A Chemical Genetics Analysis of the Roles of Bypass
Polymerase DinB and DNA Repair Protein AlkB in
Processing N[superscript 2]-Alkylguanine Lesions In Vivo
The MIT Faculty has made this article openly available. Please share
how this access benefits you. Your story matters.
Citation
Shrivastav, Nidhi, Bogdan I. Fedeles, Deyu Li, James C.
Delaney, Lauren E. Frick, James J. Foti, Graham C. Walker, and
John M. Essigmann. “A Chemical Genetics Analysis of the Roles
of Bypass Polymerase DinB and DNA Repair Protein AlkB in
Processing N2-Alkylguanine Lesions In Vivo.” Edited by Martin
G. Marinus. PLoS ONE 9, no. 4 (April 14, 2014): e94716.
As Published
http://dx.doi.org/10.1371/journal.pone.0094716
Publisher
Public Library of Science
Version
Final published version
Accessed
Thu May 26 21:20:53 EDT 2016
Citable Link
http://hdl.handle.net/1721.1/88192
Terms of Use
Creative Commons Attribution
Detailed Terms
http://creativecommons.org/licenses/by/4.0/
A Chemical Genetics Analysis of the Roles of Bypass
Polymerase DinB and DNA Repair Protein AlkB in
Processing N2-Alkylguanine Lesions In Vivo
Nidhi Shrivastav1,2,4¤a, Bogdan I. Fedeles1,2,4, Deyu Li1,2,4, James C. Delaney1,2,4¤b, Lauren E. Frick1,2,4¤c,
James J. Foti3¤d, Graham C. Walker3, John M. Essigmann1,2,4*
1 Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts, United States of America, 2 Department of Chemistry,
Massachusetts Institute of Technology, Cambridge, Massachusetts, United States of America, 3 Department of Biology, Massachusetts Institute of Technology, Cambridge,
Massachusetts, United States of America, 4 Center for Environmental Health Sciences, Massachusetts Institute of Technology, Cambridge, Massachusetts, United States of
America
Abstract
DinB, the E. coli translesion synthesis polymerase, has been shown to bypass several N2-alkylguanine adducts in vitro,
including N2-furfurylguanine, the structural analog of the DNA adduct formed by the antibacterial agent nitrofurazone.
Recently, it was demonstrated that the Fe(II)- and a-ketoglutarate-dependent dioxygenase AlkB, a DNA repair enzyme, can
dealkylate in vitro a series of N2-alkyguanines, including N2-furfurylguanine. The present study explored, head to head, the in
vivo relative contributions of these two DNA maintenance pathways (replicative bypass vs. repair) as they processed a series
of structurally varied, biologically relevant N2-alkylguanine lesions: N2-furfurylguanine (FF), 2-tetrahydrofuran-2-ylmethylguanine (HF), 2-methylguanine, and 2-ethylguanine. Each lesion was chemically synthesized and incorporated
site-specifically into an M13 bacteriophage genome, which was then replicated in E. coli cells deficient or proficient for DinB
and AlkB (4 strains in total). Biochemical tools were employed to analyze the relative replication efficiencies of the phage (a
measure of the bypass efficiency of each lesion) and the base composition at the lesion site after replication (a measure of
the mutagenesis profile of each lesion). The main findings were: 1) Among the lesions studied, the bulky FF and HF lesions
proved to be strong replication blocks when introduced site-specifically on a single-stranded vector in DinB deficient cells.
This toxic effect disappeared in the strains expressing physiological levels of DinB. 2) AlkB is known to repair N2-alkylguanine
lesions in vitro; however, the presence of AlkB showed no relief from the replication blocks induced by FF and HF in vivo. 3)
The mutagenic properties of the entire series of N2-alkyguanines adducts were investigated in vivo for the first time. None of
the adducts were mutagenic under the conditions evaluated, regardless of the DinB or AlkB cellular status. Taken together,
the data indicated that the cellular pathway to combat bulky N2-alkylguanine DNA adducts was DinB-dependent lesion
bypass.
Citation: Shrivastav N, Fedeles BI, Li D, Delaney JC, Frick LE, et al. (2014) A Chemical Genetics Analysis of the Roles of Bypass Polymerase DinB and DNA Repair
Protein AlkB in Processing N2-Alkylguanine Lesions In Vivo. PLoS ONE 9(4): e94716. doi:10.1371/journal.pone.0094716
Editor: Martin G. Marinus, University of Massachusetts Medical School, United States of America
Received February 22, 2014; Accepted March 18, 2014; Published April 14, 2014
Copyright: ß 2014 Shrivastav et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by National Institutes of Health Grants CA080024, CA26731, ES002109 (to J.M.E.), and CA021615 (to G.C.W.). G.C.W. is an
American Cancer Society Professor. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: jessig@mit.edu
¤a Current address: McKinsey & Company, Philadelphia, Pennsylvania, United States of America
¤b Current address: Visterra Inc., Cambridge, Massachusetts, United States of America
¤c Current address: Agilent Technologies Inc., Wakefield, Massachusetts, United States of America
¤d Current address: Joule Unlimited, Bedford, Massachusetts, United States of America
approach for addressing the impact of such variables on lesion
toxicity and mutagenicity is shown in Figure 1.
The present work explored the in vivo consequences (replication
efficiency and fidelity) and genetic requirements (presence or
absence of bypass polymerases or DNA repair enzymes) of four
N2-guanine DNA alkyl adducts: N2-furfurylguanine (FF), 2tetrahydrofuran-2-yl-methylguanine
(HF),
2-methylguanine
(m2G), and 2-ethylguanine (e2G) (Figure 1A). Previously, we have
shown that the direct reversal DNA repair enzyme AlkB can repair
these lesions in vitro [3]; the present study explored the relevance of
AlkB repair of these lesions in living cells. Additionally, we have
shown that both DinB and pol k are capable of bypassing the FF
lesion in vitro [4]; however, it remained unknown whether the same
Introduction
The genome is vulnerable to damage from exogenous and
endogenous chemical reactions, including alkylation, oxidation,
and deamination [1,2]. Not surprisingly, several different lesion
tolerance and repair pathways have evolved to deal with these
types of DNA damage. DNA adduct bypass by translesion
synthesis (TLS) polymerases allows for genome replication in the
presence of DNA damage, while canonical DNA repair pathways,
which include direct repair, base-excision repair, nucleotideexcision repair, non-homologous end joining and homologous
recombination remove such damage prior to replication. A holistic
PLOS ONE | www.plosone.org
1
April 2014 | Volume 9 | Issue 4 | e94716
DinB Bypasses N2-Alkylguanine Adducts In Vivo
Figure 1. The structures of the N2-alkylguanine lesions and the experimental strategy. (A) The synthesis of the 16-mer oligonucleotides
containing N2-alkylguanine lesions. The lesion-containing 16-mer oligonucleotides were synthesized by using the convertible nucleoside 2-fluoro-O6(trimethylsilylethyl)-29deoxyinosine (bottom). The 2-fluoro atom (shown in blue) was then substituted with an amine group in parallel reactions with
2-fold molar excess of methyl-amine, ethyl-amine, furfurylamine and tetrahydrofurfuryl amine to yield m2G, e2G, FF and HF, respectively (top). See
Materials and Methods for details. (B) Toxicity and mutagenicity assays. To determine the bypass and mutagenic properties N2-alkyl guanine lesions in
vivo, the oligonucleotide 16mers were synthesized and ligated into the genome of M13 bacteriophage, which was then replicated within E. coli cells
lacking or expressing DinB or AlkB protein (4 strains in total). The viral progeny DNA was recovered and analyzed to determine two endpoints: 1) the
relative reduction in progeny from lesion vs. a non-lesion competitor estimated the extent to which the N2-alkylguanine lesions are blocks to DNA
replication; 2) the base composition at the lesion site in the progeny indicated the extent and type of mutations induced by the studied lesions.
doi:10.1371/journal.pone.0094716.g001
mutagenic and carcinogenic in rodent models [22,24] and to cause
free radical damage, strand breaks, and N2-dG adducts in DNA
[25–27]. HF, the saturated analog of FF is included here to study
the effect of aromaticity on bypass and repair of a bulky N2alkylguanine.
In Escherichia coli, the dinB gene encodes the Y family DNA
polymerase pol IV (DinB) [28,29], which is one of the three TLS
polymerases that is part of the SOS pathway [30]. The dinB gene
was first identified as one of the damage inducible genes in E. coli
[31–34], and it is the only Y-family DNA polymerase that is
conserved across all domains of life (bacteria, eukaryotes, and
archaea) [35], a result of selective constraints imposed on the
encoding gene [36]. It is also present at a relatively high
intracellular concentration of 250 molecules per cell, more than
that of DNA pol III (10–30 molecules/cell) and on par with the
level of the b-processivity clamp [37,38]. Upon SOS induction, the
concentration of DinB escalates to 2500 molecules per cell [39].
DinB is implicated in both the insertion and extension steps in the
bypass of lesions that block replicative polymerases [40]. It may
also have a role in alleviating the cytotoxicity of alkyl DNA
adducts as demonstrated by Bjedov et al., who showed that DinB is
essential for the survival of DalkA Dtag cells exposed to the
were true in vivo. Given these previous observations, both AlkB and
DinB were selected as genetic variables for our in vivo chemical
genetics study.
All of the N2-alkylguanine lesions in this study are important
biomarkers or structural mimics of exposure to known mutagens
or carcinogens. The m2G adduct, the smallest alkyl adduct in the
series, is a mimic of the imino or hydroxymethyl adducts formed
by the reaction N2-amino group of guanine with formaldehyde
[5,6]. Classified by the International Agency for Research on
Cancer (IARC) as a human carcinogen [7], formaldehyde is an
ubiquitous pollutant in vehicle exhaust and cigarette smoke and a
common endogenous metabolism byproduct [7]. The m2G
adduct can also form when cellular DNA is exposed to exogenous
[5] or endogenous [8] methylating agents. The e2G DNA adduct
is a well-established biomarker of exposure to acetaldehyde [9–
14]. Acetaldehyde, classified as an animal carcinogen, and as a
possible human carcinogen (group 2B) by IARC [15], is both an
exogenous pollutant in cigarette smoke [16,17] and an endogenous
metabolite of ethanol [18–20]. The FF lesion is a mimic of the N2guanine adduct of nitrofurazone (NFZ) [21], a potent antibacterial
agent commonly used for treating serious skin conditions (burns,
grafts) [22,23]. NFZ reduction metabolites have been shown to be
PLOS ONE | www.plosone.org
2
April 2014 | Volume 9 | Issue 4 | e94716
DinB Bypasses N2-Alkylguanine Adducts In Vivo
stop the P1 infection. Following an additional incubation at 30uC
for 1 h to allow expression of the chloramphenicol gene, the cells
were plated on LB + chloramphenicol (10 mg/ml) plates. After an
overnight incubation at 37uC, colonies were obtained, replated on
LB + chloramphenicol plates and genotype confirmed by PCR.
alkylating agent methyl methanesulfonate [38]. In vitro experiments
have shown that DinB can perform DNA synthesis, with efficiency
and accuracy, across a variety of base modifications [29], such as
FF [4] and N2-(1-carboxyethyl)-29-deoxyguanosine (N2-CEdG)
[41]. In vivo bypass is observed for site-specifically placed
benzo[a]pyrene (BaP) lesions [42–45], and for lesions induced by
chemical treatment of cells with 4-nitroquinoline-1-oxide (4-NQO)
and NFZ [4] as well as incorporation of reactive oxygen speciesderived dNTPs [46,47]. The function of DinB (and also its human
homolog pol k) is of particular importance as cells are exposed to
alkylating agents from both endogenous and exogenous sources,
including cancer, inflammation and chemotherapy [2].
The AlkB enzyme is an Fe(II)- and a-ketoglutarate-dependent
dioxygenase that repairs DNA alkyl lesions by a direct reversal of
damage mechanism as part of the adaptive response in E. coli
[48,49]. Different homologs of AlkB exist in prokaryotic and
eukaryotic species; nine such homologs exist in mammalian cells
(ABH1-8 and FTO). The conservation of this enzyme across
species underlies its importance as a defensive weapon in the
cellular arsenal against DNA and RNA alkyl damage [50,51].
AlkB can efficiently repair all N-methyl lesions on the WatsonCrick base pairing side of the four DNA bases [3]. These
alkyl lesions include the simple adducts of 3-methylcytosine (m3C),
3-ethylcytosine, 1-methyladenine, 1-ethyladenine [52], 3methylthymine, 1-methylguanine [53], as well as the recently
reported 4-methylcytosine, and the four N2-alkylguanines in the
current study (m2G, e2G, FF and HF) [3]. Although AlkB can
repair many of these lesions in a double-stranded DNA context,
AlkB is much more efficient at repairing lesions in single-stranded
DNA [54–56]. In the case of the N2-alkylguanines, we have shown
that in vitro, AlkB repairs these lesions only in single-stranded
DNA; no repair was detected in double-stranded context [3].
In this work, we characterized the in vivo consequences of four
N2-dG lesions as a function of the bypass polymerase DinB and the
DNA repair enzyme AlkB. Using genome site-specific mutagenesis
methods [57], we inserted each of the four N2-dG lesions at a
specific location in single-stranded M13 phage DNA, which was
then introduced into E. coli cell strains proficient or deficient for
DinB and AlkB (a total of 4 possible strains). The mutation
frequencies at the lesion site and bypass efficiencies across the
lesions were measured in vivo using the restriction endonuclease
and postlabeling (REAP) and competitive replication of adduct
bypass (CRAB) assays, respectively [57].
Oligonucleotides
All unmodified oligonucleotides and primers were obtained
from Integrated DNA Technologies (IDT, Coralville, IA) unless
specified otherwise. The lesion-containing 16mer oligonucleotides
of the sequence 59-GAAGACCTXGGCGTCC-39 (where X
denotes an N2-alkylguanine lesion or controls) were synthesized
using phosphoramidite solid-phase methods described before
[3,4,58]. A convertible nucleoside, 2-fluoro-O6-(trimethylsilylethyl)-29deoxyinosine (ChemGenes, Wilmington, MA) was initially incorporated at the X position (Figure 1A). After hydrolysis
from the resin and deprotection with 0.1 M NaOH for 8 h at
25uC, the oligonucleotides were desalted (SepPak, Millipore) and
lyophilized. The 2-fluoro atom was then substituted with an amine
group in parallel reactions with 2-fold molar excess of methylamine, ethyl-amine, furfurylamine and tetrahydrofurfuryl amine
to yield m2G, e2G, FF and HF, respectively. The reactions were
carried out in DMSO, in the presence of N,N-diisopropylethylamine (5X molar excess) at 60uC for 12 h. Finally, the
trimethylsilylethyl group was removed with by treatment with an
excess solution of 5% acetic acid at room temperature for 4 h. The
deprotected oligonucleotides were purified by reversed-phase
HPLC using an analytical column (Varian Microsorb-MV 100-5
C18 25064.6 mm) at a flow of 1 ml/min and a gradient of 0 to
30% B over 60 min (A: 100 mM triethylammonium acetate; B:
100% acetonitrile).
Sixteen-mer oligonucleotides with the above sequence but with
X = G, A, T, or C, were used as controls. Scaffold oligonucleotides
(59 GGTCTTCCACTGAATCATGGTCATAC 39 and 59
AAAACGACGGCCAGTGAATTGGACGC 39) were used to
ligate the 16mers into the M13 vector. The 19-mer of the sequence
59GAAGACCTGGTAGCGCAGG 39 was used to construct the
‘‘+3 competitor’’ for the CRAB assay.
DinB status of the constructed cell lines was confirmed using the
upstream primer 59 GATTATGGTGCTGACCAAAAGTGCG
39 and the downstream primer 59 CGCTGGCACTTAAGAGATATCCTGCGGG 39. The M13 progeny DNA was amplified in
the CRAB/REAP assays using the following: 59 YCAGCTATGACCATGATTCAGTGGAAGAC 39 (CRAP/REAP forward
primer), 59 YCAGGGTTTTCCCAGTCACGACGTTGTAA-39
(CRAB reverse primer) and 59 YTGTAAAACGACGGCCAGTGAATTGGACG 39 (REAP reverse primer).
Materials and Methods
Cell strains
All the E. coli strains used in this work contain the F9 episome,
which enables infection by M13 phage. GW5100 strain was used
for large scale preparation of M13 phage DNA; SCS110 (JM110,
endA1) was used for amplification of progeny phage postelectroporation; NR9050 strain was used for double agar plating
with X-gal for blue-clear detection of plaques. HK81 (as AB1157,
but nalA) and HK82 (as AB1157, but nalA alkB22; AlkB-deficient)
were the DinB+AlkB+ and DinB+AlkB2 strains used in the study.
P1 vir phage transduction was used to create HK83 (as HK81,
but dinB-deficient) and HK84 (as HK82, but dinB-deficient).
Briefly, recipient cells (HK81 and HK82) from 1 ml of overnight
saturated cultures were resuspended in 500 ml LB containing
10 mM MgSO4 and 5 mM CaCl2. Approximately 100 ml of these
solutions were mixed with 0, 25, 50, or 100 ml of P1 lysate
containing a chloramphenicol resistance gene (cam) flanked by frt
sequences designed for insertion at the dinB site. After 30 min
incubation at 30uC, 100 ml of 1 M sodium citrate was added to
PLOS ONE | www.plosone.org
Enzymes and chemicals
All restriction enzymes, T4 DNA Ligase, T4 DNA polymerase
and their enzyme reaction buffers were from New England
Biolabs. Shrimp alkaline phosphatase (SAP) was from Roche. P1
nuclease, 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside
(X-gal) and isopropyl b-D-1-thiogalactopyranoside (IPTG) were
from Sigma Aldrich. T4 Polynucleotide kinase was from
Affymetrix. Sephadex G-50 Fine resin was from Amersham
Biosciences. Hydroxylapatite resin, 19:1 acrylamide:bisacrylamide
solution, and N,N,N9,N9-tetra-methyl-ethylenediamine (TEMED)
were from Bio-Rad. Phenol:chloroform:isoamyl alcohol (25:24:1;
pH 8) was from Invitrogen. 32P-c-ATP was from Perkin Elmer.
Non-radioactive ATP was from GE Healthcare Lifesciences.
3
April 2014 | Volume 9 | Issue 4 | e94716
DinB Bypasses N2-Alkylguanine Adducts In Vivo
itor genome indicates the relative amount of replication from
the lesion-bearing genome. A decrease in the lesion:competitor
output ratio signifies a lesion-induced replication block (i.e.,
lower bypass efficiency). The competitor genome, lacking a
replication-inhibiting lesion, acts as an internal standard in this
competitive assay. The CRAB assay was performed on the N2dG lesions (m2G, e2G, FF, and HF) in E. coli strains that
capture all possible combinations of DinB and AlkB proficiency/deficiency (a total of 4 strains). The genomes of m3C, a
good substrate for AlkB both in vivo and in vitro [53], and
unmodified ‘‘G’’ were used as controls.
The results of the CRAB assay for toxicity are summarized in
Figure 2 and Table S1 in File S1. To tease out the relative
contribution of each genetic variable (DinB and AlkB) to the
bypass efficiency of N2-dG lesions, data were graphed in pairs in
which one of the variables was kept constant. Based on the
previously reported in vitro findings, it was hypothesized that both
DinB and AlkB might act on N2-dG lesions; therefore, the most
relevant pair wise comparisons are those in which one of these
enzymes is knocked out. To understand the effect of DinB on the
in vivo bypass of N2-dG lesions (independent of AlkB), the two
AlkB2 strains were compared (AlkB2DinB2 vs. AlkB2DinB+)
(Figure 2A). To understand the effect of AlkB (independent of
DinB), the two DinB2 strains were compared (AlkB2DinB2 vs.
AlkB+DinB2).
In the absence of DinB, the bulky lesions FF and HF are
strong blocks to replication, with measured bypass efficiencies
of only 36% and 40%, respectively (Figure 2A). However, the
presence of DinB more than doubled the bypass efficiencies of
FF and HF to ,99% (p-value = 0.0006) and ,87% (p-value
= 0.0015), respectively (Figure 2A), thus greatly relieving the
replication block. By contrast, the presence of AlkB did not
change the bypass efficiencies of FF and HF; no significant
difference in bypass was observed between the two DinB2
strains (Figure 2B). This finding was unexpected, given that
AlkB is biochemically competent to repair the FF and HF
lesions in vitro [59]. Possible reasons for AlkB’s lack of effect on
the bypass efficiencies of FF and HF are included in the
discussion section.
The simple-alkyl lesions m2G and e2G were not significant
replication blocks in the double mutant strain (AlkB2DinB2); the
presence of DinB (Figure 2A), AlkB (Figure 2B) or both (Table S1
in File S1) did not significantly change the relative bypass of these
lesions. From the point of view of this assay, these two modified
guanines behave like a normal guanine, being virtually invisible to
the replication machinery.
Consistent with previously published data [53], the m3C lesion
was a good control for AlkB activity. In AlkB2 strains, m3C was a
very strong block to replication (relative bypass ,10%). The
presence of DinB did not alleviate the toxicity of m3C (Figure 2A).
However, in AlkB+ strains, the relative bypass of m3C jumped to
,100%, consistent with the expectation that this lesion is
efficiently repaired by AlkB, before being encountered by
replicating polymerases.
Construction of genomes
M13mp7(L2) phage single-stranded DNA starting material
was isolated as described previously [57] (See Supporting
Methods S1 in File S1). The oligonucleotides containing sitespecific lesions were subsequently cloned in using reported
methods [57]. Briefly, M13 single-stranded wild-type genomes
were linearized with EcoRI, and scaffolds annealed to the
ends. The16-mer oligonucleotide inserts were then annealed
and ligated using T4 DNA ligase. The exonuclease activity of
the T4 DNA polymerase was then used to digest the scaffolds.
Finally, the constructed genomes were purified using
phenol extraction and three TE washes in Microsep 100K
spin dialysis columns. For details, see Supporting Methods S1
in File S1.
Lesion bypass and mutagenesis assays
The relative bypass of each lesion was measured using the
CRAB assay; mutational analysis was performed by using the
REAP assay [57]. Briefly, the constructed viral genomes were
first normalized using an established protocol [57]. Each
lesion-containing genome was then mixed with the ‘‘+3’’
competitor genome in a 75:25 ratio (ratio empirically
determined, see Supporting Methods S1 in File S1) and then
electroporated into E. coli strains of all combinations of AlkB
and DinB proficiency and deficiency. After 6 h incubation at
37uC, the progeny phage were isolated and amplified by
infecting SCS110 wild-type cells, to dilute out any lesioncontaining genomes that did not electroporate and replicate in
cells. Single-stranded M13 DNA was then isolated from the
amplified progeny, using the M13 Qiaprep columns (Qiagen).
The region of interest was then PCR amplified using the
CRAB primers for the lesion bypass assay, or the REAP
primers for the mutagenesis assay. The PCR products were
subsequently digested with BbsI, HaeIII and radiolabeled to
yield an 18-mer DNA fragment that contains at its 59 end the
specific site that initially contained the lesion of interest. The
‘‘+3’’ competitor genome was only amplified by the CRAB
primers and yielded a 21-mer fragment. To quantitate the
lesion bypass, the ratio between the intensities of the 18-mer
and 21-mer fragments was determined and normalized to the
ratio of the same bands for the unmodified ‘‘G’’ control,
considered 100% bypass. To analyze the mutagenicity of a
lesion, the radiolabeled 18-mer band was cut out from the gel
and digested to single nucleotide monophosphates with
nuclease P1. The nucleotides were then separated on PEITLC plates using a saturated solution of ammonium phosphate
(pH = 5.8), and the radioactive signals quantitated using
phosphorimagery. An approximately equimolar of GATC
control genome mixture, which yielded four distinct TLC
spots corresponding to the four normal nucleotides, was used
as a mixture of standards. The detailed protocols for the
CRAB and REAP assays are included in the Supporting
Methods S1 in File S1.
Results
DinB Bypasses FF and HF Lesions In Vivo
The N2-dG Lesions are Not Significantly Mutagenic in any
Cell Strain
The CRAB assay is a quantitative tool used to determine to
what extent a given lesion blocks DNA replication in vivo
(Figure 1B) [57]. In essence, a lesion-bearing genome is mixed
with a nonlesion competitor genome in a specific input ratio
and replicated in E. coli cells of a given repair/bypass genetic
background. The output ratio of progeny phage from the
lesion-bearing genome with respect to the nonlesion compet-
The REAP assay determines the mutation frequency and
mutation type after the lesion of interest has been processed by the
intracellular replication machinery [57]. The REAP assay was
performed on all of the N2-dG lesions, the control m3C,
unmodified G, and an approximately equimolar mixture of
genomes carrying unmodified ‘G’, ‘A’, ‘T’, and ‘C’ bases at the
lesion site (denoted as GATC, Figure 3).
PLOS ONE | www.plosone.org
4
April 2014 | Volume 9 | Issue 4 | e94716
DinB Bypasses N2-Alkylguanine Adducts In Vivo
Figure 2. Bypass efficiency of m2G, e2G, FF, and HF as a function of DinB status (A) or AlkB status (B). M13 genomes containing the four
N2-alkylguanine lesions were constructed and normalized to one another before being combined with a competitor genome; genomes containing
m3C and undamaged G were used as controls. Each mixture was transformed into the E. coli cell strains indicated at the top of each graph in
triplicate, and bypass efficiencies were calculated by using the signal from the undamaged G genome mixture as 100% bypass; error bars represent
one standard deviation. For the FF and HF lesions, the significance of the difference between two populations was tested using the Student’s twotailed t test. (*** indicates p-value ,0.001, N.S. indicates not significant). All bypass data are summarized in Table S1 in File S1.
doi:10.1371/journal.pone.0094716.g002
cell strains (Table S2 in File S1), but this mutation frequency is not
statistically different from the control genome baseline.
One could not predict a priori whether or not these lesions
would be mutagenic in vivo, but the results clearly show that none
of the N2-dG lesions are significantly mutagenic in the presence or
absence of DinB or AlkB (Figure 3 and Table S2 in File S1). HF
and FF show mutation frequencies of ,1% regardless of DinB
status, which is essentially the same as the mutation frequency we
detected for the control genome having a normal G at the lesion
site. m2G and e2G also show a small non-G signal of 1 to 4% in all
Discussion
The Effect of DinB on N2-dG Lesions
In this study, the role of the E. coli DNA TLS polymerase DinB
in bypassing a spectrum of N2-alkylguanine lesions in vivo was
investigated. In 2006, it was discovered that in vitro, the TLS
Figure 3. Mutagenesis of m2G, e2G, FF, and HF in the four strains of E. coli cells lacking or expressing DinB or AlkB. Each panel (A to
D) corresponds to the E.coli strain indicated at the top of the graph. Genomes containing m3C, undamaged G, and an approximately equimolar
mixture of unmodified G/A/T/C bases at the site of inquiry (denoted as GATC) were used as controls. Genomes containing the lesions of interest were
transfected into E. coli in triplicate. The percentage of G, A, T, and C at the lesion site reveals the mutagenicity of the lesions, with error bars
representing one standard deviation. All mutagenesis data are summarized in Table S2 in File S1.
doi:10.1371/journal.pone.0094716.g003
PLOS ONE | www.plosone.org
5
April 2014 | Volume 9 | Issue 4 | e94716
DinB Bypasses N2-Alkylguanine Adducts In Vivo
pol k, as deduced from X-ray crystal structure studies of the
catalytic core of the polymerase with a primer-template DNA and
an incoming nucleotide; the structure reveals the lack of a ‘‘steric
gate’’ in scanning the minor groove at the primer-template
junction [70]. It is proposed that DinB can accommodate minor
groove lesions to enable bypass with correct base pairing, even for
lesions such as BaP [45], containing alkyl groups much bulkier
than those used in the current study.
The FF and HF lesions, while they are strong replication blocks,
are not mutagenic in any repair/bypass background; these results
can be explained by the availability of a hydrogen atom at the N2
position of guanine and the possibility of free rotation around
guanine’s exocyclic nitrogen-carbon bond. This free rotation can
generate a guanine-like Watson-Crick hydrogen bonding pattern
with cytosine. In addition, free rotation around the carbonnitrogen bond would enable the extraneous alkyl group,
irrespective of size, to swivel away from the base pairing face of
guanine into the minor groove, thus alleviating steric hindrance
caused by attachments to the N2 position. Similar freely rotating
small alkyl modifications, such as N6-methyladenine and N4methylcytosine, are very well tolerated and even utilized as DNA
replication biomarkers in prokaryotic cells [71]. Alternative
mechanisms to explain the correct base pairing of N2-dG lesions
with cytosine, such as ‘wobble’ base pairing [63], or Hoogsteen
base pairing [62,72] have been proposed or observed. However,
for an N2-dG lesion to pair correctly with a cytosine using either
mechanism, the cytosine base has to be in its protonated form (for
Hoogsteen base pairing), or its imine tautomeric form (for wobble
base pairing), which is rarely observed in duplex DNA under
physiological conditions.
polymerase DinB efficiently bypasses the FF adduct (Figure 1A), a
homolog of the major adduct formed by the reaction of NFZ with
guanine [4]. Catalytically, DinB is about 15-fold more proficient at
inserting a cytosine opposite the FF adduct than opposite
undamaged guanine [4]. Additionally, due to its increased affinity
for dCTP, DinB is 25-fold more efficient at extending beyond a
cytosine opposite the FF lesion than opposite guanine [40]. The
current study is the first in vivo quantitative analysis of the
mutagenic and toxic properties of the FF lesion and its saturated
homolog HF, as a function of the DinB genotype of the cell. The
key findings of this study are: 1) FF and HF are strong blocks to
replication when introduced in DinB2 cells on a single-stranded
vector; 2) The replication inhibition caused by FF and HF is
substantially alleviated by the presence of DinB in vivo, further
supporting the role of DinB in N2-alkylguanine lesion bypass
observed previously in vitro [4]; 3) The lesion bypass occurs in an
error-free manner, as the correct base (cytosine) is always inserted
opposite the guanine lesions by DinB. This last finding is also in
concordance with previously published in vitro bypass results
[4,40]. Taken together with the in vitro data available for DinB and
its homologs, the current study suggests that these Y-family
polymerases bypass bulky N2-guanine adducts, such as the one
formed by NFZ, in an error-free manner, in vivo. Given that NFZ is
an antibiotic, DinB may be an important biochemical shield
evolved for the defense of E. coli against certain types of ‘chemical
warfare’ from other species. This finding is also consistent with the
proposed role of DinB in transcription-coupled translesion
synthesis across N2-dG lesions formed by NFZ [60]. It is worth
noting that, while FF and HF are strong blocks to replication in
the absence of DinB, the level of bypass detected in the DinB2
cells (28 to 40%) was higher than that seen for the concurrently
run positive control m3C (,10%) or other alkyl lesions (i.e., m1G
or m3T) tested previously in AlkB-negative cells [53]. One possible
explanation is that there might be other bypass/repair mechanisms at play (i.e., Pol V) that assist with lesion tolerance in the
absence of DinB to the extent observed in this study. While it has
been proposed that nucleotide excision repair (and not TLS) might
be the primary repair pathway that deals with NFZ-induced
damage [61], that pathway requires a double-stranded DNA
context, which is obviated by our experimental system that utilizes
single-stranded M13 genomes.
In contrast to the bulky FF and HF lesions, the small N2alkylguanine lesions m2G and e2G were neither replication blocks
nor were they mutagenic in any of the E. coli cells tested. Since no
replication inhibition was seen in DinB2 cells, the presence of
DinB did not change the bypass efficiencies of m2G and e2G; in
fact, there is no evidence that DinB was actually recruited at the
replication fork, when m2G or e2G lesions were encountered. This
in vivo result under physiological conditions is in contrast with what
has been observed for e2G in in vitro assays with other Y-family
and replicative polymerases [62–64]. It could be that there is
another enzyme or enzymes that preferentially and efficiently
repairs or bypasses these lesions such that the supplementary role
of DinB in the bypass of m2G and e2G is overshadowed beyond
the detection limit of our assay.
One possible explanation for the non-toxic phenotype of FF and
HF seen in DinB+ cells is that DinB can tolerate the N2-alkyl dG
lesions. These lesions can occupy the minor groove of DNA [65]
and interfere with polymerase-minor groove interactions [66–68],
should the alkyl group swivel near the N3 atom of guanine. Several
B-family polymerases are known to have a conserved motif that
scans the DNA minor groove for lesions and misincorporations
[69], which is lacking in the Y-family DNA polymerases. It is
speculated that this may be the case for the Y-family mammalian
PLOS ONE | www.plosone.org
The Effect of AlkB on N2-dG Lesions
A number of N2-dG lesions were tested as possible substrates for
AlkB, in line with the theme of this study on the cellular processing
of N2-guanine DNA lesions. While all the four N2-dG lesions
studied are repaired by AlkB in vitro [59], the results from this study
show that AlkB does not have a discernible effect on either the
polymerase bypass or mutagenicity of these lesions in vivo. FF and
HF are replication blocks in the absence of DinB (Figure 2A and
Table S1 in File S1). While the presence of DinB alleviates the
replication inhibition, AlkB has no significant effect on the bypass
efficiencies of FF and HF lesions in DinB2 cells (Figure 2B and
Table S1 in File S1). There are two possible explanations for these
experimental observations: 1) Given AlkB’s low cellular concentration (2 molecules/cell) [73], it does not effectively repair the
bulky HF and FF lesions in vivo, before they are encountered by the
replication machinery; or 2) AlkB does perform the initial
oxidation step on these lesions, but the subsequent intermediates,
(such as FF-2H and HO-HF, described in our previous paper
[59]), may be long-lived and equally strong replication blocks. By
contrast, the smaller N2-dG lesions (m2G and e2G) were not toxic
or mutagenic in any of the four cell strains studied (Figures 2 and
3). This suggests that at least in AlkB2 cells, a mechanism of
tolerance of small minor groove lesions by replicative polymerases
is operating; as mentioned above, these lesions may rotate into the
minor groove during replication [59,70]. However, effective repair
of m2G or e2G by AlkB in vivo may still occur in the AlkB+ cell
strains, supplementing the free rotation mechanism.
In conclusion, this work demonstrates that inside living cells,
DNA adduct bypass by DinB is the mechanism of choice to
overcome the deleterious consequences of bulky N2-dG adducts,
such as FF and HF. While we have shown that AlkB can repair
these lesions and the simpler m2G and e2G adducts in vitro, the
AlkB effect on FF and HF in vivo is not significant, possibly because
6
April 2014 | Volume 9 | Issue 4 | e94716
DinB Bypasses N2-Alkylguanine Adducts In Vivo
the repair intermediates are also strong replication blocks, longlived and not cleared efficiently before encountering replication
machinery. Our study highlights the fact that even though multiple
DNA repair or tolerance pathways can act on N2-alkylguanine
DNA lesions in vitro, one pathway, lesion bypass, is the preferred
mechanism for maintaining genomic integrity in vivo.
Acknowledgments
Supporting Information
Author Contributions
File S1 Supporting Methods S1, Supporting Tables S1–S2 and
Supporting References.
(PDF)
Conceived and designed the experiments: NS BIF DL JCD LEF JJF GCW
JME. Performed the experiments: NS BIF DL JCD LEF JJF. Analyzed the
data: NS BIF DL JCD JME. Contributed reagents/materials/analysis
tools: LEF JJF. Wrote the paper: NS BIF DL JCD LEF JJF GCW JME.
We thank the Tannenbaum/Wishnok Laboratory and the MIT Center for
Environmental Health Sciences for providing the ESI-TOF Mass
spectrometry facility and Agilent Technologies for providing the UHPLC
system. We also thank Dr. John. S. Wishnok and Dr. Vipender Singh for
helpful discussions.
References
20. Balbo S, Meng L, Bliss RL, Jensen JA, Hatsukami DK, et al. (2012) Time course
of DNA adduct formation in peripheral blood granulocytes and lymphocytes
after drinking alcohol. Mutagenesis 27: 485–490. doi:10.1093/mutage/ges008.
21. Jarosz DF (2007) Novel function and regulation of mutagenic DNA polymerases
in Escherichia coli. Massachusetts Institute of Technology: PhD Thesis.
Available: http://dspace.mit.edu/handle/1721.1/39742. Accessed 5 December
2012.
22. Hiraku Y, Sekine A, Nabeshi H, Midorikawa K, Murata M, et al. (2004)
Mechanism of carcinogenesis induced by a veterinary antimicrobial drug,
nitrofurazone, via oxidative DNA damage and cell proliferation. Cancer Lett
215: 141–150. doi:10.1016/j.canlet.2004.05.016.
23. Rodgers GL, Mortensen JE, Fisher MC, Long SS (1997) In vitro susceptibility
testing of topical antimicrobial agents used in pediatric burn patients:
comparison of two methods. J Burn Care Rehabil 18: 406–410.
24. Takegawa K, Mitsumori K, Yasuhara K, Moriyasu M, Sakamori M, et al.
(2000) A mechanistic study of ovarian carcinogenesis induced by nitrofurazone
using rasH2 mice. Toxicol Pathol 28: 649–655.
25. McCalla DR, Reuvers A, Kaiser C (1971) Breakage of bacterial DNA by
nitrofuran derivatives. Cancer Res 31: 2184–2188.
26. Tu Y, McCalla DR (1975) Effect of activated nitrofurans on DNA. Biochim
Biophys Acta 402: 142–149.
27. Zampieri A, Greenberg J (1964) Nitrofurazone as a mutagen in Escherichia coli.
Biochem Biophys Res Commun 14: 172–176.
28. Wagner J, Gruz P, Kim SR, Yamada M, Matsui K, et al. (1999) The dinB gene
encodes a novel E. coli DNA polymerase, DNA pol IV, involved in mutagenesis.
Mol Cell 4: 281–286.
29. Walsh JM, Hawver LA, Beuning PJ (2011) Escherichia coli Y family DNA
polymerases. Front Biosci J Virtual Libr 16: 3164–3182.
30. Friedberg EC (2006) DNA Repair And Mutagenesis 2nd ed. Washington DC:
ASM Press. 1118 p.
31. Kenyon CJ, Walker GC (1980) DNA-damaging agents stimulate gene expression
at specific loci in Escherichia coli. Proc Natl Acad Sci U S A 77: 2819–2823.
32. Brotcorne-Lannoye A, Maenhaut-Michel G (1986) Role of RecA protein in
untargeted UV mutagenesis of bacteriophage lambda: evidence for the
requirement for the dinB gene. Proc Natl Acad Sci U S A 83: 3904–3908.
33. Kim SR, Maenhaut-Michel G, Yamada M, Yamamoto Y, Matsui K, et al.
(1997) Multiple pathways for SOS-induced mutagenesis in Escherichia coli: an
overexpression of dinB/dinP results in strongly enhancing mutagenesis in the
absence of any exogenous treatment to damage DNA. Proc Natl Acad Sci U S A
94: 13792–13797.
34. Wagner J, Nohmi T (2000) Escherichia coli DNA polymerase IV mutator
activity: genetic requirements and mutational specificity. J Bacteriol 182: 4587–
4595.
35. Ohmori H, Friedberg EC, Fuchs RP, Goodman MF, Hanaoka F, et al. (2001)
The Y-family of DNA polymerases. Mol Cell 8: 7–8.
36. Bjedov I, Lecointre G, Tenaillon O, Vaury C, Radman M, et al. (2003)
Polymorphism of genes encoding SOS polymerases in natural populations of
Escherichia coli. DNA Repair 2: 417–426.
37. Benson RW, Norton MD, Lin I, Du Comb WS, Godoy VG (2011) An active site
aromatic triad in Escherichia coli DNA Pol IV coordinates cell survival and
mutagenesis in different DNA damaging agents. PloS One 6: e19944.
doi:10.1371/journal.pone.0019944.
38. Bjedov I, Dasgupta CN, Slade D, Le Blastier S, Selva M, et al. (2007)
Involvement of Escherichia coli DNA polymerase IV in tolerance of cytotoxic
alkylating DNA lesions in vivo. Genetics 176: 1431–1440. doi:10.1534/
genetics.107.072405.
39. Fuchs RP, Fujii S, Wagner J (2004) Properties and functions of Escherichia coli:
Pol IV and Pol V. Adv Protein Chem 69: 229–264. doi:10.1016/S00653233(04)69008-5.
40. Jarosz DF, Cohen SE, Delaney JC, Essigmann JM, Walker GC (2009) A DinB
variant reveals diverse physiological consequences of incomplete TLS extension
by a Y-family DNA polymerase. Proc Natl Acad Sci U S A 106: 21137–21142.
doi:10.1073/pnas.0907257106.
41. Yuan B, Cao H, Jiang Y, Hong H, Wang Y (2008) Efficient and accurate bypass
of N2-(1-carboxyethyl)-29-deoxyguanosine by DinB DNA polymerase in vitro
1. Loeb LA, Harris CC (2008) Advances in chemical carcinogenesis: a historical
review and prospective. Cancer Res 68: 6863–6872. doi:10.1158/00085472.CAN-08-2852.
2. Shrivastav N, Li D, Essigmann JM (2010) Chemical biology of mutagenesis and
DNA repair: cellular responses to DNA alkylation. Carcinogenesis 31: 59–70.
doi:10.1093/carcin/bgp262.
3. Li D, Fedeles BI, Shrivastav N, Delaney JC, Yang X, et al. (2013) Removal of NAlkyl Modifications from N(2)-Alkylguanine and N(4)-Alkylcytosine in DNA by
the Adaptive Response Protein AlkB. Chem Res Toxicol 26: 1182–1187.
doi:10.1021/tx400096m.
4. Jarosz DF, Godoy VG, Delaney JC, Essigmann JM, Walker GC (2006) A single
amino acid governs enhanced activity of DinB DNA polymerases on damaged
templates. Nature 439: 225–228. doi:10.1038/nature04318.
5. Lu K, Craft S, Nakamura J, Moeller BC, Swenberg JA (2012) Use of LC-MS/
MS and stable isotopes to differentiate hydroxymethyl and methyl DNA adducts
from formaldehyde and nitrosodimethylamine. Chem Res Toxicol 25: 664–675.
doi:10.1021/tx200426b.
6. McGhee JD, von Hippel PH (1975) Formaldehyde as a probe of DNA structure.
I. Reaction with exocyclic amino groups of DNA bases. Biochemistry (Mosc) 14:
1281–1296.
7. International Agency for Research on Cancer (2006) Formaldehyde, 2butoxyethanol and 1-tert-butoxypropan-2-ol. IARC Monogr EvalCarcinogRisks
Hum 88: 1–478.
8. Crean C, Geacintov NE, Shafirovich V (2009) Methylation of 29-deoxyguanosine by a free radical mechanism. J Phys Chem B 113: 12773–12781.
doi:10.1021/jp903554n.
9. Brooks PJ, Theruvathu JA (2005) DNA adducts from acetaldehyde: implications
for alcohol-related carcinogenesis. Alcohol Fayettev N 35: 187–193.
doi:10.1016/j.alcohol.2005.03.009.
10. Wang M, Yu N, Chen L, Villalta PW, Hochalter JB, et al. (2006) Identification
of an acetaldehyde adduct in human liver DNA and quantitation as N2ethyldeoxyguanosine. Chem Res Toxicol 19: 319–324. doi:10.1021/tx0502948.
11. Upton DC, Wang X, Blans P, Perrino FW, Fishbein JC, et al. (2006) Replication
of N2-ethyldeoxyguanosine DNA adducts in the human embryonic kidney cell
line 293. Chem Res Toxicol 19: 960–967. doi:10.1021/tx060084a.
12. Terashima I, Matsuda T, Fang TW, Suzuki N, Kobayashi J, et al. (2001)
Miscoding potential of the N2-ethyl-29-deoxyguanosine DNA adduct by the
exonuclease-free Klenow fragment of Escherichia coli DNA polymerase I.
Biochemistry (Mosc) 40: 4106–4114.
13. Matter B, Guza R, Zhao J, Li Z, Jones R, et al. (2007) Sequence distribution of
acetaldehyde-derived N2-ethyl-dG adducts along duplex DNA. Chem Res
Toxicol 20: 1379–1387. doi:10.1021/tx7001146.
14. Cheng T-F, Hu X, Gnatt A, Brooks PJ (2008) Differential blocking effects of the
acetaldehyde-derived DNA lesion N2-ethyl-29-deoxyguanosine on transcription
by multisubunit and single subunit RNA polymerases. J Biol Chem 283: 27820–
27828. doi:10.1074/jbc.M804086200.
15. International Agency for Research on Cancer (1999) Acetaldehyde. IARC
Monogr Eval Carcinog Risks Hum World Health Organ Int Agency Res Cancer
71 Pt 2: 319–335.
16. Cheah NP, Pennings JLA, Vermeulen JP, van Schooten FJ, Opperhuizen A
(2013) In vitro effects of aldehydes present in tobacco smoke on gene expression
in human lung alveolar epithelial cells. Toxicol Vitro Int J Publ Assoc BIBRA
27: 1072–1081. doi:10.1016/j.tiv.2013.02.003.
17. Singh R, Sandhu J, Kaur B, Juren T, Steward WP, et al. (2009) Evaluation of
the DNA damaging potential of cannabis cigarette smoke by the determination
of acetaldehyde derived N2-ethyl-29-deoxyguanosine adducts. Chem Res
Toxicol 22: 1181–1188. doi:10.1021/tx900106y.
18. Abraham J, Balbo S, Crabb D, Brooks PJ (2011) Alcohol metabolism in human
cells causes DNA damage and activates the Fanconi anemia-breast cancer
susceptibility (FA-BRCA) DNA damage response network. Alcohol Clin Exp
Res 35: 2113–2120. doi:10.1111/j.1530-0277.2011.01563.x.
19. Singh R, Gromadzinska J, Mistry Y, Cordell R, Juren T, et al. (2012) Detection
of acetaldehyde derived N(2)-ethyl-29-deoxyguanosine in human leukocyte DNA
following alcohol consumption. Mutat Res 737: 8–11. doi:10.1016/
j.mrfmmm.2012.07.001.
PLOS ONE | www.plosone.org
7
April 2014 | Volume 9 | Issue 4 | e94716
DinB Bypasses N2-Alkylguanine Adducts In Vivo
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57. Delaney JC, Essigmann JM (2006) Assays for determining lesion bypass
efficiency and mutagenicity of site-specific DNA lesions in vivo. Methods
Enzymol 408: 1–15. doi:10.1016/S0076-6879(06)08001-3.
58. Delaney JC, Smeester L, Wong C, Frick LE, Taghizadeh K, et al. (2005) AlkB
reverses etheno DNA lesions caused by lipid oxidation in vitro and in vivo. Nat
Struct Mol Biol 12: 855–860. doi:10.1038/nsmb996.
59. Li D, Fedeles BI, Shrivastav N, Delaney JC, Yang X, et al. (2013) Removal of NAlkyl Modifications from N(2)-Alkylguanine and N(4)-Alkylcytosine in DNA by
the Adaptive Response Protein AlkB. Chem Res Toxicol. doi:10.1021/
tx400096m.
60. Cohen SE, Walker GC (2011) New discoveries linking transcription to DNA
repair and damage tolerance pathways. Transcription 2: 37–40. doi:10.4161/
trns.2.1.14228.
61. Ona KR, Courcelle CT, Courcelle J (2009) Nucleotide excision repair is a
predominant mechanism for processing nitrofurazone-induced DNA damage in
Escherichia coli. J Bacteriol 191: 4959–4965. doi:10.1128/JB.00495-09.
62. Pence MG, Blans P, Zink CN, Fishbein JC, Perrino FW (2011) Bypass of N2ethylguanine by human DNA polymerase k. DNA Repair 10: 56–64.
doi:10.1016/j.dnarep.2010.09.007.
63. Pence MG, Blans P, Zink CN, Hollis T, Fishbein JC, et al. (2009) Lesion bypass
of N2-ethylguanine by human DNA polymerase iota. J Biol Chem 284: 1732–
1740. doi:10.1074/jbc.M807296200.
64. Perrino FW, Blans P, Harvey S, Gelhaus SL, McGrath C, et al. (2003) The N2ethylguanine and the O6-ethyl- and O6-methylguanine lesions in DNA:
contrasting responses from the ‘‘bypass’’ DNA polymerase eta and the
replicative DNA polymerase alpha. Chem Res Toxicol 16: 1616–1623.
doi:10.1021/tx034164f.
65. Seeman NC, Rosenberg JM, Rich A (1976) Sequence-specific recognition of
double helical nucleic acids by proteins. Proc Natl Acad Sci U S A 73: 804–808.
66. Kool ET (2002) Active site tightness and substrate fit in DNA replication. Annu
Rev Biochem 71: 191–219. doi:10.1146/annurev.biochem.71.110601.135453.
67. McCain MD, Meyer AS, Schultz SS, Glekas A, Spratt TE (2005) Fidelity of
mispair formation and mispair extension is dependent on the interaction
between the minor groove of the primer terminus and Arg668 of DNA
polymerase I of Escherichia coli. Biochemistry (Mosc) 44: 5647–5659.
doi:10.1021/bi047460f.
68. Morales JC, Kool ET (1999) Minor Groove Interactions between Polymerase
and DNA: More Essential to Replication than Watson-Crick Hydrogen Bonds?
J Am Chem Soc 121: 2323–2324. doi:10.1021/ja983502+.
69. Swan MK, Johnson RE, Prakash L, Prakash S, Aggarwal AK (2009) Structural
basis of high-fidelity DNA synthesis by yeast DNA polymerase delta. Nat Struct
Mol Biol 16: 979–986. doi:10.1038/nsmb.1663.
70. Lone S, Townson SA, Uljon SN, Johnson RE, Brahma A, et al. (2007) Human
DNA polymerase kappa encircles DNA: implications for mismatch extension
and lesion bypass. Mol Cell 25: 601–614. doi:10.1016/j.molcel.2007.01.018.
71. Wion D, Casadesús J (2006) N6-methyl-adenine: an epigenetic signal for DNAprotein interactions. Nat Rev Microbiol 4: 183–192. doi:10.1038/nrmicro1350.
72. Choi J-Y, Angel KC, Guengerich FP (2006) Translesion synthesis across bulky
N2-alkyl guanine DNA adducts by human DNA polymerase kappa. J Biol Chem
281: 21062–21072. doi:10.1074/jbc.M602246200.
73. Nieminuszczy J, Grzesiuk E (2007) Bacterial DNA repair genes and their
eukaryotic homologues: 3. AlkB dioxygenase and Ada methyltransferase in the
direct repair of alkylated DNA. Acta Biochim Pol 54: 459–468.
and in vivo. Proc Natl Acad Sci U S A 105: 8679–8684. doi:10.1073/
pnas.0711546105.
Napolitano R, Janel-Bintz R, Wagner J, Fuchs RP (2000) All three SOSinducible DNA polymerases (Pol II, Pol IV and Pol V) are involved in induced
mutagenesis. EMBO J 19: 6259–6265. doi:10.1093/emboj/19.22.6259.
Seo KY, Nagalingam A, Miri S, Yin J, Chandani S, et al. (2006) Mirror image
stereoisomers of the major benzo[a]pyrene N2-dG adduct are bypassed by
different lesion-bypass DNA polymerases in E. coli. DNA Repair 5: 515–522.
doi:10.1016/j.dnarep.2005.12.009.
Benasutti M, Ezzedine ZD, Loechler EL (1988) Construction of an Escherichia
coli vector containing the major DNA adduct of activated benzo[a]pyrene at a
defined site. Chem Res Toxicol 1: 160–168.
Chandani S, Loechler EL (2009) Y-Family DNA polymerases may use two
different dNTP shapes for insertion: a hypothesis and its implications. J Mol
Graph Model 27: 759–769. doi:10.1016/j.jmgm.2008.11.003.
Katafuchi A, Sassa A, Niimi N, Grúz P, Fujimoto H, et al. (2010) Critical amino
acids in human DNA polymerases eta and kappa involved in erroneous
incorporation of oxidized nucleotides. Nucleic Acids Res 38: 859–867.
doi:10.1093/nar/gkp1095.
Yamada M, Nunoshiba T, Shimizu M, Gruz P, Kamiya H, et al. (2006)
Involvement of Y-family DNA polymerases in mutagenesis caused by oxidized
nucleotides in Escherichia coli. J Bacteriol 188: 4992–4995. doi:10.1128/
JB.00281-06.
Yi C, Yang C-G, He C (2009) A non-heme iron-mediated chemical
demethylation in DNA and RNA. Acc Chem Res 42: 519–529. doi:10.1021/
ar800178j.
Sedgwick B, Bates PA, Paik J, Jacobs SC, Lindahl T (2007) Repair of alkylated
DNA: recent advances. DNA Repair 6: 429–442. doi:10.1016/
j.dnarep.2006.10.005.
Aas PA, Otterlei M, Falnes PO, Vågbø CB, Skorpen F, et al. (2003) Human and
bacterial oxidative demethylases repair alkylation damage in both RNA and
DNA. Nature 421: 859–863. doi:10.1038/nature01363.
Ougland R, Zhang C-M, Liiv A, Johansen RF, Seeberg E, et al. (2004) AlkB
restores the biological function of mRNA and tRNA inactivated by chemical
methylation. Mol Cell 16: 107–116. doi:10.1016/j.molcel.2004.09.002.
Duncan T, Trewick SC, Koivisto P, Bates PA, Lindahl T, et al. (2002) Reversal
of DNA alkylation damage by two human dioxygenases. Proc Natl Acad
Sci U S A 99: 16660–16665. doi:10.1073/pnas.262589799.
Delaney JC, Essigmann JM (2004) Mutagenesis, genotoxicity, and repair of 1methyladenine, 3-alkylcytosines, 1-methylguanine, and 3-methylthymine in alkB
Escherichia coli. Proc Natl Acad Sci U S A 101: 14051–14056. doi:10.1073/
pnas.0403489101.
Yang C-G, Yi C, Duguid EM, Sullivan CT, Jian X, et al. (2008) Crystal
structures of DNA/RNA repair enzymes AlkB and ABH2 bound to dsDNA.
Nature 452: 961–965. doi:10.1038/nature06889.
Falnes PØ, Johansen RF, Seeberg E (2002) AlkB-mediated oxidative
demethylation reverses DNA damage in Escherichia coli. Nature 419: 178–
182. doi:10.1038/nature01048.
Trewick SC, Henshaw TF, Hausinger RP, Lindahl T, Sedgwick B (2002)
Oxidative demethylation by Escherichia coli AlkB directly reverts DNA base
damage. Nature 419: 174–178. doi:10.1038/nature00908.
PLOS ONE | www.plosone.org
8
April 2014 | Volume 9 | Issue 4 | e94716