Characteristics of differential herbicide response in sulfonylurea-resistant Kochia scoparia accessions
by Kailayapillai Sivakumaran
A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in
Agronomy
Montana State University
© Copyright by Kailayapillai Sivakumaran (1992)
Abstract:
Three chlorsulfuron-resistant kochia accessions were tested for levels of resistance to sulfonylurea and
imidazolinone herbicides, based on whole plant response and sensitivity of the target enzyme. The
Minot and Chester accessions were completely resistant to 175 g ha^-1 chlorsulfuron, and I60 values
for the Chester accession ranged from 22-fold (metsulfuron) to 196-fold (chlorsulfuron) higher than the
susceptible Bozeman accession. However, the Chester accession was 1.5- to 2-fold more resistant to
five other sulfonylurea herbicides than Minot, as determined by ALS I60 values. Levels of
cross-resistance to four imidazolinone herbicides did not differ appreciably between the Minot and
Chester accessions. The intermediate Power accession displayed only 2-to 5-fold increase in resistance
over susceptible Bozeman accession to all sulfonylurea herbicides tested, and was not cross-resistant to
imidazolinone herbicides.
The highly variable degrees of ALS resistance and cross-resistance among kochia populations may be
due to different mutations in the genes encoding ALS. Putative clones have been isolated to determine
the molecular basis for the variable responses. DNA sequencing results obtained thus far are not
adequate to draw any conclusions. Further studies are needed to determine the molecular basis for the
varying patterns of resistance observed. CHARACTERISTICS OF DIFFERENTIAL HERBICIDE RESPONSE IN SULFONYLUREARESISTANT KOCHIA SCOPARIA ACCESSIONS
by
Kailayapillai Sivakumaran
A thesis submitted in partial fulfillment
of the requirements for the degree
of
Master of Science
in
Agronomy
MONTANA STATE UNIVERSITY
Bozeman, Montana
July, 1992
Si
ii
APPROVAL
of a thesis submitted by
Kailayapillai Sivakumaran
This thesis has been read by each member of the thesis committee and has been
found to be satisfactory regarding content, English usage, format, citations, bibliographic
style, and consistency and is ready for submission to the College of Graduate Studies.
L i L K S 1Z-U-—
Chairman, Graduate Committee
Approved for the Major Department
Date
Head, MajorTDepart
Approved for the College of Graduate Studies
Graduate Dean
nt
iii
STATEMENT OF PERMISSION TO USE
In presenting this thesis in partial fulfillment of the requirements for a master's degree
at Montana State University, I agree that the Library shall make it available to borrowers under
rules of the Library. Brief quotations from this thesis are allowable without special permission,
provided that accurate acknowledgement of source is made.
Permission for extensive quotation from or reproduction of this thesis may be granted
by my major professor, or in his absence, by the Dean of Libraries when, in the opinion of
either, the proposed use of the material is for scholarly purposes. Any copying or use of the
material in this thesis for financial gain shall not be allowed without my written permission.
v
iv
ACKNOWLEDGEMENTS
I would like to thank Dr. William Dyer for the opportunity, guidance, help, and support
he provided throughout this project.
I appreciate the assistance and encouragement given by my graduate committee. Dr.
Luther Talbert and Dr. Pete Fay.
I would also like to thank Dr. Jan Clarke, Dr. TheCan Caesar, Shirley Gerhardt, Glenn
Magyar, Woody Cranston, Dawit Mulugeta, Kristi Carda, Josette Wright, K. Ravindran, N.
Shivaparan, and Patty Shea for their contributions at various stages of this project.
V
TABLE OF CONTENTS
Page
APPROVAL............................................................................................................................
ii
STATEMENT OF PERMISSION ..............................................................................................jjj
ACKNOWLEDGEMENTS....................................................................................................... iv
TABLE OF C O N TE N TS .......................................................................................................
v
LIST OF T A B L E S .......... ........................................................................................................vii
LIST OF FIGURES
................................................................................................................viii
ABSTRACT.................................
ix
Chapter
1.
LITERATURE REVIEW .............................................................................
I
CO CO GO 0 ) £>
I
The Sulfonylurea Herbicides ..............................
Mode of A c tio n ............. ; .............................. ; ...................................... I
Mechanism of Plant Resistance to
ALS-Inhibiting Herbicides
Kochia ............................
Herbicide Resistant Crops
S ele c tio n .................. .. .
Hybridization ................
Gene Transfer through
Molecular Techniques .............................................................................. 9
Objectives of S t u d y .............................................................................. Tl
2.
WHOLE PLANT AND TARGET ENZYME
S EN SITIVITY........................................................................................... 12
Introduction ................................................................
12
Materials and M e th o d s ......................................................................... 12
Plant M a te ria l........................................................................................ 12
Whole Plant Sensitivity ...................................................................... 13
Target Enzyme Sensitivity ......................................................
13
Results and Discussion...................................................
15
3.
ISOLATION AND SEQUENCING OF
PUTATIVE GENOMIC CLONES.........................................
24
Introduction . . . .......................................................................................24
Materials and M e th o d s ................................................................... .. . 25
Heterologous ALS P ro b e s ................................................................. 26
Construction of Genomic Library .................................................... 27
Genomic Library Screening .............................................................. 29
vi
TABLE OF CONTENTS contd...
Excision of pBluescript Phagemid
fromthe Lambda Zap V e c to r.......................................
30
Sequencing of Putative
KochiaALS G e n e s .................................................................................. 31
Results and Discussion........................................................................ 33
4.
S U M M A R Y ............................................................................................. 39
LITERATURE C IT E D .....................................................................................
40
APPENDICES ..................................................................................
47
Appendix I .............................................................................................................................48
Appendix I l ....................................................................................................
51
vii
LIST OF TABLES
Table
1.
2.
3.
4.
5.
Page
Dry weights (percent of control) of Bozeman, Power,
Chester, and Minot kochia accessions 3 weeks after treatment
with four sulfonylurea herbicides at I X and 10X field application
rates................................................................................................
15
I60 values for six sulfonylurea herbicides of ALS extracted from
Bozeman, Power, Chester, and Minot kochia accessions....
18
Iso values for four imidazolinone herbicides of ALS extracted from
Bozeman, Power, Chester, and Minot kochia accessions....
20
Titers expressed as plaque forming units per ml of primary
packaged libraries of Bozeman and Chester kochia genomic
DNA................................................................................................
33
Insert size of phagemids from the Bozeman and Chester genomic
libraries,..........................................................................................
34
viii
LIST OF FIGURES
Figure
1.
2.
3.
4.
5.
Page
Specific activity (percent of control) of ALS extracted from
Bozeman, Power, Chester, and Minot kochia accessions assayed
in the presence of (a) chlorsulfuron, (b) triasulfuron,
(c) metsulfuron, (d) thibenuron, (e) sulfometuron, or
(f) chlorimuron............. ;...............................................................
17
Specific activity (percent of control) of ALS extracted from
Bozeman, Power, Chester, and Minot kochia accessions assayed in
the presence of (a) imazapyr, (b) imazamethabenz, (c) imazethapyr,
or (d) imazaquin.....................................................................................
Schematic diagram of the ALS coding region of pPAW9 RCR,
three fragments obtained from Hind III digestion, and the resulting
plasmid constructs used for DNA probe preparations..........
Schematic diagram of pBluescript (pBS SK-) phagemid excision
from Lambda Zap Il...............................................................................
Brassica napus ALS sequence aligned with partial sequence of
B1:2 clone...................................................................................
19
26
31
37
ix
ABSTRACT
Three chlorsulfuron-resistant kochia accessions were tested for levels of resistance to
sulfonylurea and imidazolinone herbicides, based on whole plant response and sensitivity of the
target enzyme. The Minot and Chester accessions were completely resistant to 175 g ha'1
chlorsulfuron, and I60 values for the Chester accession ranged from 22-fold (metsulfuron) to
196-fold (chlorsulfuron) higher than the susceptible Bozeman accession. However, the Chester
accession was 1.5- to 2-fold more resistant to five other sulfonylurea herbicides than Minot,
as determined by ALS I60 values. Levels of cross-resistance to four imidazolinone herbicides
did not differ appreciably between the Minot and Chester accessions. The intermediate Power
accession displayed only 2 -to 5-fold increase in resistance over susceptible Bozeman accession
to all sulfonylurea herbicides tested, and was not cross-resistant to imidazolinone herbicides.
The highly variable degrees of ALS resistance and cross-resistance among kochia
populations may be due to different mutations in the genes encoding ALS. Putative clones
have been isolated to determine the molecular basis for the variable responses. DNA
sequencing results obtained thus far are not adequate to draw any conclusions. Further studies
are needed to determine the molecular basis for the varying patterns of resistance observed.
I
CHAPTER I
LITERATURE REVIEW
The Sulfonylurea Herbicides
The discovery of the herbicidal properties of sulfonylureas in the 1970's represents
a major advancement in agricultural chemistry. The sulfonylurea herbicides are characterized
by favorable environmental characteristics such as low use rates, low non-target toxicity,
excellent crop safety, and flexibility of application timing (Levitt et at. 1981). These chemicals
belong to a large class of compounds of which over 28,000 have been synthesized and
characterized (Hartnett et al. 1991), while more than 375 have been patented as herbicides
(Brown 1990).
Sulfonylurea herbicides are degraded in soil by chemical hydrolysis and microbial
activity (Brown 1990). The adsorption, movement, and degradation of sulfonylurea herbicides
are affected by soil pH, organic matter, and clay content (Fredrickson and Shea 1984; Walker
et al. 1989).
The sulfonylurea herbicides show activity against a wide spectrum of weeds including
annuals such as kochia (Kochia scoparia) and Russian thistle {Sa/sofa iberica), and perennials
such as Canada thistle (Cirsium arvense) (Donald 1987) and McCartney rose (Rosa bracteata)
(Meyer and Bovey 1990). Crops in which these compounds are used are tolerant due to their
ability to metabolically degrade the herbicide (Sweetser et al. 1982).
Mode of Action
Initial studies on the mode of action of sulfonylurea herbicides were conducted using
chlorsulfuron.
These studies demonstrated that the herbicides were extremely potent and
selective inhibitors of plant and bacterial growth (LaRossa and Schloss 1984). Ray (1982a;
1982b) demonstrated that plant cell division was rapidly inhibited after treatment with
2
chlorsulfuron.
Growth inhibition of Salmonella typhimurium on minimal media but not on
complete media led LaRossa and Schloss (1984) to examine several biosynthetic pathways,
including those for branched chain amino acids and their respective enzymes.
Likewise,
studies conducted by Shaner and Reidey (1986) revealed that supplementation of herbicidetreated maize cell cultures with the three amino acids leucine, isoleucine and valine alleviated
the herbicidal symptoms.
These and other physiological studies conducted with S.
typhimurium suggested that the target site of sulfonylurea herbicides is the enzyme
acetolactate synthase (ALS), also referred to as acetohydroxyacid
synthase (AHAS) (EC
4 .1.3.18), which catalyzes the first step in branched chain amino acid biosynthesis (Chaleff
and Mauvais 1984).
ALS is required for the biosynthesis of two acetohydroxy acids: it
catalyzes the condensation of pyruvate either with a second molecule of pyruvate to yield
acetolactate or with 2-oxobutyrate to yield acetohydroxybutyrate (cited in Stidham and Singh
1991). Carbon flow to branched chain amino acids is regulated via feedback inhibition of ALS
(Miflin 1971).
Like a majority of plant amino acid biosynthetic enzymes, ALS is nuclear-
encoded and localized in the chloroplast (Muhitch et at. 1987).
ALS requires the presence of three co-factors which appear to be essential for correct
enzyme functioning.
Thiamine pyrophosphate (TPP) and divalent magnesium activate the
enzyme, while flavin adenine dinucleotide (FAD) acts as a stabilizing factor with no apparent
role in catalysis (Muhitch et at. 1987; Schloss et at. 1984; Schloss et a!. 1988). Absorption
spectra of FAD bound to ALS change during catalysis: these changes were diminished by
sulfometuron methyl, but substitution of reduced FAD (FADH2) for FAD caused an increase in
the binding constant for sulfometuron methyl (Schloss 1984). Therefore, sulfometuron methyl
binding must occur proximal to the site of FAD binding and near the binding site of the second
pyruvate (LaRossa and Schloss 1984).
In addition to the sulfonylureas, four other structurally unrelated classes of herbicides
also target ALS. These include the imidazolinones (Shaner et a!. 1984), triazolopyrimidines
3
(Schloss et at. 1988), sulfonylcarboxamides (Crews et a/. 1989), and N-phthalyl-L-valine
anilides (Huppatz and Casida 1985). The triazolopyrimidines appear to interact with plant ALS
in a manner similar to the sulfonylurea and imidazolinone herbicides (Schloss et al. 1988).
Imidazolinone and sulfonylurea herbicides have high levels of activity at very low use rates due
to their high specificity and activity towards the plant enzyme (Hartnett et at. 1991).
Both
herbicide classes are slow, tight binding, uncompetitive inhibitors of plant ALS (Muhitch et at.
1987). Little is known about interactions of the other two classes of herbicides with ALS
(Shaner 1991).
Sulfonylurea and imidazolinone herbicides may compete for the same binding site on
the ALS enzyme (Schloss et at. 1988). Alternatively, Saxena and King (1988) reported that
sulfonylurea-resistant Datura innoxia mutants were hypersensitive to imazaquin, indicating that
the binding sites may not overlap. These observations suggest the possibility of separable
functional sites of action for sulfonylurea and imidazolinone herbicides on ALS (Saxena and
King 1990). Recent studies indicate that the binding site of imidazolinone herbicides on the
enzyme is distinctly different from that of sulfonylurea herbicides (Sathasivan et al. 1991).
Their studies showed that a single point mutation at nucleotide 1958 of the ALS encoding
sequence in Arabidopsis thaiiana Umr I) resulted in imidazolinone resistance, but not cross­
resistance to sulfonylurea herbicides. Hence, it has been suggested that the point mutation
may not cause a significant change in secondary or tertiary structure of ALS, but may instead
cause a minor alteration in electrical charge or a steric hindrance at the herbicide-binding site
on the ALS molecule resulting in resistance to the herbicide (Sathasivan etai. 1991). Likewise,
Hattori et al. (1992) suggested that the cross-resistance observed in A. thaiiana could be due
to multiple mutations (imr I, csr I) each conferring resistance to one class of herbicide.
However, this question cannot be fully resolved until the crystal structure of ALS is known.
Binding domains of the two herbicide classes may still overlap due to secondary and tertiary
structure of the enzyme formed by protein folding (Sathasivan et a/. 1991).
4
There are up to six ALS isoenzymes in microorganisms which differ in their sensitivity
to sulfonylurea and imidazolinone herbicides, as well as feedback inhibition patterns (Schloss
et at. 1988). In plants, Chaleff and Bascomb (1987) demonstrated the presence of two genes
encoding ALS in the tetraploid species Nicotiana tabacum: the genes are 99.3% homologous
at the amino acid level (Lee et a/. 1988). Hence, it was suggested that the two isoenzymes
may be very similar and expressed at similar levels in the plant (Chaleff and Bascomb 1987).
ALS in the diploid species >4. thatiana (Haughn and Somerville 1986) and Brassica campestris
(Swanson et ai. 1988) is encoded by a single gene. The allotetraploid Brassica napus contains
two or more genes for ALS (Rutledge et ai. 1991).
The ALS gene sequence from prokaryotic and eukaryotic organisms is conserved to a
great degree. Comparisons of deduced yeast and bacterial ALS amino acid sequences revealed
three regions of high homology (Falco et ai. 1985). In higher plants, sequence analysis of A
thaliana and N. tabacum ALS genes showed that they were highly conserved, with 75% and
85% homology at the DNA and amino acid levels, respectively (Mazur et at. 1987b). The 5'
end of the coding sequence is not conserved between these two species, this portion of the
gene encodes a chloroplast transit sequence (Jones et at. 1985). In fact, the majority of the
divergence observed among plant ALS genes occurs in the transit peptide region (Hartnett et
at. 1991). The transit sequences contain only 27% identical amino acid residues, with about
50% homology at the DNA sequence level (Mazur et al. 1987a). Hydropathy analysis of the
deduced transit peptide sequences indicates that they share a number of similar hydrophobic
and hydrophilic domains, thus implying that amino acid polarity in these regions may be more
important.than the protein primary structures (Mazur et al. 1987a).
Mechanism of Plant Resistance to ALS-Inhibitino Herbicides
Herbicide resistance in weeds or crop plants may be categorized into three general
mechanisms: I ) modification of the site of action, 2) altered metabolism and 3) limited uptake
5
or translocation. Mechanisms I and 2 account for all known examples of resistance in plants
to ALS inhibitors (Shaner 1991). However, the predominant mechanism observed is an altered
ALS which is no longer sensitive to the inhibitors (Shaner 1991; Chaleff and Mauvais 1984;
Wiersma et aL 1989; Sathasivan et at. 1991). N. tabacum transformed with an altered ALS
gene from A. thaliana encodes for about 20% of total ALS activity. This fraction was highly
resistant to chlorsulfuron (Haughn et a!. 1988).
However, in the absence of herbicide, the
amount of ALS activity was observed to be consistently lower than in wild type tissue; the
reason for reduced levels of ALS activity in transgenic lines is not known (Haughn et at. 1988).
There have been no reported cases of increased herbicide resistance among plants or cells
selected on ALS inhibitors due to altered uptake or translocation, or increased levels of
metabolism (Shaner 1991).
DNA sequence analysis of a sulfonylurea-resistant A. thaliana mutant showed that the
resistant ALS gene contained a single base substitution, resulting in a proline to serine
substitution at position 197 (Haughn et at. 1988). A resistant tobacco mutant was shown to
contain the above mutation plus a second mutation leading to a leucine to tryptophan
substitution at position 573 (Lee et aL 1988). This double mutant was cross-resistant to both
sulfonylurea and imidazolinone herbicides. In Escherichia coli, a resistant ALS gene contained
a single base mutation at position 574 causing an alanine to valine substitution (Yadev et ai.
1986).
Proof of the mode of action of sulfonylurea herbicides came from a combination of
genetic and biochemical studies.
Studies conducted with herbicide-resistant mutants of S.
typhimurium (LaRossa and Schloss 1984), Saccharomyces cerevisiae (Falco and Dumas 1985),
N. tabacum
(Chaleff and Mauvais), and A.
thaliana (Haughn and Somerville 1986)
demonstrated that ALS activity was insensitive to herbicide inhibition. Studies conducted with
transgenic N. tabacum plants carrying herbicide-resistant A. thaliana ALS genes have confirmed
that ALS is the site of action of these herbicides (Mazur et aL 1987b).
Resistance to ALS
6
inhibitors is inherited as a single, partially dominant trait in maize (Newhouse et at. 1989),
tobacco (Chaleff and Bascomb 1987), A. thaliana (Haughn and Somerville 1986), prickly
lettuce (Lactuca serrio/a) (Mallory-Smith et at. 1989), and Chlamydomonas reinhardtii (Winder
and Spalding 1988). Homozygous resistant plants are more resistant to the herbicides than
heterozygous plants (Shaner 1991).
Kochia
Kochia (Kochia scoparia) is an introduced herbaceous annual plant that invades
cropland, disturbed sites and waste areas throughout the central U.S. (Eberlein and Fore 1984).
Kochia is one of 45 species known in the family Chenopodiaceae (Standley 1916). Due to its
ability to compete in a wide range of environments and its efficient mating and seed dispersal
systems, kochia is considered a major weed pest in many crop and non-crop situations. Kochia
flowers about 8 to 12 weeks after emergence and produces around 14,000 seeds per plant
(Thill et a!. 1991). Seed longevity in soil ranges from 2 to 3 years (Zorner et a/. 1984). The
plant is partially self-fertile and has been reported as predominantly open pollinated (Thill et a/.
1991). However, field studies conducted by Mulugeta (1991) suggest about 4% outcrossing.
Kochia is a diploid plant (2n = 18) (Uhrikova 1974). Mature plants can abscise at ground level
and tumble for long distances, effectively dispersing seed (cited in Thill et a/. 1991).
Chlorsulfuron, one of the first commercialized sulfonylurea herbicides, has been widely
and continuously used in many areas since its introduction in 1980.
Due to long soil
persistence and high levels of efficacy, weed resistance to chlorsulfuron has developed in a
number of locations in the Northern Great Plains.
The first reported case of sulfonylurea-
resistant weeds was that of prickly lettuce in 1987 (Mallory-Smith et at. 1990), followed by
kochia (Primiani et a/. 1990), common chickweed (Stellaria media) (Hall and Devine 1989), and
Russian thistle (Salso/a iberica) (cited in Thill et a/. 1991). Of these species, kochia accounts
for the vast majority of reported resistant populations sites (Thill et a!. 1991).
7
Chlorsulfuron-resistant kochia is widely distributed in small grain growing areas, but the
degrees of resistance and cross-resistance to other ALS-inhibiting herbicides vary widely among
field populations.
DeCastro and Youmans (cited in Shaner 1991) reported that the cross­
resistance of four chlorsulfuron-resistant kochia populations to four sulfonylurea and three
imidazolinone herbicides was highly variable. One population was resistant to all sulfonylureas
tested and to imazethapyr and imazequin, while all populations were sensitive to imazapyr.
Similarly, sulfonylurea-resistant prickly lettuce and kochia populations were cross-resistant to
imidazolinone herbicides (Thill et at. 1991). However, the degree of cross-resistance varied
with the source of the weed populations.
Reduced vigor and ecological fitness may be an intrinsic feature of herbicide resistance,
and may be considered as the "cost" or "penalty" for resistance (Gressel and Segel 1982).
However, the generalization of this phenomenon has been questioned by Rubin et a/. (1985)
and Chauvel and Gasquez (1991). Chauvel and Gasquez (1991) showed that photosynthetic
potential and growth parameters of triazine-resistant populations were at least comparable to
those found in susceptible populations, both under competitive and non-competitive conditions.
Likewise, very little difference in fitness was found among three isogenic biotypes of triazineresistant Chenopodium album (Gasquez 1991).
Studies conducted by Thompson et a/. (1992) and Christoffoleti and Westra (1992)
showed only slight differences between sulfonylurea-resistant and susceptible kochia
accessions with respect to growth rate, biomass production, leaf area and seed production.
In greenhouse studies the susceptible accession produced an average of about 13,000 seeds
versus 11,000 seeds for the resistant accession (Thompson et al. 1992).
However, shoot
height, shoot and stem diameter, and leaf and stem dry weight were slightly greater in the
resistant accessions (Thompson et a/. 1992). Overall, the results suggest that sulfonylurearesistant kochia accessions are not less fit than susceptible accessions (Christoffoleti and
Westra 1992).
8
Herbicide Resistant Crops
The significant progress made in introducing herbicide resistance traits into crops by
conventional breeding methods and genetic engineering has been the focus of attention in both
academic institutions and industry in recent years (Rubin 1991). These achievements have
been greatly aided by the progress made in understanding the genetic, biochemical and
physiological bases of the herbicides' modes of action and selectivity mechanisms, and the
understanding and expertise developed in regenerating plants from cultured cells and tissues
(Rubin 1991). The high economic value of herbicides coupled with the cost and complications
of new compound registration have encouraged academic and private institutions to pursue
research in this area (Mazur and Falcb 1989).
Several methods of incorporating herbicide resistance traits into agronomic crops have
been employed with varying degrees of success. The methods used to date are: I) selection
at the whole plant, cell, or organelle level, 2) hybridization of crops with resistant weedy
relatives, and 3) gene transfer through molecular techniques.
Selection
Genetic analysis of the differential response of crops, grasses and weed species to
several herbicides has shown that genes for herbicide tolerance may have evolved before the
domestication of cultivated crops (Snape et at. 1991). Identification of tolerant germplasm
coupled with conventional plant breeding methods have been successful in selecting for
increased herbicide resistance levels in perennial turf and pasture grasses (Johnston and
Faulkner 1991). In vitro selection methods at the cell, tissue, protoplast, and microspore level
have also been exploited to select for herbicide resistance. The potential of.these methods
was demonstrated by the recent selection of maize mutants resistant to cyclohexanedione,
aryloxyphenoxy propionate and imidazolinone herbicides: resistance was stably expressed in
regenerated plants and their progeny (Newhouse et al. 1990; Gronwald et a/. 1989). In vitro
selected imidazolinone-resistant maize varieties were released in spring of 1992 (cited in Dyer
9
et a!. 1992).
Hybridization
Early efforts to transfer naturally-occurring herbicide resistance from weed biotypes to
related crop species involved the transfer of atrazine resistance. Traditional sexual crosses
were employed to transfer maternally-inherited atrazine resistance from Brassica campestris
to Brassica crops such as canola, oilseed rape, and broccoli (Souza Machado and Hume 1987).
In spite of the reduction in yield and quality due to reduced photosynthetic efficiency, triazineresistant canola cultivars are grown in Canada in locations where weeds are difficult to control
by other means (cited in Rubin 1991).
A similar approach was used to transfer triazine
resistance from green foxtail (Setaria viridis) to the related crop foxtail millet {Setaria italica)
(Darmency and Femes 1985).
Gene transfer through molecular techniques
A greater understanding of mechanisms of action of herbicides in microorganisms and
higher plants at the molecular level has led to significant progress in identifying and transferring
genes for resistance into valuable crops. Three techniques have been used so far with success
(Rubin 1991).
(a) Transfer of genes encoding insensitive target enzymes.
Mutant ALS genes encoding
insensitive ALS enzymes were identified and introduced into tobacco, tomato, sugar beet,
oilseed rape and other crops (Mazur and Falco 1989; Hartnett et at. 1991). The resulting
transgenic plants showed varying degrees of resistance to ALS inhibiting herbicides, depending
on the type of mutation (Rubin 1991).
Several transgenic crop species were shown to be
resistant in greenhouse and field trials (Mazur and Falco 1989). Similarly, glyphosate-resistant
plants were generated by transferring mutant S. typhimurium aroA genes which encode a less
sensitive 5-enolpyruvyl-shikimate 3 phosphate synthase (EPSPS). enzyme (Padgettfe et al.
1989).
10
(b) Overexpression of genes encoding target enzymes. Overexpression of the enzyme targeted
by a herbicide results in an increase in the number of target sites available for herbicide
inhibition: the net result is that proper pathway functioning may still occur in the presence of
the herbicide.
Transgenic glyphosate-resistant plants were produced by transferring and
overexpressing wild type aroA genes from bacteria and plant sources. The EPSPS enzyme was
over-produced by about 20-fold due to increased gene expression from the cauliflower mosaic
virus (CaMV) 35S promotor (Padgette et a/. 1989). Introduction of an alfalfa mutant glutamine
synthetase gene with a CaMV 35S promotor into tobacco conferred a limited level of tolerance
to bialaphos (glufosinate) (Botterman et a/. 1991). A limiting aspect of this approch is that
high levels of stable resistance are usually not obtained.
(c) Introduction of genes encoding detoxifying enzymes.
This is a strategy to improve
tolerance to a herbicide by introducing genes from other organisms encoding enzymes that
break down the herbicide (Rubin 1991). The bar gene, which confers resistance to bialaphos,
was isolated from Streptomyces hygroscopicus and transferred to several crops (Botterman
1989).
Similarly, the bxn gene, which encodes for a nitrilase responsible for bromoxynil
hydrolysis, was isolated from the soil bacterium Klebsiella pneumonia subspecies ozanea and
transferred to tobacco: the resulting transgenic plants demonstrated high levels of resistance
(Stalker et al. 1988). The tfd/K gene which encodes a monoxygenase enzyme involved in the
breakdown of 2,4-D was isolated from the soil bacterium Alcaligenes eutrophus and introduced
into tobacco, resulting in transgenic lines with moderate levels of resistance to 2,4-D (Streber
and Willmitzer 1989).
Creation of herbicide-resistant crops through biotechnology has been the focus of
intense debate. A primary concern is the possibility of transgene escape from crops through
hybridization with related wild species (Darmency et al. 1991). Since in some cases resistance
is inherited as a dominant or partially dominant trait, gene flow by pollen could spread the trait
(Rubin 1991). Howeveri all crops are naturally tolerant to some herbicides, and no cases have
11
been documented of gene flow of tolerance from crops to associated weeds (Dyer et at. 1992).
A second concern about herbicide-resistant crops is the possible escape of a resistant
crop from cultivation to become a weed, as was the case for non-engineered proso millet
(Panicum miHiaceum) (Bough and Cavers 1989). However, weediness is generally thought to
result from many genes and hence it is unlikely that introduction of one or a few foreign genes
could cause a crop to become a weed (Dyer et at. 1992). Other concerns relating to this issue
involve the possibility of altered or novel secondary products produced by transgenic plants,
and the increased selection pressure for herbicide resistant weeds that will accompany
herbicide resistant crop use (Dyer et at. 1992).
Objectives of Study
Although the mechanism of chlorsulfuron resistance in one kochia accession was
shown to be due to an insensitive ALS (Saari et al. 1990), the physiological basis for
differential response to ALS-inhibiting herbicides among other chlorsulfuron-resistant kochia
populations is unknown.
Hence, the first objective of this study was to conduct a
comprehensive analysis of the sensitivity of four kochia accessions to sulfonylurea and
imidazolinone herbicides at the enzyme level. The second objective was to determine the
molecular basis of resistance in kochia by isolating and sequencing the susceptible and
resistant alleles.
12
CHAPTER 2
WHOLE PLANT AND TARGET ENZYME SENSITIVITY
Introduction
Studies conducted by DeCastro and Youmans (Shaner 1991) showed that four
accessions of chlorsulfuron-resistant kochia varied in their sensitivity to sulfonylurea and
imidazolinone herbicides.
While the mechanism of chlorsulfuron resistance in one kochia
accession was shown to be due to an insensitive ALS (Saari et at. 1990), the basis for
differential response to ALS-inhibiting herbicides among kochia populations is unknown.
Hence, the objectives of this study were to (I) determine the whole plant and target enzyme
response of four kochia accessions to sulfonylurea and imidazolinone herbicides, (2) determine
the inhibitory dose which reduces enzyme activity by 50% (I60) for each accession, and (3)
compare enzyme sensitivity levels with whole plant responses.
Materials and Methods
Plant material
In the fall of 1990, kochia seeds were collected and bulked from 20 plants in fields
near Chester, Power, and Bozeman in Montana and from Minot, North Dakota. The fields near
Chester and Minot had been treated with chlorsulfuron for at least 3 consecutive years prior
to seed collection, while the Bozeman accession was from an untreated site. Seeds were
stored at 4 °C until use. For greenhouse studies, seeds were planted 0.5 cm deep in 40 x 80
cm trays containing potting mixture (Ficon Sunshine Mixture 1):soil:sahd (1:1:1). Plants were
grown at 25 ± 2 °C under natural light supplemented with metal halide lamps (2 4 0 //E m"2sec'1)
to provide a daylength of 15 hours. Plants were fertilized (Peters 20:20:20) weekly.
13
Whole plant sensitivity
To determine whole plant sensitivity to ALS-inhibiting herbicides, 3-week old (3 to 5
cm tall, 4 to 5 leaf stage) kochia plants were treated with herbicides at I X and 10X the normal
field use rates. Herbicides used ( IX field rates in parentheses) were chlorsulfuron (17.5 g ha"1),
triasulfuron (33.5 g ha"1), metsulfuron methyl (112 g ha'1), and thibenuron (140 g ha'1).
Herbicides were applied with a flat fan 8002E nozzle in a spray volume of 87 L ha"1 at 276 kPa
using a moving nozzle sprayer. Three weeks after herbicide application, plants were visually
rated for injury, harvested at the soil surface, oven dried at 70° C for 48 hours, and weighed.
The experiment was conducted twice in a randomized complete block design with four
replications. Data were subjected to analysis of variance, and pooled over both experimental
repetitions since there was no between-experiment interactions. Means of the four accessions
within herbicide rate combinations were analyzed separately using the LSD test (p s 0.05).
Data are reported as percent reduction in biomass compared to the untreated controls of each
accession.
Target enzyme sensitivity
ALS extraction and assay was carried out as described in Saari et ah (1990) with the
following modifications.
Leaves were collected from 5 week-old plants (10 to 15 cm tall with
20 to 30 leaves) and immediately frozen in liquid nitrogen. Leaves (10 g fresh weight) were
homogenized using a Brinkmann Polytron in 50 mL extraction buffer (Appendix I). The mixture
was sparged with nitrogen gas for 15 minutes, filtered through six layers of cheesecloth, and
centrifuged at 2 7,000 X g for 20 minutes at 4° C. The supernatant was saturated with 25%
(NH4)2SO4, centrifuged, and the supernatant saturated up to 50% with (NH4)2SO4 to precipitate
the ALS enzyme. Protein extract containing ALS activity was collected by centrifugation at
2 0,0 00 X g for 15 minutes at 4° C. The pellet obtained was dissolved in 2 mL of extraction
buffer
without
polyvinylpolypyrollidone, antifoam-A,
and anion
exchange
resin.
The
resuspended enzyme extract was dialyzed against 2 L of the same buffer for 2 hours at 4° C.
14
The desalted enzyme extract was used immediately for assay.
ALS activity was assayed as described (Ray 1984) with the following modifications.
The final assay mixture contained 50 //L enzyme extract and varying concentrations of the
herbicides in the assay buffer (Appendix I) in a reaction volume of 0.5 mL. After incubation
at 3 0 °C for I hour, the reaction was terminated by the addition of 25
12 N H2SO4 and
centrifuged in a microfuge for 3 minutes. The supernatant was transferred to new tubes and
incubated at GO0C for 15 minutes.
Following by the addition of 50 /vL of 0.5% (w/v) N-
(aminoiminomethyl)-N-methylglycine (creatine) (in water) and 0.5 mL of 50% (w/v) a-naphthol
(freshly prepared in 2.5 N NaOH), the reaction was incubated at 60 0C for 15 minutes.
Absorbance was measured at 525 nM (Varian tectrometer, Series 634)
to determine the
amount of acetolactate formed. Total protein content of samples was determined using the
Bio-Rad protein assay (Bio-Rad catalog # 500 0006). Specific activity of ALS was calculated
using an extinction coefficient of 6.5 mM"1 cm"1 for acetoin (LaRossa and Schloss 1984).
Herbicides were prepared daily from technical grade chemicals as 0.1 mM stock solutions in
I mM NaOH (chlorsulfuron, triasulfuron, metsulfuron methyl, chlorimuron, sulfometuron
methyl, and thibenuron), or in distilled water (imazapyr, imazamethabenz, imazethapyr, and
imazequin).
ALS activity data are presented as percent of untreated control activities for each
accession. Regression equations of these data were used to calculate I60 values as described
by Ray (1984), but using the MSUSTAT MRegress program (Version 4.12, developed by
Richard E. Lund, Montana State University).
I60 is defined as the herbicide concentration
required.to inhibit ALS enzyme activity by 50% . Approximate standard errors associated with
I60 values were calculated as described (Carlson et at. 1983) using
SE(I60) = SE (YZI60Hb1 + 2(b2)l60]"1 .
where y = herbicide concentration, b ,= linear coefficient, and b2= quadratic coefficient. Data
are reported as averages of two experiments conducted with different plant material, with two
15
determinations from enzyme extracts for each experiment.
Specific activities of ALS from
Chester, Minot, Power, and Bozeman accessions were 1.56, 2.75, 1.78, and 1.63 nmoles
acetolactate mg protein'1 min"1, respectively.
Results and Discussion
Table I shows the response of four kochia accessions to treatment with four
sulfonylurea herbicides. The resistant Chester and Minot accessions were completely resistant
to chlorsulfuron, even at 175 g ha"1. Dry weight of the Chester accession was reduced by
about 25% by all herbicides and rates tested, except thibenuron at 140 g ha"1.
Table I . Dry weights (percent of control) of Bozeman, Power, Chester, and Minot kochia
accessions 3 weeks after treatment with four sulfonylurea herbicides at I X and 10X field
application rates.
Dry Weight (Percent of Control1)
Accession
Chlorsulfuron
IX
IO X
Triasulfuron
IX
Metsulfuron
IOX
Ix
Thibenuron
IOx
IX
IOX
Bozeman
51
13
18
8
42
11
21
15
Power
55
33
33
19
37
19
31
25
Chester
101
100
74
75
72
74
96
70
Minot
100
98
44
40
45
43
46
38
LSD006
4.7
5.0
6.7
9.3
4.9
4.3
4.5
6.8
1 Percent of dry weight of untreated controls for each accession.
In contrast, the resistant Minot accession was more sensitive to other sulfonylurea
herbicides, since dry weight was reduced by more than 50% by the same treatments. The
16
Power accession generally showed an intermediate response to all treatments, except at the
I X dose of chlorsulfuron, where dry weight was not significantly different from the susceptible
Bozeman accession.
Thus, the Power accession displayed a low level of resistance to all
sulfonylureas tested, while the Minot and Chester accessions were differentially cross-resistant
to these closely related herbicides.
At the I X herbicide doses, dry weights of the susceptible Bozeman accession ranged
from 18% (triasulfuron) to 51 % (chlorsulfuron) of untreated plant dry weights. The relatively
low level of growth reduction by these treatments is most likely a reflection of the time after
treatment that plants were harvested. Even though no growth occurred after treatment, plants
v
were still green and turgid after 3 weeks. Treated susceptible plants may survive longer than
I month under greenhouse conditions.
To compare whole plant response of kochia accessions with in vitro ALS sensitivity,
ALS activity was assayed in the presence of the four sulfonylurea herbicides tested in Table
I plus sulfometuron methyl and chlorimuron (Figure I). ALS from the resistant Chester and
Minot accessions was highly resistant to chlorsulfuron, and was not completely inhibited even
at the 1 0 //M concentration (Figure la). As seen from the whole plant experiments, ALS from
the Power accession displayed an intermediate level of sensitivity to chlorsulfuron, while ALS
from the Bozeman accession was very sensitive to this herbicide. ALS sensitivity to the other
sulfonylurea herbicides generally followed the same pattern (Figures I b-1 d), although ALS from
the intermediate Power accession was only slightly less sensitive to sulfometuron and
chlorimuron inhibition than the susceptible Bozeman accession (Figures Ie and If).
Regression equations of data in Figure I were used to calculate I60 values for the six
herbicides (Table 2). In all cases, the Chester accession displayed the highest resistance levels
of the four accessions. I60 values for the Chester accession ranged from 22-fold (metsulfuron)
to 196-fold (chlorsulfuron) higher than the susceptible Bozeman accession. In addition, ALS
from the Chester accession was generally 1.5- to 2-fold more resistant than enzyme from the
17
Minot accession. I60 values for the Power accession were again intermediate, averaging about
3-fold greater than the Bozeman accession, while remaining substantially below I60 values for
Specific A c tiv ity (% of Control)
the resistant Minot and Chester accessions.
.
0.1
■
•
▼
D
Minot (R)
Chester (R)
Power (!)
Sozemen (S)
■
•
▼
o
Minot (R)
Chester (R)
Power (!)
Sozemen (S)
I
■
•
▼
D
Minot (R)
Chester (R)
Power (!)
Sozemen (S)
■ Minot (R)
• Chester (R)
▼ Power (!)
o Bozemen (S)
10
■
•
▼
o
100
10 00
10000
Minot (R)
Chester (R)
Power (I)
Bozemen (S)
I
10
ICO
10 00
10000
H e rb ic id e C o n c e n tra tio n (nM )
Figure I . Specific activity (percent of control) of ALS extracted from Minot, Chester,
Power, and Bozeman kochia accessions assayed in the presence of (a) chlorsulfuron, (b)
triasulfuron, (c) metsulfuron, (d) thibenuron, (e) sulfometuron, or (f) chlorimuron. Vertical
bars are SE of means.
Table 2. I60 values for six sulfonylurea herbicides of ALS extracted from Bozeman, Power, Chester, and Minot kochia accessions.
I60 Values (nM)
Thibenuron
Sulfometuron
Triasulfuron
Accession
Chlorsulfuron
Metsulfuron
Chlorimuron
Bozeman
17 (0.5)'
09 (7.6)
48 (4.2)
82 (5.1)
84 (6.0)
21 (1.5)
Power
53 (2.0) .
213 (8.7)
90 (11)
227 (41)
200 (12)
114 (12)
Chester
3342 (347)
2010 (142)
1475 (217)
2878 (226)
5195 (544)
2244 (172)
2475 (165)
1872 (88)
1027 (125)
1562 (94)
3583 (350)
1665 (129)
Minot
1 SE of Iso values
19
To determine cross-resistance of kochia accessions to imidazolinone herbicides, ALS
sensitivity to four members of this family was determined (Figure 2). ALS from the
resistant Chester and Minot accessions was generally less sensitive to herbicide inhibition
than enzyme from the other accessions. However, levels of resistance to the
imidazolinones were much lower than those observed for the sulfonylurea herbicides.
Response of ALS from the Power accession was very similar to ALS sensitivity of the
susceptible Bozeman accession, indicating little if any increase in resistance to
imidazolinone herbicides. Whole plant response to imidazolinones generally followed the
Specific A c tiv ity (% of C ontrol)
patterns seen at the enzyme level (data not shown).
■
•
▼
□
Minot (R)
Chester (R)
Power (I)
Bozeman (S)
.
■
•
▼
n
Minot (?.)
Chester (R)
Power (I)
Bozeman (S)
■ Minot (R)
• Chester (R)
▼ Power (I)
o Bozeman (S)
H e rb ic id e C o n c e n tr a tio n (uM)
Figure 2. Specific activity (percent of control) of ALS extracted from Minot, Chester,
Power, and Bozeman kochia accessions assayed in the presence of (a) imazapyr, (b)
imazamethabenz, (c) imazethapyr, or (d) imazaquin. Vertical bars are SE of means.
20
Regression equations of data in Figure 2 were used to calculate I60 values (Table 3).
I60 values for imidazolinone herbicides of ALS from the resistant Chester and Minot accessions
were significantly higher than the susceptible Bozeman accession, although levels of resistance
were only about 1.5-fold (imazethapyr) to 6-fold (imazapyr) higher than Bozeman. In contrast
to sensitivity differences observed between the Chester and Minot accessions for sulfonylurea
herbicides, these lines displayed very similar levels of sensitivity to the imidazolinones.
I60
values for the intermediate Power accession were generally similar to the Bozeman accession,
indicating no substantial increase in resistance to imidazolinone herbicides.
Table 3. I60 values for four imidazolinone herbicides of ALS extracted from Bozeman, Power,
Chester, and Minot kochia accessions.
I60 Values (//M)
Accession
Imazapyr
Imazamethabenz
Imazethapyr
Imazequin
Bozeman
6.0 (0.57)1
2.4 (0.03)
7.4 (0.17)
5.8 (0.02)
Power
5.9 (0.09)
1.7 (0.05)
5.6 (1.00)
7.0 (0.36)
Chester
37.2 (1.00)
7.3 (0.15)
12.0 (0.67)
12.7 (0.71)
Minot
36.5 (0.93)
5.8 (0.10)
15.6 (0.83)
1 2 .3 (0 .7 2 )
1 SE of I60 values.
These results demonstrate differential sensitivity of kochia accessions to sulfonylurea
and imidazolinone herbicides at the whole plant and target enzyme levels. Similar results have
been reported for four kochia populations (three from ND and one from TX) tested for cross­
resistance at the whole plant level (Shaner 1991).
All populations were resistant to the
selective agent chlorsulfuron, and to thifensulfuron methyl. As observed in the current results,
resistance to sulfometuron methyl and metsulfuron was quite variable among the populations.
However, in contrast to the current results, only one population was cross-resistant to both
imazethapyr and imazaquin while all populations were sensitive to imazapyr (Shaner 1991).
In other studies, sulfonylurea-resistant kochia and prickly lettuce displayed different levels of
21
cross-resistance to imidazolinone herbicides, depending on the source of the resistant weed
population (Thill et at. 1991).
In general, selection for sulfonylurea and/or imidazolinone resistance in the field or
laboratory has resulted in highly variable patterns of cross-resistance. Maize lines selected for
imidazolinone resistance showed varying degrees of cross-resistance to sulfonylureas as well
as differences in sensitivity among individual imidazolinones (Newhouse etal. 1990). Similarly,
several differing patterns of cross-resistance were observed among mutants of Chlamydomonas
reinhardtii (Winder and Spalding 1988) and Datura innoxia (Saxena and King 1990) after in
vitro selection. These results together with the present data on resistant kochia accessions
lead to the following conclusions:
I) levels of cross-resistance among field-selected weed
species do not follow any predictable patterns, and 2) large scale resistant weed management
strategies should not be extrapolated based on the characteristics of only one or a few
resistant weed types.
The basis for differential levels of cross-resistance among various plant species
probably lies in the nature of mutation in gene(s) encoding ALS. In yeast, mutations in at least
ten sites in ILV2 confer sulfonylurea resistance, and mutations in three corresponding sites in
plant genes likewise lead to resistance (Mazur and Falco 1989). Substitutions at Pro 196 in
the N. tabacum SuRA allele (Lee et al. 1988) or the analogous Pro 197 site in the >4. thaliana
csrl allele (Haughn and Somerville 1986) confer selective resistance to sulfonlylurea herbicides.
A second allele of csrl (designated im rl and csr1-2) has recently been identified in the A.
thaliana GH90 mutant (Haughn and Somerville 1990) that confers resistance to imazapyr, but
not to sulfonylurea herbicides (Sathasivan et ah 1991). The basis for imidazolinone resistance
was identified as a substitution from Ser to Asn at residue 653 of ALS. Combining these two
herbicide-specific mutations in one chimeric ALS gene conferred cross-resistance to both
herbicides in transgenic tobacco (Hattori et ah 1992).
Thus, it appears that mutations in
widely separated regions of the ALS coding sequence may give rise to either herbicide-specific
22
resistance or varying patterns of cross-resistance. Given the high degree of genetic variability
associated with many weed species (Warwick 1991), it seems clear that several combinations
of single and multiple mutations may be selected for under field conditions.
The resistant Chester and Minot kochia accessions show a high degree of resistance
to chlorsulfuron and the other sulfonylurea herbicides tested. However, the Chester accession
is generally more resistant than the Minot accession to these herbicides, a difference that may
be due to the type of mutations in their respective ALS genes.
In another sulfonylurea-
resistant kochia accession, sequence analysis of a 234 bp region within the ALS gene
demonstrated the presence of a point mutation leading to an amino acid substitution at Pro 113
(Guttieri et at. 1992). Although I do not know which specific mutations occur in the resistant
Chester and Minot accessions, apparently they confer significantly different levels of resistance
to the sulfonylureas, without altering levels of cross-resistance to the imidazolinones. The
intermediate response of the Power accession is also of interest, in that the response may be
due to a third type of mutation conferring only low levels of sulfonylurea resistance and
essentially no imidazolinone cross-resistance.
Resistance level differences among these
accessions was not due to altered amounts of the ALS enzyme, since ALS specific activity was
similar in all cases. It is unlikely that altered uptake, translocation, or metabolism contributed
to the ALS resistance differences measured here, since these processes were not affected in
other sulfonylurea-resistant kochia accessions (Saari et al. 1990; Thill et a/. 1991).
If herbicide resistance initially arises from scattered individual plants, then the gene
flow (pollen and seed dispersal) characteristics of each species will influence the makeup of
resistant populations. Since resistance to ALS inhibitors appears to be inherited as a simple,
partially dominant trait (Newhouse et al. 1990), weed species may develop homogeneous
resistant populations (outcrossing, high seed dispersal) or highly variable lines within resistant
populations (selfing, low seed dispersal). In the case of kochia, due to open pollination and
high seed dispersal (Thill et al. 1991) homogeneous resistant populations are likely to occur.
23
A better understanding of this variability and the underlying genetic mechanisms is clearly
needed in order to develop more effective strategies to manage resistant weeds and prevent
further outbreaks.
24
CHAPTER 3
ISOLATION AND SEQUENCING OF PUTATIVE GENOMIC CLONES
Introduction
Sulfonylurea, imidazolinone, and triazolopyrimidine herbicides may compete for a
common binding site on the enzyme, based on herbicide-enzyme binding studies using the
bacterial ALS (Schloss et at. 1988). However, this may not be the case in plants, since several
spontaneous and chemically induced mutant plant enzymes displayed varying levels of crossresistance to ALS-inhibiting herbicides (Hall and Devine 1990; Saxena and King. 1988).
Differences in cross-resistance may indicate the presence of multiple mutations in different
regions of the gene encoding ALS. Decastro and Youmans reported that the cross-resistance
patterns of four chlorsulfuron-resistant kochia populations to sulfonylurea and imidazolinone
herbicides were highly variable (Shaner 1991). These studies suggest that the herbicides may
be interacting with non-overlapping binding sites on the enzyme (Sathasivan et at. 1991), and
that there may be separable structural sites of action on the enzyme for the two herbicide
classes (Saxena and King 1990). Since levels of resistance and cross-resistance varied in the
Power, Chester, and Minot kochia accessions (Chapter 2), I wanted to determine the molecular
basis for the observed differences.
Characterizing of the mutation(s) in genes encoding ALS which may have occurred in
resistant kochia accessions will help enhance our understanding of the interaction between the
sulfonylurea and imidazolinone herbicides and the ALS enzyme.
Second, a better
understanding of the causes and effects of resistance at the molecular level may help us to
develop better weed control programs. Understanding the molecular basis of resistance in
weed species may also help in developing better herbicide-resistant crops.
The primary objective of this study was to identify the specific mutation(s) in ALS that
led to different levels of resistance and cross-resistance observed in the Chester, Minot, and
25
Power kochia accessions. To accomplish this goal, putative genomic clones encoding ALS
were isolated from wild type (Bozeman) and resistant (Chester) kochia accessions, and
subjected to preliminary DNA sequence analysis.
Materials and Method
Seeds of susceptible (Bozeman) and resistant (Chester) kochia accessions were
germinated and grown in the greenhouse as described in Chapter 2. Two to 3 grams of leaves
from 4 to 5 week old plants were harvested and frozen at -80° C.
Genomic DNA was
extracted as described in Sambrook et at. (1989).
In order to isolate clones containing the entire ALS gene, genomic DNA was digested
with several restriction enzymes to select an enzyme which did not cleave within the coding
region. DNA (10 yvg) was digested with £coR I, Hind III, Sac I, Kpn I, Xba I, Xho I, Nhe I, Bgt
I, BamH I, Bg! II, Pst I, Hinc II, and Nco I for 2 hours at 37° C. Digested DNA was separated
by electrophoresis on 0.8% agarose gels and transferred to nitrocellulose membranes (0.45 p,
Micron Separations Inc.) as described (Southern 1975). After baking at 90° C for I to 1.5
hours under vacuum, the blots were washed in wash buffer (Appendix I) for 3 hours at 60° C.
Blots were prehybridized overnight in hybridization solution (Appendix I) at 42° C. Hybridization
was carried out in the same buffer with the addition of 5% (w/v) dextran sulfate and
radioactively labeled probes for 24 to 36 hours at 42° C (Chandler et ai. 1986).
After
hybridization, membranes were washed in formamide wash buffer (Appendix I) at 42° C for 20
to 25 minutes followed by three washes (30-45 minutes each) in I X blot wash buffer
(Appendix I) at 60° C (Chandler et at. 1986). Air-dried blots were exposed to Kodak XAR X-ray
film with intensifying screens for 5 to 12 hours at -80° C.
Kochia genomic southern blots were probed with the pKS 940 insert (see below) to
identify restriction enzymes which did not cleave within the ALS coding region. The results
showed that the pKS 940 hybridized in a single band of kochia genomic DNA digested with
26
EcoR I. Therefore, this enzyme was chosen to digest genomic DNA for library construction.
Heterologous ALS Probes
pPAW9 RCR
Nco I
Hind III
Hind III
~
,In d I I I
p KS 6 0 0
Bgl Il
CODING REG ION
^
4 5 0 bp
9 4 0 bp
6 0 0 bp
H ind 111
Hind III
H in d III
H in d III
pKS 4 5 0
~
Hind III
MCS '
H in d II I
pKS 9 4 0
Figure 3. Schematic diagram of the ALS coding region of pPAW9 RCR, three DNA fragments
obtained from Hind III digestion, and the resulting plasmid constructs used for DNA probe
preparations. MCS = multiple cloning site.
DNA fragments used as probes for kochia ALS genes were obtained from pPAW9 RCR
(Reconstructed Coding Region) (Wiersma et al. 1990), kindly provided by Dr. M. M. Moloney.
pPAW9 RCR consists of the Brassica napus ALS gene (pPAW I) Wiersma et al. 1989) from
which the promoter has been removed. pPAW9 RCR DNA was digested with Hind III, resulting
in three gene fragments of 940, 600, and 450 bp (Figure 3). The three DNA fragments were
separated from the plasmid by electrophoresis in a low melting point agarose gel, purified,
ligated into Hind III digested pUC 19, and transformed into E. coli NM 522 (Appendix II). The
new constructs were designated pKS 940, pKS 600, and pKS 450, respectively.
Bacteria containing pKS 940, pKS 600, and pKS450 were grown overnight in 50 mL
of LB/ampicillin (50 ^g/mL) medium at 37° C with shaking, and plasmid DNA isolated as
27
described (Birnboim and Doly 1979).
ALS gene fragments were isolated from plasmids by
digestion with Hind III followed by electrophoresis through low melting point agarose, DNA
band excision, phenol/chloroform extraction and ethanol precipitation. DNA fragments were
labeled with Ia-32PldCTP (NEN) by the random hexamer labelling reaction (Feinberg and
Vogelstein I 983). Unincorporated nucleotides were removed by spin dialysis (Neal and Florini
1973) through Biogel P-30 resin (Bio-Rad).
Construction of Genomic Library
Kochia DNA from the Bozeman and Chester accessions was digested with fcoRI and
size fractionated on a 0.6% low melting point agarose gel by electrophoresis at 25 volts for
5 to 6 hours. Gel areas containing DNA fragments 2 to 10 Kb in length were excised and DNA
purified by phenol/chloroform extraction (Sambrook ef a/. 1989).
Genomic DNA libraries were constructed in Lambda Zap Il using EcoRI-digested Lambda
Zap Il arms (Stratagene). Two amounts of digested genomic DNA (75 ng and 225 ng) were
ligated in separate reactions to 0.5 yvg of Lambda Zap Il arms with 0.5 /vL IO X ligation buffer,
0.5 / / L I O mM ATP, and 2 Weiss units T4 DNA Iigase in a total volume of 5 //L at 4° C
overnight.
A test insert (pRheo) was ligated to the vector arms in a similar reaction as a
positive control and also to determine packaging efficiency.
In vitro packaging of ligated vector/inserts into viable phage particles was carried out
following manufacturer's instructions (Stratagene catalog # 200213).
The reaction was
incubated at room temperature for 2 hours followed by the addition of 500 //L phage dilution
buffer (Appendix I) and 20 //L chloroform. Primary libraries were stored in the dark at 4°C.
£. coii XLI-BIue (Stratagene catalog # 236211) (Appendix II) cells required for the
transfection and susequent multiplication of the vector were prepared as follows. XLI-BIue
cells were taken from the supplied glycerol stock and streaked on LB/tetracycline (12.5 //g/mL)
plates and incubated at 37° C overnight. LB (see Appendix I) medium (3 mL) supplemented
28
with 10 mM MgSO4 and 0.2% maltose was inoculated with single colony from an overnight
plate and incubated at 37° C and 250 rpm until the culture reached an OD600 reading of 1.0
(4 to 6 hours). XLI-BIue cells were pelleted by centrifugation at 1000 X g for 10 minutes,
resuspended in 1 .5 mL of 10 mM MgSO4, and diluted with the same buffer to an OD600 of 0.5.
XLI-BIue cells thus prepared are hereafter referred to as plating cells.
Packaged libraries were diluted IO'2, IO'4, IO'6 in phage dilution buffer and 100 //I of
each dilution was added to 200 /vL plating cells, which was incubated at 37° C for 15 minutes
for phage adsorption. To this solution 3 mL 52° C NZY top agar was added (Appendix I). The
suspension was poured onto 2 day-old 37° C NZY plates (80 mm) and the plates incubated at
37° C for 6 to 8 hours. The efficiency of library construction, expressed as pfu (plaque forming
units) per mL, was calculated using the formula
(# of olaoues) X (dilution factor) X 1000 u\ = pfu/ml
(amount plated)
I
I
Negative controls for this experiment were a) plating cells without added phage, and
b) unligated Lambda Zap arms.
Positive controls were c) wild type lambda DNA (strain
cl857sam7), d) self-ligated Lambda Zap arms, and e) the test insert (pRheo) ligated to Lambda
Zap arms.
Genomic libraries were amplified in order to create multiple copies of individual clones.
Aliquots of the packaged lambda clones equivalent to approximately 20,000 recombinant
bacteriophage were mixed with 200 /vL of plating cells and incubated in Falcon tubes (catalog
# 2059) at 37° C for 15 minutes. NZY top agar (3 mL) was added, the suspension poured
onto 80 mm NZY plates, and incubated at 37° C for 6 to 8 hours.
To determine the
percentage of recombinant and nonrecombinant phage, 50 yvL of 250 mg/mL 5-bromo-4-chloro3-indolyl-S-D-galactoside (X-gal) (Research Organics Inc.) in N,N-dimethylformamide and 15/;L
of 0.5 M isopropyl-IS-D-thiogalactopyranoside (IPTG) (Sigma) in water were added to tubes prior
to plating, and numbers of blue and white plaques counted. For phage elution from amplified
plates, 3 mL of phage dilution buffer was added to each plate and incubated at 4° C for 2 to
29
4 hours. The bacteriophage suspensions were decanted, pooled, chloroform added to 0.3% ,
and stored at 4° G until use.
Genomic Library Screening
Screening of genomic libraries was carried out as described in Sambrook et at. (1989).
Phage were grown at a concentration of approximately 1000 plaques per 80 mm plate at 37°
C for 6 to 8 hours.
Plates were chilled at 4° C for 2 hours and plaques transferred onto
nitrocellulose filters (0.45 /v. Micron Separations Inc.) by laying the filters on the top agar for
2 minutes. The filter and agar were marked for orientation with India ink in a 25 gauge needle
by stabbing plates in three or more asymmetric locations.
Plaques on each plate were
transferred to duplicate filters in order to distinguish false positive signals.
Filters were
denatured on Whatman 3 MM filter paper soaked in denaturing solution (Appendix I) for 3 to
5 minutes, transferred to neutralizing solution (Appendix I) for 5 minutes, followed by a final
rinse in 2X SSC. Filters were dried at room temperature for 30 to 45 minutes and baked at
80° C for 90 minutes under vacuum.
Hybridization of nitrocellulose filters containing bacteriophage clones with heterologous
ALS probes (see above) was carried out as outlined in Sambrook et at. (1989). Baked filters
were floated on 2X SSC for 2 minutes, submerged for 5 minutes, and then incubated in
prehybridization solution for phage lifts (Appendix I) for I to 2 hours at 42° C. Denatured 32PIabeled probe (3 X 10° to I X IO 7 cpm//vg
specific activity) was added to the phage lift
prehybridization solution and hybridization was carried out at 42° C for 12 to 16 .hours.
Following hybridization, filters were washed twice (each for I to 1.5 hours) in I X SSC and
0.1 % SDS at 65° C. Filters were air-dried and exposed to Kodak XAR X-ray film overnight at 80° C with an intensifying screen. Positive hybridization signals on X-ray film were aligned
with plaque
positions on agar plates.
Plaques hybridizing to both pKS 940 and pKS 600
inserts were cored out with yellow micropipette tips and stored in I mL phage dilution buffer
30
containing one drop of chloroform at 4° C.
Plaques isolated as described above were rescreened at lower density to ensure plaque
purity. Aliquots of phage eluted from agar plugs were replated at a density of about 10 to 25
plaques per plate. Filters were screened a second time by hybridization, after which a single,
well-isolated plaque was selected from each plate and stored as described above.
Excision of oBluescriot Phaoemid
from the Lambda Zap Vector
In order to carry out further studies including DNA insert sequencing, the pBluescript
phagemid was excised from the Lambda Zap vector. The Lambda Zap vector is designed to
allow in vivo excision and recircularization of a phagemid containing the cloned insert (Figure
4). Excision of phagemids containing putative kochia ALS genes was carried out as described
(Stratagene catalog # 2 3 6 2 1 1).
Excision was performed by incubating 250 /vL of plating cells, 250 //L of positively
hybridizing phage stock (containing about I X IO 8 recombinant phage) and I /vL of R408 helper
phage (containing about I X I O 8 pfu/mL) at 37° C for 15 minutes in a 50 mL Erlenmeyer flask.
Preliminary experiments were carried out to optimize the ratio of cells to phage and helper
phage. Five mL 2X YT media (Appendix I) was added and the solution incubated at 37° C with
shaking (250 rpm) for 1.5 hours. Following heating at 70° C for 20 minutes, the lysate was
centrifuged for 5 minutes at 4 00 0 x g, and the supernatant containing pBluescript phagemids
was stored at 4° C until use. Excised phagemids were tranformed into E. coli XLI -Blue cells
by incubating 10 ^L of the supernatant recovered earlier with 200
jjL
of plating cells in Falcon
tubes at 37° C for 15 minutes. One to 100 uL of the mixture was spread on LB/ampicillin
plates and incubated at 37° C overnight. Colonies formed on these plates were restreaked on
fresh LB/ampicillin plates and also stored as glycerol stocks.
The negative control in the
phagemid excision operation was XLI-BIue plating cells with no recombinant Lambda Zap plus
R408 helper phage.
31
MCS
Eo o fl
OOflI
MCS
IN S E R T
p B lu e e o rlp t S K -
LAMBDA ZAP Il
Helper Phage (R 4 0 8 )
INSERT
pBS S K PH A G EM ID
Transformed Into
XLI-BIue cells
ISOLATION AND PURIFICATION OF PHAQEMIDS
W ITH INSERTS FOR SEQUENCING
Figure 4. Schematic diagram of pBluescript (pBS SK-) phagemid excision from Lambda Zap II.
MCS = multiple cloning site. Helper phage is involved with the secretion of proteins essential
for the excision process (for complete biology see Short et at. 1988).
Individual colonies representing positively-hybridizing plaques were grown overnight in
LB/ampicillin liquid medium. Plasmid DNA was isolated as described (Sambrook et at. 1989)
and digested with EcoRI followed by gel electrophoresis and ethidium bromide staining to
determine lengths of genomic inserts in individual clones.
Sequencing of Putative Kochia ALS Genes
Plasmid DNA to be used for sequencing was prepared using an alkaline lysis procedure
(Birnboim and Doly, 1979) using the Prep-A-Gene kit according to manufacturer's instructions
32
(Bio-Rad catalog # 7 3 2 -6 0 1 1). Standard sequencing techniques as described in Sambrook et
at. (1989) were followed.
Purified plasmid DNA was sequenced with Sequenase 2.0 (US
Biochemicals) using the dideoxy chain termination method of Sanger et at. (1977). Template
DNA (3 to 5 //g) was denatured with 0.2 M NaOH, 0.2 mM EDTA at 37° C for 30 minutes and
then neutralized with 0.1 volume 3 M NaOAC (pH 4.5).
DNA was ethanol precipitated,
resuspended in 7 fjL distilled H2O, 2 /vl_ 10 X reaction buffer (Appendix I) and I fjL M 13
forward or reverse primer (US Biochemicals, catalog numbers 70736 and 70708 respectively),
and annealed at 37° C for 30 minutes.
Annealed template-primer mixtures (10 //L), were
labeled with 0.5 //L [a-3BS]d thio ATP (1000 Ci/mmol) and 2 fjL Sequenase (diluted 1:8 in
enzyme dilution buffer) in a reaction containing
75 mM dithiothreitol, labeling mixture
(Appendix I) diluted 1:5 and 1:3 in distilled water (to enable reading the sequence closer to and
further away from the primer annealing site, respectively). The reaction was carried out at
room temperature for 3 to 5 minutes.
Termination reactions were carried out in four 1.5 mL tubes for each sample, each
containing 2.5 //L of the appropriate ratios of ddATPidATP, ddCTP:ddCTP, ddGTP:dGTP, or
ddTTPidTTTP.
Seven-deaza dGTP (US Biochemical, catalog # 70750) was used to reduce
sequence artifacts (Barnes et at. 1983). Tubes were prewarmed to.37° C and 3.5 //L of the
labeling reaction was added to each of the termination tubes. The termination reaction was
incubated for 3 to 5 minutes at 37° C and stopped by the addition of 4 //L stop solution
(Appendix I).
Samples were denatured at . 85° C for 3 minutes and held on ice until
electrophoresis.
Samples (4 /vL) were loaded on 0.4 mm thick 6% acrylamide gels and electrophoresed
at 2500 volts for 3 to 7 hours at 50° C. Gels were fixed (5% acetic acid, 12% methanol) for
15 minutes and dried at 80° C for 60 minutes under vacuum.
Dried gels were exposed to
Kodak XAR X-ray film for 8 to 24 hours at room temperature and DNA sequence information
recorded from developed films.
Sequence manipulations and comparisons were conducted
33
using Genepro version 5.0 software (Riverside Scientific Inc.).
Results and Discussion
Southern blotting and hybridization of kochia genomic DNA with ALS probes from
Brassica napus revealed a single hybridizing band in DNA digested with EcoRI, indicating that
there were no EcoRI sites within the kochia ALS gene. Therefore, EcoRI digested DNA was
used for genomic library construction.
Titers of the Bozeman and Chester genomic libraries are shown in Table 4. Cloning
efficiency of the test insert was 8.8 X 10 81 indicating that ligation and packaging steps were
successful and efficient. Titers of the Bozeman and Chester libraries were decreased about 40fold below the test insert efficiency, as is usually the case in this procedure. Lower numbers
of recombinants could be due to less efficient ligation of kochia DNA to the Lambda Zap arms.
Table 4. Titers expressed as plaque forming units per mL of primary packaged libraries of
Bozeman and Chester kochia genomic DNA.
Source
Blue
Test insert
Total Recombinants
Number of plaques per plate
White
Percent Recombinant
(pfu/mL)
16
104
86%
8.8 X IO 8
22
127
83%
2.5 X IO 7
Bozeman
75 ng
3.3 X IO 7
225 ng
Chester
75 ng
225 ng
29
103
78%
1.6 X IO 7
4.7 X IO 7
34
However, the number of recombinants obtained was judged adequate for screening purposes.
Bozeman had a titer of 3.5 X IO 7 pfu/mL and both primary packaged libraries were made up
to a total volume of 500 /j L. The Bozeman library contained 83% recombinants, for a total of
2.40 X IO 7 recombinants. The Chester library contained a total of 2.45 X I O 7 recombinant
plaques with an efficiency of 78% .
I recovered 20 positively hybridizing plaques from the Bozeman accession (labeled B l-I
to B I-20) and 17 putative positives from the Chester accession (labeled C l- I to C1-17). Of
these, four phagemids from the Bozeman library and two phagemids from the Chester library
were excised from the Lambda Zap vector and insert lengths were determined (Table 5).
Table 5. Insert size of phagemids from the Bozeman and Chester genomic libraries and the
number of bases sequenced in each clone.
Source
Approximate Size (Kb)
Bases Sequenced
5'
3'
B l-I
3.8
322
360
B I-2
2.0
541
330
B I-3
2.9
B I-4
2.4
CM
1.8
C l-1 2
3.8
DNA sequence analysis of clones B l-I and B I-2 showed that these.clones contained
between 36% and 44% sequence identity with the DNA sequence of Brassica napus ALS.
I have been unable to sequence these clones further due to lack of time.
35
TCTAGATATAAAAGTATTTTATTACTTAAAAAGTATATTTTTTT GTTAATTAAAGATATC
60
TTTTT GTTATTT GAAAAATTTTGAGAAAGTAAAGAATAATATTTAAATGTACTTTTTTTA
120
TTTCATTAGGGATATCATAGTAATCAACCACCGTGAGAGTTAACGTGAGTGCGACACCTA
180
AAAAAGTGACTTCTCAAATAATATTAT GGAGATGTATCTACAAGAAAAATAAACATTGTT
240
GTGTAAATTTTGAATAAATGACTGAGGGCATCCACATGGTAAAATTTACTAAGAGTATCT
300
GAACAAAAATATTAAAATAAAAATAAAAAGAAAGAAAGAGAAATCAGAAAACAAGAGAAG
360
CCATTGGTTAAGAAGAGACTCACACATTCTTTTGACAGAGTTTTTCTACGGATGACATTT
420
ATT GAATGAGACAACAAATTTAACAGCATTAAGTTTTATTCATCTAATTAAC CTATTAAT
480
AATTTTATGTTAAGAGACATGGATAAAGAAACTTATTGCTGCAGACGCTCTGAGATGGGG
540
AATTCG
* ***
TTGGCAATATTAGTTACGAGCCAACTTGAAGTGTCACATGCATGTATAAATTTTAGTTCT
7
GAAT-- -ATGGTAAAGTAGCTC— CTGGGTGGGGAACTACTGGTTTGA-TGGGAGTTGC
*
*
**
* *
***
*
*
* ** * ** *
* *
****
CT CTCACAGAGTTTATTTACT CATTCAAATTAAGCAATTTCTCGCAACACTCCATTTTGC
60
600
660
A - -ATGG CTTTATTTGCAGTATTCCTATCTATTATTTTG GAAATTTATAATTCTTCCGTT
*
*******
*** *
* ***
* ***
* *
**
*******
ACCATGGCTTCGTTTTCGTTCTTCGGCACCATTCCGTCGTCTCCCACAAAAGCTTCCGTC
720
h
:>i
1«
I 18
TTCTCCCTGCCGGTGTCGGTAACTACGCTCCCGTCCTTCCCGCGCCGCCGTGCTACTCGT
6
S
TTACTGGATGGAATTTCAATGAATTAATTTGTAT-TTACAAGAAAATGAAATCCAAAAGA
**
* **
* * *
*
*
* * *
* *
*
177
ACCAGGCAGTTCTAACCTTTCAATACAAAGTGATTTTCG-ATCTCCGATTTTTATTTCTA
*
*
***
*
** *
****
**
* * * * *
*
*
GTCTC-CGTTTCCGCCAACTCGAAG-AAAGACCAAGACG--CCACAGCTTCACGTCGAGA
a
236
288
***
* ** * *
* ** ** *
* *
* **
* * **
947
TTATCCT GATACACATG- GTTCTACCTCGTCTGATATTTCTTTTGGTATTTGAAACACGG
*
*
**
* * ** * *
* *
*
* **
*
* ***
AGGACGCGCATCAATGGAGATCCATCAAGCCCTAACTCGCTCCAACACAATCCGAAACGT
407
896
ATGAGTGTGTGACTT GTTATAATTCATCCTATTGATAATACAGAAAATGAGTCTGTCATC
**
* * **
* * * * * *
** *
* * * * * *
CCTGGTCGAAGCCCTGGAG.......... CGTC--AAGGAGTTGACGTAGTCTTCG-CTTACC-C
348
836
ACTTCC......... CTTTATGGT-AG-- TTCGATCGCGGAATTTCTTTCTGTATTTCCG GAAT
GAATCCGAGCACATTCAGCTCCAAATACGCTCCCAACGTGCCCCGCAGTGGCGCAGACAT
iy
780
AATAGCGAAAATAGATCAAGAATATT GACTATGATTCATATTAAACTCGAGTACGTACAA
*
*
** **** * *
*
*
** *
** * * *
1007
36
467
523
CCTTCCCCGTCACGAACAAGGAGGTATCTTCGCCGCCGAGGGTTACGCTCGTTCCTCCGG
1067
AATTGCTTCAAGAAGATTAG-AGCTGAATGACTCGTTATTATTCAATC— TATGCATAT
*
*
**
*
* *
**
* * *
*
* ****
* **
**
522
TAAACCCGGAATCTGCATCGCCACTTCCGGTC-CAGGAGCTATGAATCTCGTCAGCGGAT
1126
TGTAC-ACGC---GTTTGATATA
*
* ****
****** *
TAGCCGACGCCCTGTTTGACAGCGTACCCCTCATCGCAATCACAGGACAGGTCCCTCGCC
1186
GGATGATTGGTACCATGGCGTTCCAGGAGACACCCGTTGTTGAGGTAACGAGGACTATAA
1246
. CGAAACATAACTATCTTGTTATGGAAGTTGATGATATACCTAGGATCGTTCGAGAAGCTT
1306
TCTTTCTAGCTACTTCGGTTAGACCGGGACCGGTTCTTATAGACGTCCCCAAAGATGTTC
1366
AGCAACAGTTTGCGATTCCTAACTGGGAACAGCCTATGCGCTTACCTCTTTCAATGTCTA
1426
CGATGCCTAAACCCCCCAAAGTTTCTCACTTAGAGCAGATTCTTAGGTTGGTTTCGGAGT
1486
CTAAGAGGCCTGTCTTGTACGTTGGAGGTGGTTGTCTGAACTCGAGTGAGGAACTGCGCA
1546
GATTTGTGGAACTTACTGGCATCCCTGTTGCTAGTACGTTCATGGGACTTGGATCGTATC
1606
CTTGTGACGATGAAGAGTTCTCTCTGCAAATGCTAGGAATGCATGGAACAGTGTACGCTA
1666
ATTACGCTGTCGAGTATAGCGATCTTCTGCTTGCTTTTGGGGTTAGGTTTGACGACCGTG
1726
TGACCGGAAAGCTTGAGGCCTTTGCTAGCCGGGCCAAGATCGTGCATATTGATATTGATT
1786
CTACCGAAATCGGGAAGAACAAGACACCTCATGTGTCGGTGTGTTGTGATGTTCAGCTAG
1846
CCTT GCAAGGGATGAACGAGGTTCTT GAGAACCGACGAGATGTGCTTGACTTCGGGGAAT
1906
GGAGATGTGAAATGAACGAACAGAGACTAAAGTTCCCTCTCCGCTACAAGACGTTTGGGG
1966
AAGAGATTCCTCCACAGTACGCCATTCAACTACTTGACGAGCTAACCGACGGGAAGGCAA
2026
TTATCACTACTGGTGTCGGGCAACACCAGATGTGGGCCGCCCAATTCTACAGATTCAAGA
2086
AACCCCGCCAATGGTCGTCTTCAGGAGGACTAGGAGCCATGGGGTTCGGTCTTCCTGCAG
2146
CCATGGGAGCCGCTATAGCCAACCCGGGAGCAGTGGTTGTCGACATTGATGGGGATGGTA
2206
GCTT CATCATGAACATTCAAGAACTGGCAACCATCAGGGTTGAGAATCTTC CAGTCAAGG
2266
TTTTGCTGATTAATAATCAGCACCTCGGAATGGTCCTTCAGTGGGAAGACCACTTCTACG
2326
CAGCTAACAGAGCCGATTCTTTTCTGGGAGACCCGGCGAACCCTGAGGCGGTATTCCCGG
2386
ATATGCTGTTGTTCGCCGCATCGTGCGGTATACCAGCCGCCAGGGTCACCAGAAGGGAGG
2446
37
ACCTACGAGAGGCAATCCAGACAATGCTGGACACACCTGGACCATTCTTGTTGGATGTGG
2506
TCTGTCCTCACCAGGACCATGTGTTACCACTCATCCCTAGTGGCGGCACCTTCAAGGACA
2566
TTATTGTGTAGTACTACTTTAATGTTTGATTATTCTATGCTCTCTTCTGTTTTGTAATAA
2626
CAAAGTAAAACCAGTTTGCAATAT CAGAAGATCTTCT GATTATCAATAT CATGCTACTCT
2686
CATAAT GAAAAACGCAAACTTCACTCTTTATTTATATGAGAATAATAACTGTAGTGTTTA
2746
CATAACAATTTATAAGTTAGAAAGACTAATAAAAAAAAAGTTATATACTTGATGAAAAGG
2806
CAGAAGTAAGTTTACAATTAATTT CTACGTTCCTGCAT GAAAAAAAAAAAACATACAATT
2866
TTTTTCAAGCATGGGTAACCTTATTGAATACGAACAATCCAGACGAAAATGGGGCAAAAC
2926
TACCTTGAGATCTGCACCTGAACAGAAAACTCCAGGAACCAGACCTGTGATCATCACAAC
2986
TCTAAAAGCTGAACTATCCTGCTGTATGGTCTCAAATGTGTTCTGCATCTCCTTATCAAT
3046
AGCATTTTTCGGCTACTGGCCTGTCTA.
3073
Figure 5. ALS gene sequence of Brassica napus aligned with the partial DNA sequence of the
B I-2 clone. The partial sequence of the B I-2 clone is 545 bases in length and is aligned
begining above position 594 of B. napus ALS gene. The open reading frame of B. napus is
1911 bases in length beginning at position 664. The transcription initiation (CAAT and
TATAA) consensus sequences are at position 545 and 583 respectively. The * sign shows
the positions at which the bases are the same in both the sequences. A dash (-) indicates an
insertion generated by the sequence analysis software to obtain maximal sequence alignment.
It is possible that the DNA sequence obtained so far lies outside the ALS open reading
frame, resulting in the low sequence identity scores. Figure 5 shows the best alignment of
DNA sequence from the B I-2 clone with the ALS coding sequence of Brassica napus. The
sequence alignment shows that the B I-2 clone is homologous to the B. napus ALS gene but
the percent identity is lower than would be expected for coding regions.
In order to
conclusively prove that the positively hybridizing clones encode kochia ALS further studies
must be conducted.
Further sequence information may be obtained by synthesizing new
primers from sequence data thus far obtained, and using these primers for continued
sequencing. Primers made by Guttieri et at. (1992) from the highly conserved A domain could
help identify positive clones which encode kochia ALS. Once the gene sequence of the wild
38
type (Bozeman) ALS is confirmed then it will be possible to determine the mutation(s) occurring
in the resistant accessions by sequence comparison.
39
CHAPTER 4
,i
SUMMARY
The response of the resistant accessions at the whole plant level clearly show varying
degrees of tolerance to sulfonylurea herbicides. These observations are confirmed by assays
of ALS activity from the accessions.
Whole plant and enzyme level responses of the four
accessions show similar levels of tolerance to imidazolinone herbicides. ALS assay studies
indicate that the resistance observed may be due to a less sensitive enzyme.
Due to time
restraints, definite results could not be obtained to pinpoint the molecular basis for the
differential resistance and cross-resistance observed at the whole plant and enzyme levels.
40
LITERATURE CITED
41
Barnes1W -M ., M. Sevan, and P.H. Son. 1983. Kilo-Sequencing: creation of an ordered nest
of assymmetric deletions across a large target sequence carried on M 13. Methods in
Enzymology 101:98-122.
Birnboim, J. and J. Doly.
1979. A rapid alkaline extraction procedure for screening
recombinant plasmid DNA. Nucl. Acids Res. 7:1513-1523.
Botterman, J. 1989. Advances in engineering herbicide resistance in plants. Brighton crop
protection conference-weeds, p. 979-985.
Botterman, J., K. D'Halliun, and M. DeBIock. 1991. Engineering of glyfosinate resistance and
evaluation under field conditions. Pages 355-359 in J.C. Caseley, G.W. Cussans, and
R.K. Atkin (eds.) Herbicide resistance in weeds and crops. Butterworth Heinemann,
Oxford.
Bough, M.A. and P.B. Cavers.
69:265.
1989.
Proso millet, a crop gone wild.
Can. J. Plant Sci.
Brown, H.M. 1990. Mode of action, crop selectivity and soil relations of the sulfonylurea
herbicides. Pestic. Sci. 29:263-281.
Chaleff, R.S. and N.F. Bascomb. 1987. Genetic and biochemical evidence for multiple
forms of acetolactate synthase in Nicotiana tabacum. Mol. Gen. Genet. 210:33-38.
Chaleff, R.S. and C.J. Mauvais. 1984. Acetolactate synthase is the site of action of two
sulfonylurea herbicides in higher plants. Science 224:1443-1445.
Chandler, V., C. Rivin, and V. Walbot. 1986. Stable non-mutator stocks of maize have
sequences homologous to the M u l transposable element. Genetics 14:1007-1021.
Chauvel, B. and J. Gasquez. 1991. Study of the growth of herbicide-resistant black grass
populations. Pages 431-432 in J.C. Casely, G.W. Cussans, and R.K. Atkin (eds.)
Herbicide resistance in weeds and crops. Butterworth Heineman, Oxford.
Christoffoleti, P.J. and P. Westra. 1992. Competition and coexistance of sulfonylurea
resistant and susceptible kochia (Kochia scoparia) biotypes in unstable
environments. WSSA Abstr. 32:105
Crews, A .D., S.l. Alvardo, T.F. Brady, R.F. Doehner, D.M. Gange, D.L. Little, and P.J.
Wepplo. 1989. Discovery of a new class of herbicides: Sulfonylcarboxamides.
1989 ACS National meeting. Abstr.39.
Darmency, H. and J. Femes. 1985. Use of wild Setaria viridis (L.) Beauv. to improve
triazine resistance in cultivated S. itaiica (L.) by hybridization. Weed Res. 25:175179.
Darmency, H., I. Thill, and X. Reboud. 1991. Escape of herbicide resistant gene from
transgenic crops. Pages 437-438 in J.C. Casely, G.W. Cussans, and R.K. Atkin
(eds.) Herbicide resistance in weeds and crops. Butterworth Heinemann, Oxford.
Donald, W .W . 1987. Effect of soil applied chlorsulfuron Canada thistle [Cirsum arvense)
root and root bud growth. Weed Tech. 1:154-161.
42
Dyer, W.E., J.S. Holt, F.D. Hess, and S.O. Duke. 1992. Potential benefits and risks of
herbicide-resistant crops produced by biotechnology. Horticultural Reviews (in
press).
Eberlein, C.V. and Z.Q. Fore. 1984. Kochia biology. Weeds Today 15:5-6.
Falco, S.C. and K.D. Dumas. 1985. Genetic analysis of mutants of Saccharomyces
cerevisiae resistant to the herbicide sulfometuron methyl. Genetics 109:21-35.
Falco, S.C., K.D. Dumas, and K.J. Livak. 1985. Nucleotide sequence of the yeast ILV2
gene which encodes acetolactate synthase. Nucleic Acid Res. 13:4011-4027.
Feinberg, A.P. and B. Vogelstein. 1983. A technique for radiolabeling DNA restriction
endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13.
Fredrickson, D.R. and P.J. Shea. 1984. Effects of soil pH on degradation, movement, and
plant uptake of chlorsulfuron. Weed Sci. 34:328-332.
Gasquez, J.
1991.
Mutation for triazine resistance within susceptible populations of
Chenopodium album L. Pages 103-104 in J.C. Caseley, G.W. Cussans, and R.K.
Atkin (eds.) Herbicide resistance in weeds and crops. Butterworth Heinemann,
Oxford.
Gressel, J. and L. Segel. 1982. Interrelated factors controlling the rate of appearance of
resistance: The outlook for the furure. Pages 325-348 in H.M. LaBaron and J.
Gressel (eds.) Herbicide resistance in plants. John Wiley and Sons, New York.
Gronwald, J.W ., W.R. Parker, D.A. Somers, D.L. Wyse, and B.G. Genenbach. 1989.
Selection for tolerance to graminicide herbicides in maize tissue culture.
Brighton Crop Protection Conferance-Weeds 1217-1224.
Guttieri1 M .J., C.V. Eberlein, D.L. Hoffman, C. Smith, and D.C. Thill. 1992. DNA
sequence variation in acetolactate synthase genes from herbicide resistant and
susceptible weed biotypes. Proceedings of Western Soc. Weed Sci. 45:118.
Hall, L.M. and M.D. Devine. 1989. Cross-resistance of chlorsulfuron resistant biotypes of
Stellaria media to triazole pyrimidine herbicides. Plant Physiol. 93:962-966.
Happatz, J.L. and J.E. Casida. 1985. Acetohydroxyacid synthase inhibitors: N-phthalyl-Lvaline anilide and related.compounds. Zeitschrift fur Naturforschung
40:652-656.
Hartnett, M.E., C.F. Chui, S.C. Falco, S. Knowlton, C.J. Mauvais, and B.J. Mazur. 1991.
Molecular analysis of sulfonylurea herbicide resistant ALS genes. Pages 343-353 in
J.C. Caseley, G.W. Cussans, and R.K. Atkin (eds.) Herbicide resistance in weeds
and crops. Butterworth Heinemann, Oxford.
Hattori, J., R. Rutledge, H. Labbe, D. Brown, G. Sunohara, and B. Miki. 1992. Multiple
resistance to sulfonylureas and imidazolinones conferred by an actohydroxy acid
synthase gene with separate mutations for selective resistance. Mol. Gen. Genet.
232:167-173.
43
Haughnz G.W. and C.R. Somerville. 1986. Sulfonylurea-resistant mutants of Arabidopsis
thaiiana. Mol. Gen. Genet. 204:430-434.
Haughnz G.W., J. Smith, B. Mazur, and C. Somerville. 1988. Transformation with a mutant
Arabidopsis acetolactate synthase gene renders tobacco resistant to sulfonylureas.
Mol. Gen. Genet. 211:266-271.
Johnston, D.T. and J.S. Faulkner. 1991. Herbicide resistance in the graminaceae- a plant
breeder's view. Pages 319-330 in J.C. Caseley, G.W. Cusssans, and R.K. Atkin
(eds.), Herbicide resistance in weeds and crops. Butterworth Heinemann, Oxford.
Jones, A .V ., R.M. Young, and K.J. Leto. 1985. Subcellular localization and properties for
acetolactate synthase, target site of the sulfonylurea herbicides. Plant Physiol.
77:5293-5297.
LaRossa, R.A. and J.V. Schloss. 1984. The herbicide sulfometuron methyl is bacteriostatic
due to inhibition of acetolactate synthase. J. Biol. Chem. 259:8753-8757.
Lee, K.Y., J. Townsend, J. Tepperman, M. Black, C-F. Chui, B. Mazur, P. Dunsmuir, and J.
Bedbrook. 1988. The molecular basis of sulfonylurea herbicide resistance in
tobacco. EMBO. J. 7:1241-1248.
Levitt, G., H.L. Ploeg, R.C. Weigel JR., and D.D. Fitzgerald. 1981. 2-chloro-N-[4-methoxymethyl-1,3,5-triazin-2-yl amino carbonyllbenzosulfonamide, a new herbicide.
J. Agric. Food Chem. 29:416-424.
Mallory-Smith, C.A., D.C. Thill, and M.J. Dial. 1990. Identification of sulfonylurea
resistant prickly lettuce (Lactuca serriola). Weed Tech. 4:169-172.
Mazur, B.J. and S.C. Falco. 1989. The development of herbicide resistant crops.
Rev. Plant Physiol, and Mol. Biol. 40:441-470.
Ann.
Mazur, B.J., C-F. Chui, and J.K. Smith. 1987a. Isolation and characterization of plant
genes coding for acetolactate synthase, the target enzyme for two classes of
herbicides. Plant Physiol. 8 5 :1 110-1117.
Mazur, B.J., C-F. Chui, and J.K. Smith. 1987b. Acetolactate synthase, the target enzyme
of the sulfonylurea herbicides, in D. Von Wettstein and N.H. Chua (eds.) Plant
Molecular Biology. Vol. 140. Plenum Press, New York.
Meyer, R.E. and R.W. Bovey. 1990. Influence of sulfonylurea and other herbicides on
selected woody and herbaceous species. Weed Sci. 38:249-255.
Miflin, B J. 1971. Cooperative feedback control of barley acetohydroxyacid synthase by
leucine, isoleucine, and valine. Arch. Biochem. Biophys. 146:512-550.
Muhitch, M .J., D.L. Shaner, and M.A. Stidham. 1987. Imidazolinones and acetohydroxyacid
synthase from higher plants. Plant Physiol. 83:451-456.
Mulugeta, D. 1991. Management, inheritance, and gene flow of resistance to chlorsulfuron
in Kochia scoparia L. MS thesis, Montana State University.
44
Neal, M.W. and J.R. Florini. 1973. A rapid method for desalting small volumes of solution.
Anal. Biochem. 55:328-330.
Newhouse, K.E., D.L. Shaner, T. Wang, and R. Fincher. 1990. Genetic modification of
crop responses to imidazolinone herbicides. Pages 474-481 in M.B. Green, H.M.
LeBaron and W .M . Moberg (eds.) Managing resistance to agrochemicals from
fundarmental research to practical strategies. ACS Symposium Series No.421.
Washington D.C.
Padgette, R., G. Della-Cioppa, D.P. Shah, R.T. Fraley, and G.M. Kishore. 1989. Selective
herbicide tolerance through protein engineering. Pages 441-476 in J. Schell
and I. Vasil (eds.) Cell culture and somatic cell genetics of plants. Academic Press,
New York.
Primiani, M .M ., J.C. Cotterman, L.L. Saari. 1990. Resistance of kochia (Kochiascoparia)
to sulfonylurea and imidadolinone herbicides. Weed Tech. 4:169-172.
Ray, T.B. 1982a. The mode of action of chlorsulfuron: a new herbicide for cereals.
Pestic. Biochem. Physiol. 17:10-17.
Ray, T.B. 1982b. The mode of action of chlorsulfuron: the lack of direct inhibition of plant
DNA synthesis. Pestic. Biochem. Physiol. 18:262-266.
Relton, J.M ., R.M. Wallsgrove, J.P. Bourgin, and S.W.J. Bright. 1986. Altered feedback
sensitivity of acetohydfoxyacid synthase from valine-resistant mutants of tobacco
(Nicotiana tabacum L.). Planta 169:46-50.
Rubin, B. 1991. Herbicide resistance in weeds and crops, progress and prospects. Pages
387-407 in J.C. Caseley, G.W. Cussans, R.K. Atkin (eds.) Herbicide resistance in
weeds and crops. Butterworth Heinemann1 Oxford.
Rubin, B., T. Yaacoby, and M. Schonfeld. 1985. Triazine resistance with wheat herbicide,
. a possible threat to cereal crops. British crop protection conferance-weeds.
1171-1178.
Rutledge, R.G., T. Ouellet, J. Hattori, and B.L. Miki. 1991. Molecular characterization and
genetic origin of the Brassica napus acetohydroxyacid synthase multigene family.
Mol. Gen. Genet. 229:31-40.
Saari, L.L., J.C. Cotterman, and M.M. Primiani. 1990. Mechanism of sulfonylurea
resistance in the broadleaf weed Kochia scoparia. Plant Physiol. 93:55-61.
Sanger, F., S. Nicklen1 and A.R. Coulson. 1977. DNA sequencing with chain terminating
inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.
Sathasivan, K., G.W. Haughn, and N. Murai. 1991. Molecular basis of imidazolinone
herbicide resistance in Arabidopsis thaiiana var. Columbia. Plant Physiol.
97:1046-1050.
Saxena, P.K. and J. King. 1988. Herbicide resistance in Datura innoxia-. cross-resistance
of sulfonylurea-resistant cell lines to imidazolinones. Plant Physiol. 86:863-867.
45
Saxena, P.K. and J. King. 1990. Lack of cross-resistance of imidazolinone-resistant cell
lines of Datura innoxia to chlorsulfuron. Plant Physiol. 94:1111-1115.
Schloss, J.V. 1984. Interaction of the herbicide sulfometuron methyl with acetolactate
synthase: a slow binding inhibitor. Pages 737 In Bray, R.C., P.C. Engel, S.C.
Mayhew (eds.), Flavins and Flavoproteins. Walter de Gruyter and Co., Berlin.
Schloss, J.V., L.M. Ciskanik, and D.E. VanDyk. 1988. Origin of the herbicide binding site
of acetolactate synthase. Nature 3 3 1 :360-362.
Shaner,
D.L.
1991.
Mechanisms
of resistance
to
acetohydroxyacid
synthase/acetohydroxyacid synthase inhibitors. Pages 187-198 In J.C. Caseley, G.W.
Cussans, R.K. Atkin (eds.), Herbicide resistance in weeds and crops. Butterworth
Heinemann, Oxford.
Shaner, D.L., and M.L. Reider. 1986. Physiological responses of corn (Zea mays) to
AC 243, 997 in combination with valine, leucine, and isoleucine. Pestic. Biochem.
Physiol. 25:248-250.
Shaner, D.L., P.C. Anderson, and M.A. Stidham. 1984. Imidazolinones: potent inhibitors
of acetohydroxyacid synthase. Plant Physiol. 76:545-546.
Short, J.M ., J.M . Fernandez, J.A. Sorge, and W.D. Huse.
1988. Lambda ZAP: A
bacteriophage Lambda espression vector with in vivo excision properties. Nucl.
Acids Res. 16:7583-7600.
Snape, J.W ., D. Leckie, B.B. Parker, and E. Nevo. 1991. The genetical analysis and
exploitation of differential responses to herbicides in crop species. Pages 305-317 In
J.C. Caseley, G.W. Cussans, R.K. Atkin (eds.), Herbicide resistance in weeds and
crops. Butterworth Heinemann, Oxford.
Southern, E.M. 1975. Detection of specific sequences among DNA fragments separated
by gel electrophoresis. J. Mol. Biol. 98:503-517.
Souza Machado, V. and D.J. Hume. 1987. Breeding herbicide-tolerant cultivars- a Canadian
experience. British Crop Protection Conference-Weeds. 473-477.
Stalker, D.M., K.E. McBride, and L.D. Malyj. 1988. Herbicide resistance in transgenic plants
expressing a bacterial detoxification gene. Science 242:419-423.
Standley, P.C. 1916. Chenopodiaceae. North American Flora 2:1-93.
Stidham, M.A. and B.K. Singh. 1991. Imidazolinone-acetohydroxyacid synthase interactions.
Pages 71-90 In D.L. Shaner and S.L. O'Connor (eds.), The imidazolinone herbicides.
CRC Press.
Streber, W.R. and L. Willmitzer. 1989. Transgenic tobacco plants expressing detoxifying
enzymes are resistant to 2,4-D. Bio/Technology 7:811-816.
46
Subramanian, M .V. and B.C. Gerwick.
1989.
Inhibition of acetolactate synthase by
triazolopyrimidines. A review of recent developments. Pages 227-288. In J.R.
Whitaker, P.E. Sonnet (eds.), Biocatalysis in agricultural biotechnology. Am. Chem.
Soc. Symp. Series Vol. 389.
Swanson, E.B., M.P. Coumans, G.L. Brown, J.D. Patel, and W.B. Beversdorf. 1988. The
characterization of herbicide tolerant plants in Brassica napus L. after in vitro selection
of microspores and protoplasts. Plant Cell Reports 7:83-87.
Sweetser, P.G., G.S. Schow, and J.M. Hutchinson. 1982. Metabolism of chlorsulfuron by
plants: biological basis for selectivity of a new herbicide for cereals. Pestic.
Biochem. Physiol. 17:18-23.
Thill,
D.C., C.A. Mallory, L.L. Saari, J.C. Cotterman, and M.M . Primiani.
1989.
Sulfonylurea resistance-mechanism of resistance and cross resistance. WSWS
Abstr. 29:132.
Thill, D.C., C.A. Mallory-Smith, L.L. Saari, J.C. Cotterman, M.M. Primiani, and J.L. Saladini.
1991.
Sulfonylurea herbicide resistant weeds: Discovery, distribution, biology,
mechanism, and management. Pages 11-128. in J.C. Caseley, G.W. Cussans, R.K.
Atkin (eds.), Herbicide resistance in weeds and crops. Butterworth Heinemann,
Oxford.
Thompson, C.R. and D.C. Thill. 1992. Sulfonylurea herbicide-resistant and -susceptible
kochia (Kochia scoparia) growth rate and seed production. WSWS Abstr.
32:131.
Uhrikova, A. 1974. Index to chromosome numbers of Slovakian flora, pt.4. Acta
Facultatis rerum naturalium universitatis comenianae.
Walker, A .E., G. Cotterill, and S.J. Welch.
1989.
Adsorption and degradation of
chlorsulfuron and metsulfuron methyl in soils from different depths. Weed Res.
29:281-287.
Warwick, S.l. 1991. Herbicide resistance in weedy plants: physiological and population
biology. Ann. Rev. Ecol. Syst. 22:95-114.
Wiersma, P.A., M G. Schmiemann, J.A. Condie, W.L. Crosby, and M .M . Moloney. 1989.
Isolation, expression and phylogenetic inheritance of acetolactate synthase gene
from Brassica napus. Mol. Gen. Genet. 219:413-420.
Wiersma, P.A., J.E. Hachey, W.L. Crosby, and M .M .. Moloney. 1990. Specific truncations
of an acetolactate synthase gene from Brassica napus efficiently complement Uv B/iiv
G mutants of Salmonella typhimurium. Mol. Gen. Genet. 224:155-159.
Yadev, N., R.E. McDevitt, S. Bernard, and S.C. Falco.
1986.
Single amino acid
substitutions in the enzyme acetolactate synthase confer resistance to the
herbicide sulfometuron methyl. Proc. Natl. Acad. Sci. USA 83:4418-4422.
Zorner, P.S., R.L. Zimdahl, and E.E. Schweizer. 1984. Effect of depth and duration of
seed burial on kochia (Kochia scoparia). Weed Sci. 32:602-607.
47
APPENDICES
48
Appendix I
49
SOLUTIONS
ALS Extraction Buffer
100 mM K2HPO4, pH 7.5
0.5 mM MgSO4
I mM Pyruvate
10 j j M Flavin dinucleotide
0.5 mM Thiamine pyrophosphate
I mM Dithiothreitol
0.1 mM PhenylmethyIsuIfonyI fluoride
10% (v/v) Glycerol
5% (w/v) Polyvinylpolypyrollidone
0.0165% Antifoam-A
ALS Assav Buffer
20 mM K2HPO4, pH 7.0
0.5 mM MgSO4
20 mM Pyruvate
I j j M Flavin dinucleotide
0.5 mM Thiamine pyrophosphate
20 X SSC
175.3 g NaCI
88.2 g Sodium citrate
H2O to 1000 mL
(pH adjusted to 7.0)
20% SDS
200 g Sodium dodecyl sulfate
H2O to 1000 mL
(pH adjusted to 7.2)
Blot wash buffer
0.1 X SSC
0.1% SDS
Formamide wash buffer
5 X SSC
0.2% SDS
50% Fprmamide
Hybridization buffer
4 50 mM NaCI
45 mM Sodium citrate
50% Deionized Formamide
100 jjg/mL Salmon sperm DNA
0.05% Ficoll
0.05% Polyvinylpyrrolidone
0.05% BSA
I % Sodium dodecyl sulfate
Prehvbridization buffer
for olaoue lifts.
6 X SSC
50% Formamide
0.05% Blotto
Denaturina solution
1.5 M NaCI
0.5 M NaOH
Neutralizing solution
1.5 M NaCI
0.5 M Tris. Cl (pH 7.5)
Phaoe dilution buffer
100 mM NaCI
8 mM MgSO4
50 mM Tris.CI (pH 7.5)
0.01 % geletin
5 X seouencino buffer
200 mM Tris.CI (pH 7.5)
100 mM MgCI2
250 mM NaCI2
Labelino mixture
7.5 pM dGTP
7.5 fjM dCTP
7.5 j j \ dTTP
Seouencino reaction buffer (5X)
200 mM Tris.CI (pH 7.5)
100 mM MgCI2
250 mM NaCI
I X Blotto
5% Nonfat dried milk
0.02% Sodium azide
50
Seauenase dilution buffer
I O m M Tris.CI (pH 7.5)
5 mM Dithiothreitol
0.5 mg/ml BSA
Sequencing stop solution
20 mM EDTA
95% Formamide
0.05% Bromophenol blue
0.05% Xylene cynol FF
NZY Aaar plates (per liter)
5 g NaCI
2 g MgSO4
5 g Yeast extract
IO g Casein hydrolysate
15 g Agar
NZY T op Aaar (per liter)
5 g NaCI
2 g MgSO4
5 g Yeast extract
I O g Casein hydrolysate
7 g Agarose
2 X YT Broth (per liter)
10 g NaCI
10 g Yeast extract
16 g Bacto-tryptone
LB Broth (per liter)
10 g NaCI
5 g Yeast extract
10 g Bacto-tryptone
51
Appendix Il
52
BACTERIAL STRAINS
X L I-Blue: en d A I, hsdRI 7 (rk'zmk+), supE44, thi-1, lambda", recA I, gyrA96, relAI, (lac"),
[F', proAB, Iaclq Z A M I5, TnTOltet")].
NM522: FIacIqL(IacIZ)M I5 proAB/supE thiLdac' proABiLihsdMS-mcrBiBKx^m^ex^-).
l:c( I H t \
t.'vni'iY I II: