microbiology, Washington D.C.
50
APPENDIX
51
Table 6.
Pollen germination of control and transgenic
alfalfa.
Plant
Barrier - control
Sll-2
Sll-3
Sll-4
Sll-5
Sll-6
Sll-7
Sll-8
Sll-9
Sll-10
Sll-Il
Sll-12
Sll-13
Sll-14
Sll-18
Sll-19
Sll-20
Sll-22
Sll-23
S10-3
P5-3
P5-4
P5-6
P5-10
R21-7
R21-13
R23-12
R24-36
i
% Pollen Germination1
100%
100
0
40
45
4
4
100
0
33
0
100
100
0
40
0
0
0
90
0
100
67
100
100
17
13
30
0
Control plant corrected to 100%
houchen
b in d e r y lt d
UTICA/OMAHA
NE.