Mechanisms That Prevent DNA Re-Replication in the Yeast
Saccharomyces cerevisiae
by
Robyn E. Tanny
B.S. Biochemistry
Brown University, 1999
Submitted to the Department of Biology
in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy in Biology
at the
Massachusetts Institute of Technology
MASSACHUSETT-MITrTWE
OFIECHNO5i6Y
SEP 1 3 2006
September, 2006
LIBRARIES
@ Robyn E. Tanny. All rights reserved.
WW
The author herby grants to MIT permission to reproduce and to distribute publicly
paper and electronic copies of this thesis document in whole or in part
in any medium now known or hereafter created.
Signature of Author:
'_-'Kr
Certified by:
Accepted by:
Vk
Department of Biology
July 27, 2006
S
WI
'
S
I
---
"
-''Stephen P. Bell
Professor of Biology
Thesis Supervisor
"'Stephen P. Bell
Professor of Biology
Chair, Committee for Graduate Students
Mechanisms That Prevent DNA Re-Replication in the Yeast Saccharomyces cerevisiae
By
Robyn E. Tanny
ABSTRACT
Every time a cell divides it must faithfully duplicate its genome before the cell
divides. If replication initiates a second time (re-replication) before cytokinesis, cells can
accumulate extensive DNA damage, which results in genomic instability, a hallmark of
tumorigenesis. To prevent re-replication eukaryotic cells must inhibit the re-initiation of
replication start sites, or origins, across the genome. Examples of both Cyclin-Dependent
Kinase (CDK)-dependent and CDK-independent mechanisms have been identified that
regulate the components of the pre-Replicative Complex (pre-RC) to prevent rereplication. The pre-RC is a multi-protein complex that assembles at origins during G1,
before DNA replication begins. After an origin initiates pre-RC components must be
prevented from reassembling at origins until the next cell cycle.
When the mechanisms preventing re-replication in the yeast Saccharomyces
cerevisiae are disrupted, unregulated replication occurs. Not all origins are capable of reinitiating during this re-replication. Rather, a subset of all potential origin sequences
reform pre-RCs, and of those, only a portion re-initiates. The origins that re-initiate do
not correlate with any other known subclass of origins (e.g. - early/late initiating origins).
The inability of some origins to form pre-RCs during re-replication might be due to
restrictive chromatin structure preventing pre-RC components from associating with
origin DNA. Similarly, origins that form pre-RCs but do not re-initiate might be
prevented from recruiting replication machinery due to a restrictive chromatin structure.
In addition, these origins might not re-initiate because replication factors that function
downstream of pre-RC components also could be regulated to prevent re-replication.
One of the mechanisms that S. cerevisiae and other eukaryotes use to prevent rereplication is phosphorylating one or multiple subunits of the Origin Recognition
Complex (ORC). In S. cerevisiae,Orc2 and Orc6 are both phosphorylated but have
distinct mechanisms for preventing re-replication. Phosphorylating Orc2 results in the
direct inhibition of pre-RC assembly whereas phosphorylating Orc6 helps stabilize CDK
at origins. By contrast, of CDK helps to prevent re-replication, most likely through a
combination of catalytic activity and steric hindrance.
Thesis Advisor: Stephen P. Bell
Title: Professor of Biology
Acknowledgements
Graduate school has certainly been a memorable time and I would like to thank all
the people who made it so. I have always felt that I was very lucky to be a part of the
Class of 2000 because we all got along so well. Within the class I have made some very
good friends and they have made graduate school go so much faster, or maybe slower.
Thank you to my family and non-biology friends for their support and love over the past
years. I am very lucky to be surrounded by so many wonderful people.
I would also like to thank all of the members of the Bell Lab, past and present. I
feel very strongly that one of the best qualities of the Bell Lab is the people who work/ed
here because everyone has always been willing to help whenever they can. The people
who work in the lab have made graduate school an intellectually stimulating experience.
Thanks to my labmates I have had many enriching discussions on a wide range of topics,
biology-related and not. My work would not have been possible without them.
I would like to thank my thesis committee, Terry Orr-Weaver, Angelika Amon,
Frank Solomon and Johannes Walter for their time and their helpful advice.
Finally, I would like to thank my advisor, Steve Bell, for providing such a great
environment to learn research science. I have never felt restricted in attempting
experiments or following through on ideas. Steve's advice and help have been invaluable
over the years.
Table of Contents
Abstract
Acknowledgments
Table of Contents
2
3
4
Chapter I. Introduction
Overview
cis -Acting Factors Involved in DNA Replication Initiation
trans-Acting Factors involved in the Initiation of DNA Replication
Regulation of Replication
Conclusions of regulation
Thesis Summary
References
6
7
10
17
28
36
37
38
Chapter II. Genome-wide Analysis of Re-replication Reveals Inhibitory
Controls that Target Multiple Stages of Replication Initiation
Summary
Introduction
Results
51
52
53
56
Re-replication initiates at distinct sites in the genome
Re-Replication initiates from sites of GI pre-RC formation
Origins Direct Re-replication
Timing of initiation during S-phase does not correlate with the
ability to re-replicate
Origins can re-initiate multiple times
Pre-RC formation is not the only determinant of the ability to
re-replicate
Discussion
Limited replication fork processivity prevents complete genome
re-replication
What determines origin sensitivity to re-initiation?
Formation of a pre-RC is not sufficient to induce re-replication
during G2
Experimental Procedures
Supplementary Figures
References
Chapter III. Orc2 and Orc6 phosphorylation have distinct roles in
preventing re-replication
Summary
Introduction
Results
56
59
63
66
69
72
76
76
78
78
81
85
106
110
111
112
113
Different ORC mutations result in different levels of re-replication 113
Creation and in vivo characterization of phosphomimetic mutants
Phosphomimetic mutants can incorporate into ORC and
specifically bind origin DNA
In vitro pre-RC assembly in the presence of phosphomimetic
mutants
In vitro phosphorylation of ORC results in reduced Mcm2-7
loading
Discussion
Orc2 and Orc6 have distinct mechanisms in vivo
The role of Orc2 in preventing re-replication
The role of Orc6 in preventing re-replication
The role of Orcl in preventing re-replication
How do Orc2 and Orc6 phosphorylation work together to
prevent re-replication?
Experimental Procedures
Supplemental Tables
References
Chapter IV. Discussion
Summary of Results
Why are some origins more sensitive to re-replication than others?
Other replication proteins might be regulated to prevent re-replication
Re-replication and silencing
How ORC phosphorylation prevents re-replication
References
118
122
122
127
128
128
128
130
131
132
137
139
143
146
147
147
150
151
154
159
Chapter I
Introduction
Overview
During each cell cycle, the process of genomic replication must occur faithfully
and only once before the cell divides. To accomplish this task during the S phase of the
cell cycle, the cell employs many proteins that assemble at selected chromosomal sites,
known as origins of replication, across the genome. After DNA replication is initiated, it
is vital that origins do not initiate a second time during the same cell cycle. Re-initiation
is a lethal event resulting in DNA damage, genomic instability and, possibly,
tumorigenesis. To prevent these disastrous outcomes, the cell uses numerous mechanisms
to prevent re-initiation, which will be described within this introduction.
Initiation of DNA replication can be divided into two stages: an origin-selection
stage and an origin-activation stage. The selection stage occurs during the G1 phase of
the cell cycle whereas the activation phase begins at the G 1/S transition. The two stages
are further distinguished by the level of Cyclin Dependent Kinase (CDK) activity (Hua et
al. 1997). Origin selection can only occur when CDK activity is low in GI. Conversely,
the increase of CDK activity at the G1/S transition is responsible for triggering the
activation stage.
During the selection stage, origins are marked by the formation of a prereplicative complex (pre-RC) at specific sites along the chromosomes (reviewed in
Mendez and Stillman 2003). The pre-RC consists of multiple proteins that assemble in a
step-wise fashion at the origin DNA. The Origin Recognition Complex (ORC), a sixsubunit complex, is the first pre-RC component to associate with origin DNA. ORC is
responsible for recruiting Cdc6 and Cdtl. Both of these proteins are then required to load
the six-subunit MiniChromosome Maintenance (Mcm2-7) complex, which is the putative
replicative helicase, at the origin DNA.
The activation stage of initiation is triggered by the increase in CDK activity at
the Gl/S transition. CDK activity, along with another kinase, Cdc7, and its regulatory
partner, Dbf4, are necessary for other proteins needed for replication to assemble at
origins such as Cdc45, McmlO, Sld2, the GINS complex, DNA polymerases and other
replication factors. The end result of these events is the formation of bi-directional
replication forks.
An origin that has been activated or passively replicated from activation of a
neighboring origin must be prevented from initiating during the remainder of the cell
cycle. The same CDK activity that is responsible for activating origins is also critical to
avert re-replication. CDKs phosphorylate multiple pre-RC components, and these
modifications prevent reformation of pre-RCs at origins. Because CDK activity remains
high throughout S, G2 and M phases, pre-RCs can not form at origins again until the next
G , when CDK activity is low once more.
There are several mechanisms that prevent re-replication, all of which target preRC components (Diffley 2004). CDK-dependent phosphorylation of Cdc6 and Mcm2-7
results in the translocation of these proteins from the nucleus to the cytoplasm and/or
degradation of the proteins. The regulation of ORC differs depending on the organism.
In metazoans, Orc is removed from the DNA and/or degraded to prevent re-replication.
In yeast, Orcl remains associated with the DNA throughout the cell cycle, but the CDKdependent phosphorylation of Orc2 and Orc6 (Saccharomyces cerevisiae only) inhibits
re-replication. The remaining pre-RC component, Cdtl, is regulated by multiple
mechanisms in the yeast Saccharomyces cerevisiae and in metazoa but is not known to be
regulated in S. cerevisiae. In both S. pombe and metazoa, Cdtl is degraded as cells enter
S phase. In addition to being degraded, Cdtl is bound by an inhibitor after initiation of
DNA replication in multicellular organisms to prevent its function.
My work has focused on studying the effects of re-replication and the
mechanisms that prevent this lethal event. To elucidate how re-replication is prevented, I
first analyzed how re-replication occurs in the yeast S. cerevisiae when the prevention
mechanisms described above were abrogated. In particular, I identified which origins are
susceptible to re-replication, where pre-RC components are assembled during rereplication and the extent of re-replication. To further understand the mechanisms that
prevent re-replication, I have studied how ORC phosphorylation acts to prevent pre-RC
assembly. In this introduction I will review both the cis- and trans-actingelements
involved in initiating eukaryotic DNA replication and how both types of factors play a
role in preventing re-initiation during a single cell cycle.
cis -Acting Factors Involved in DNA Replication Initiation
Originsof DNA replication
To replicate the entire genome, each chromosome must have at least one
replication start site. Unlike bacteria, eukaryotic genomes have multiple start sites, or
origins, along each chromosome. The increased number of origins ensures the genome is
replicated during S-phase. Although the components that comprise an origin are not
conserved among eukaryotic organisms, there are parallels that exist.
The first eukaryotic origin was described for the yeast S. cerevisiae in 1979
(Stinchcomb et al. 1979). This site was found serendipitously while searching for yeast
plasmids that could be maintained extrachromosomally. One plasmid, containing a 1.4
kilobase (kb) DNA fragment of the Trpl locus, transformed yeast at a high frequency and
was maintained extrachromosomally without integrating into the genome. This was the
first example of a chromosomal fragment supporting autonomous replication on an
extrachromosomal plasmid. The sequence responsible for directing this replication and
other subsequently identified sequences are termed Autonomous Replication Sequences,
or ARSs.
Dissection of the different chromosomal regions containing ARS function
determined that there were several functional domains that comprise an ARS element in S.
cerevisiae (Celniker et al. 1984; Palzkill and Newlon 1988; Marahrens and Stillman
1992). The average length of an origin is less than 150 base pairs (bp) and contains two
major domains: the A and B elements (Fig 1). The A element is defined by an 11-bp
degenerate A/T-rich sequence, also known as the ARS Consensus Sequence (ACS)
(Broach et al. 1983). The ACS is essential for initiating DNA replication and necessary
for ORC binding (see below). At ARS1, the B element can be broken down into three
smaller domains: B 1, B2 and B3 (Marahrens and Stillman 1992). These sequences are
more degenerate than the ACS but are still A/T-rich. Although no single B element is
essential, removal of any one B element reduces the efficiency of initiation from ARSL.
Analysis of several additional origins shows that although B elements are not sequenceconserved among origins, they are functionally conserved (e.g.- a B element can not
substitute for a B2 element). The B 1 element is important for stabilizing ORC binding
(Rao and Stillman 1995), and the exact function of the B2 element is still unknown.
Although, B2 elements are important for association of Mcm2-7 within the origin (Zou
and Stillman 2000; Lipford and Bell 2001; Wilmes and Bell 2002). The B3 element is a
binding site for the transcription factor Abfl (Diffley and Stillman 1988). This element is
not found at all origins, but might play a role in organizing a favorable chromatin
environment for pre-RC formation (see below) at some origins (Lipford and Bell 2001).
Although the S. cerevisiae origin has been useful in studying the cis-acting
elements of DNA replication, origins are not easily defined in other eukaryotes (Fig 1)
(reviewed in Cvetic and Walter 2005). The origins in the fission yeast S. pombe are
approximately ten times larger than origins in S. cerevisiae and have no common
consensus sequence other than being A/T rich. Origins identified in metazoa can be
hundreds of times larger than both yeast origins and some seem to be replication
initiation domains rather than specific initiation sites (Dijkwel and Hamlin 1995). Within
each domain, several different sites have the capacity to initiate during any given cell
cycle. Although necessary elements have been mapped for individual origins from
different metazoa (Altman and Fanning 2004; Wang et al. 2004; Zhang and Tower 2004),
none of these seems to be conserved between origins from the same organism and even
less between different organisms.
ORC has been localized within some metazoan origins (Austin et al. 1999;
Bielinsky et al. 2001; Keller et al. 2002; Abdurashidova et al. 2003). Instead, both the
lack of sequence conservation and well defined ORC binding sites suggest that ORC, at
least in mammals, could have limited sequence specificity when binding DNA.
Experiments using DrosophilaORC show that, in vitro, ORC specifically binds 300 bp
fragments of two DNA elements important for origin function (Austin et al. 1999).
However, DmORC does not bind to a specific sequence within these fragments (Remus
et al. 2004). in vitro experiments with human ORC show that HsORC does not have
S.cerevisiae
I
ARS?
regions that bind ORC
- regions that are
imoprtant/necessary for
replication
~ 150 bp
I
S.pombe
-open reading frames
ars3001
-500 bp
Metazoan
Drosophila - Chorion Locus
-
z
F
840 bp
320 bp
Hamster - DHFR Locus
rolo
r•
m
|
55 kb
Human - LaminB2
1.2 kb
Figure 1.Comparison of origin structure between different eukaryotes. Sites of initiation
of replication are indicated by bi-directional arrows.
Figure 1. Comparison of origin structure between different eukaryotes. Sites of initiation
of replication are indicated by bi-directional arrows.
specificity for a particular DNA sequence (Vashee et al. 2003). At least in one case in
Drosophila,ORC localization has been shown to be dependent on the transcription factor
E2F (Royzman et al. 1999). Thus in metazoa, cis-acting factors besides DNA sequences
and trans-actingfactors might be involved in positioning ORC at the proper sites for
origin selection.
Characteristicsof Origins
Initiation from a particular origin can be described by two qualities: timing and
efficiency. The timing of replication describes when, during S phase, an origin initiates
replication relative to other origins. Although there is most likely a continuous
distribution of origin initiation times, most origins are classified as initiating early or late
within S phase. The efficiency of an origin describes the likelihood of a particular origin
initiating replication during a single cell cycle. An origin with high efficiency will initiate
during the majority of cell cycles whereas an origin with low efficiency will be less likely
to initiate during any given cell cycle.
Experiments from different eukaryotes have shown that replication timing is
influenced by global chromatin structures. It is also likely that chromatin affects the
efficiency of an origin. Several studies have attempted to determine how chromatin
structure affects origin timing by monitoring changes in replication timing when certain
chromatin-modifying proteins are absent. Removing the S. cerevisiaehistone deacetylase
Rpd3 caused late origins to initiate earlier than in wild-type cells (Vogelauer et al. 2002;
Aparicio et al. 2004). In one study the origins did not retain their timing relative to each
other, suggesting a large-scale breakdown of the normal pattern of replication initiation
when the chromatin is hyperacetylated (Vogelauer et al. 2002). There is also no
correlation between the timing of initiation of an origin in S. cerevisiae and its acetylated
state (M. de Vries and SP Bell, personal communication). A similar study in Drosophila
found that loss of Rpd3 resulted in increased replication (Aggarwal and Calvi 2004) at an
amplification origin. Additional studies showed that recruiting a histone acetyltransferase
to an origin either makes origin initiation timing earlier in S. cerevisiae or increases
origin activity in Drosophilasuggesting that the impact of chromatin structure on
initiation timing is conserved.
It is interesting to note that there is no correlation between the timing of origins
and their efficiency (i.e. - not all early initiating origins are efficient and not all late
origins are inefficient) (Friedman et al. 1996; Friedman et al. 1997). It is most likely that
these two qualities are determined for each origin through a combination of DNA
sequence, chromatin structure (perhaps both local and global) and possibly trans-acting
factors.
Chromatin
DNA sequence is not the only factor that determines if a particular region of the
genome can initiate replication. DNA molecules are compacted into higher-order
structures, known as chromatin, to ensure that the DNA fits inside the nucleus of a cell.
However, the level of compaction is not identical across the genome. Early analysis of
chromosomes by staining showed that there are large domains that are less compact
(euchromatin) and those that are more compact (heterochromatin). Eventually,
heterochromatic domains were found to be regions that are less actively transcribed (due
to reduced transcription-factor access), whereas euchromatic domains contain actively
transcribed genes. Many studies from several eukaryotic organisms have shown that there
is a relationship between origin selection/activation, the state of transcription and the
state of the chromatin across the genome (discussed below).
Genome-wide studies of sites of origin formation in S. cerevisiae have indicated
that chromatin plays an important role in determining origin selection. Analysis of ORC
binding sites in S. cerevisiae showed that origins are most likely to be found in intergenic
regions (Wyrick et al. 2001). This phenomenon suggests that binding of pre-RC
components is excluded from genes to prevent pre-RC components from disrupting
transcription through genes. More recently, an analysis of all genome-wide origin-
mapping experiments from S. cerevisiae showed that not only are origins mostly found in
intergenic regions, but they are more likely found between convergent genes rather than
divergent genes (reviewed in MacAlpine and Bell 2005). This distribution of origins
suggests that S. cerevisiae evolved to prevent overlap between transcription factor
binding sites and pre-RC binding sites. Consistent with the genome-wide data, analysis of
the nucleosomes surrounding two S. cerevisiae origins suggested that chromatin structure
near origins is tightly controlled to ensure efficient initiation at an origin (Lipford and
Bell 2001).
In metazoa, multiple studies also show a correlation between transcription and
sites of initiation. As described above, segments of the genome replicate at specific times
during S phase. Early cytological analysis of the timing of replication in mammalian cells
showed that euchromatic regions replicated earlier than heterochromatic regions
(Stambrook and Flickinger 1970; Goldman et al. 1984). More recent DNA microarray
data from Drosophilacells confirm these results and show that levels of active
transcription correlate with timing of replication in large domains that can measure up to
100 kb (Schubeler et al. 2002; MacAlpine et al. 2004). Transcription might also affect
origin selection as ORC binding sites in Drosophilahave been shown to positively
correlate with RNA pol II binding transcription factor binding sites (MacAlpine et al.
2004). Furthermore, removal of promoters from genes near certain mammalian origins
(Lin et al. 2003; Saha et al. 2004) abrogates initiation.
trans-Acting Factors involved in the Initiation of DNA Replication
As mentioned in the overview, initiation of DNA replication can be divided into
two stages: origin selection and origin activation. The selection stage involves the preReplicative Complex (pre-RC) assembling at sites in the genome that will initiate
replication (Fig 2). There are four major components of the pre-RC: ORC, Cdc6, Cdtl
and Mcm2-7. ORC is primarily responsible for selecting where pre-RCs will assemble
(reviewed in DePamphilis 2003). Cdc6 and Cdtl are assembly factors necessary for
recruiting Mcm2-7 to origins. After being recruited, the Mcm2-7 complex is thought to
be topologically linked to the DNA. Multiple Mcm2-7 complexes are loaded via ordered
ATP hydrolysis by Cdc6 and ORC (Fig 2) (Bowers et al. 2004). Mcm2-7 complexes are
loaded at all potential origins during the late M/G1 phase of the cell cycle, such that all
origins are primed to initiate during S phase. Importantly, these same components are the
known targets of the mechanisms that prevent re-replication. I will discuss their roles in
pre-RC assembly below.
ORC
ORC is a highly conserved, six-subunit complex that binds to origins in all
eukaryotes tested. It is the first component of the pre-RC to associate with origin DNA,
and once bound, ORC is responsible for recruiting all other members of the pre-RC to the
origin (reviewed in Bell and Dutta 2002).
Although all eukaryotes studied to date have homologs of ORC, the mechanism
by which ORC recognizes origin DNA differs between organisms. In S. cerevisiae, ORC
binds to the A/T-rich ACS (Bell and Stillman 1992). Specific ORC binding sites have not
been identified in other eukaryotes, though there are examples of ORC specifically
localized within origins (Austin et al. 1999; Ogawa et al. 1999; Keller et al. 2002;
Abdurashidova et al. 2003). Many of these other origins do not have conserved
sequences, but they are all A/T rich. The high A/T content suggests that there is a
common mechanism of how eukaryotic ORC associates with origin DNA via A/T rich
ORC
Figure 2. Model of steps in pre-RC formation in eukaryotes. 1.ATP-bound ORc binds to origins 2.
ATP-bound Cdc6 isrecruited to origins via ORC 3.Cdtl brings Mcm2-7 to origins; Mcm2-7 complexes
are associated with the DNA, but not topologically linked 4.ATP hydrolysis by Cdc6 leads to Mcm2-7
becoming topolgically linked with the DNA as well as release of Cdc6 and Cdtl 5.ATP hydrolysis
by
ORC moves Mcm2-7 away from the origin 6.The process is repeated so multiple Mcm2-7 complexes
are loaded onto the DNA.
Figure 2. A model of the steps of pre-RC formation in eukaryotes. 1) ATP-bound ORC
binds to origins. 2) ATP-bound Cdc6 is recruited to origins via ORC. 3) Cdtl brings
Mcm2-7 to origins; Mcm2-7 complexes are associated with the DNA but not
topologically linked. 4) ATP hydrolysis by Cdc6 leads to Mcm2-7 becoming
topologically linked with the DNA as well as release of Cdc6 and Cdtl. 5) ATP
hydrolysis by ORC moves Mcm2-7 away from the origin. 6) The entire process is
repeated so multiple Mcm2-7 complexes are loaded onto the DNA.
sequences. Orc4 from S. pombe is the only eukaryotic ORC subunit that has a defined
DNA-binding domain. SpOrc4 uses repeated AT-hooks to bind the multiple A/T-rich
stretches that comprise S. pombe orgins (Chuang and Kelly 1999; Kong and DePamphilis
2001; Lee et al. 2001).
The ability of ORC to bind origin DNA is dependent on ATP. Three ORC
subunits, Orc 1, Orc4 and Orc5, in all eukaryotic systems studied thus far are AAA'related proteins. Orc2 and Orc3 also are distantly related AAA'-related proteins.
Members of the AAA' family are involved in many cellular functions and have several
conserved motifs including the Walker A and Walker B motifs, which are directly
involved in ATP binding and hydrolysis (reviewed in Erzberger and Berger 2006). To
associate with origin DNA, ORC must bind ATP, but subsequent hydrolysis is not
necessary (Klemm et al. 1997). In fact, binding to double-stranded DNA reduces ORC's
capacity to hydrolyze ATP. The energy from cleaving ATP is reserved for loading other
pre-RC components onto the origin (see below). Analysis of S. cerevisiaewith mutations
in the Walker A motif has shown that both ScOrc 1 and ScOrc5 bind ATP, but the role of
ATP binding by each of these proteins seems to be distinct. ATP binding by ScOrcl is
stimulated by origin DNA, and this interaction is necessary for directing specific origin
DNA binding (Klemm et al. 1997). Analysis of ATP requirements for DmORC binding
to DNA agree with the above studies. DmOrcl binding to ATP is important for directing
the affinity of DmORC for known Drosophilaorigin element (Chesnokov et al. 2001).
Studies using HsORC also have shown a dependency on ATP for ORC to bind DNA
(Giordano-Coltart et al. 2005). SpORC is an exception for ATP-dependent DNA binding
(Chuang et al. 2002). While SpOrc , SpOrc4 and SpOrc5 all bind ATP, the presence of
the nucleotide is not required to bind the A/T-rich elements in S. pombe origins. This
difference is most likely due to the unique AT-hook DNA-binding domain in SpOrc4.
Although ATP binding is important for ORC to associate with origin DNA,
hydrolysis of ATP is responsible for recruiting and loading other pre-RC components. In
vivo experiments that mutate the Walker B motif (Klemm and Bell 2001) of ScOrc 1 or
using non-hydrolyzable forms of ATP (Klemm and Bell 2001; Harvey and Newport
2003) with different eukaryotic ORC showed that ORC could bind DNA without ATP
hydrolysis. These experiments also showed that ATP hydrolysis was necessary for
subsequent replication, suggesting that ATP hydrolysis is important for the steps between
ORC binding origin DNA and replication.
Two recent in vitro studies in S. cerevisiaeshowed that ORC does not hydrolyze
ATP until after Cdc6 is localized to origin DNA. One study showed that after Cdc6
associates with ORC, ORC ATP hydrolysis results in a possible conformational change,
which might promote Mcm2-7 loading (Speck et al. 2005). While this could happen in
vivo, it should be noted that these experiments were carried out in the presence of only
origin DNA, ORC and Cdc6. It is unclear whether the same results would occur if
Mcm2-7 complexes were present. The second study used an in vitro pre-RC assembly
assay to show that in the absence of Orc 1 ATP hydrolysis, both Cdc6 and Mcm2-7 can
associate with origin DNA. However, fewer Mcm2-7 complexes loaded in the absence of
ORC ATP hydrolysis than in the presence of ATP hydrolysis (Bowers et al. 2004). These
data suggested that Orc ATP hydrolysis is important for loading more than one complex
of Mcm2-7 at each origin. Consistent with this hypothesis, studies in several other
organisms have shown that the ratio of Mcm2-7:ORC complexes on chromatin is much
greater than 1:1 (reviewed in Takahashi et al. 2005).
Cdc6
Cdc6 was discovered in the initial screen for genes that regulate the cell division
cycle in S. cerevisiae (Hartwell 1976). Since its original description, well conserved
homologs have been found in all eukaryotes. The localization of Cdc6 to origins is
dependent on ORC but not on other pre-RC components. Similar to several of the ORC
subunits, Cdc6 is an AAA'-related protein and its ATP hydrolysis function is required for
initiation of replication. Cdc6, in conjunction with Cdtl, is necessary for loading Mcm2-7
onto origins (reviewed in Bell and Dutta 2002).
Analogous to ORC, ATP hydrolysis by Cdc6 is not required for Cdc6 to associate
with ORC (Mizushima et al. 2000), but ATP binding by Cdc6 is stimulated by the
presence of ORC (Randell et al. 2006). Only once it is bound to ORC is Cdc6 capable of
hydrolyzing ATP. Two recent studies suggest an effect of ATP hydrolysis by Cdc6. The
first set of experiments suggested that, once bound to ORC, Cdc6 hydrolyzes ATP,
resulting in an increase in ORC's specificity for origin DNA. This hydrolysis might also
lead to a conformational change in ORC that creates a favorable environment for loading
Mcm2-7 (Mizushima et al. 2000). The second study showed that Mcm2-7 complexes that
loaded onto DNA in the presence of wt Cdc6 were resistant to salt extraction (Randell et
al. 2006). However, complexes loaded onto DNA in the presence of a Cdc6 ATPhydrolysis mutant were sensitive to salt extraction. These data suggest that stably loading
Mcm2-7 complexes onto DNA requires Cdc6 ATP hydrolysis. These two hypotheses are
not mutually exclusive. It is possible that the hydrolysis of ATP by Cdc6 has both effects,
such that the change of conformation in ORC is not necessary for recruiting Mcm2-7 but
for stabilizing Mcm2-7 on the DNA.
Cdtl
Cdtl was first identified in S. pombe as a transcriptional target for the
transcription factor Cdc10 (Hofmann and Beach 1994), but it was not until several years
later that it was shown to be necessary for initiation of replication (Nishitani et al. 2000).
Homologs from Xenopus, Drosophila,and humans also were isolated and shown to be
necessary for pre-RC assembly (Maiorano et al. 2000; Whittaker et al. 2000; Rialland et
al. 2002). Initially, a homolog of Cdtl was not identified in S. cerevisiae,but an
alignment of all known eukaryotic sequences revealed S. cerevisiaeTahl 1 as a Cdtl
ortholog (Devault et al. 2002). Work from all of these organisms has shown that Cdtl is
essential for initiating replication and acts in coordination with Cdc6 to recruit Mcm2-7
to origins.
Cdtl associates with origin DNA after Cdc6 recruitment (Tada et al. 1999;
Tsuyama et al. 2005) but either before or simultaneously with Mcm2-7. Studies from
several organisms have shown that Cdtl interacts with Mcm2-7 (Gopalakrishnan et al.
2001; Tanaka and Diffley 2002; Cook et al. 2004), which suggests that Cdtl might be
responsible for physically bringing Mcm2-7 to origins. Because the nuclear localization
of Cdtl and Mcm2-7 in S. cerevisiaeis dependent on each other (Tanaka and Diffley
2002), it is possible that Cdtl acts as a chaperone for the helicase. The extent of how
Cdtl supports Mcm2-7 function on DNA might differ among organisms. Data from S.
cerevisiae indicate that Cdtl does not remain on DNA after loading Mcm2-7. In vitro
pre-RC assembly assays have shown that hydrolysis of ATP by Cdc6 could be
responsible for releasing Cdtl off the DNA after Mcm2-7 has associated with the origin
(Randell et al. 2006). Data from Xenopus extracts also have shown that Cdtl is removed
from the DNA after initiation (Maiorano et al. 2004). In D. melanogasterfollicle cells,
however, Cdtl/Dupl has been shown to travel with the replication fork during the
amplification of the chorion locus (Claycomb et al. 2002). These data and others (Thomer
et al. 2004) suggest that Cdtl/Dupl might be required for elongation during chorion
amplification specifically.
Mcm2-7
Mcm2-7 is a six-subunit complex that is believed to be the replicative helicase for
DNA replication. Many lines of evidence support this hypothesis: Mcm2-7 has weak in
vitro helicase activity (Ishimi 1997; Lee and Hurwitz 2000), moves with the replication
fork (Aparicio et al. 1997), is found in a complex with other proteins known to be at the
replication fork (Gambus et al. 2006; Pacek et al. 2006) and Mcm2-7 is required for
elongation after initiation of DNA replication (Labib et al. 2000). Electron microscopy of
the full Mcm2-7 complex or subcomplexes (see below) from several different species
shows that the MCMs form a cylindrical structure with a central channel (Adachi et al.
1997; Yabuta et al. 2003). When visualized with single-stranded DNA (ssDNA), Mcm2-7
has a "bead-on-a-string" appearance (Sato et al. 2000). Crystallization studies of an
archael MCM complex show that at least part of this central channel is positively charged
and binds DNA (Fletcher et al. 2003). Additionally, these studies showed that Mcm2-7
can form a dodecameric structure, which has been shown to be an active form of archael
MCM (Chong et al. 2000). More recent crystallization studies suggest that this form of
Mcm2-7 is stabilized by both ATP binding and the presence of dsDNA (Costa et al.
2006). The formation of a dodecameric structure is similar to the well studied SV40 large
T Antigen (TAg), a viral helicase, suggesting a similar mechanism for unwinding DNA
between the two organisms.
As described in the previous sections, Mcm2-7 is loaded onto origin DNA by
ORC, Cdc6 and Cdtl. Experiments from S. cerevisiae suggest that there are distinct steps
to load Mcm2-7 onto origin DNA. In the first step, Mcm2-7 is recruited to the origin by
ATP-bound Cdc6 and Cdtl but the complex is not fully associated (Randell et al. 2006).
Cdc6 ATPase activity is thought to result in a conformation change such that the ring
structure is stabilized around DNA, perhaps because Mcm2-7 might now encircle the
dsDNA. Finally, ATP hydrolysis by ORC allows for another round of Mcm2-7 loading
such that multiple Mcm2-7 complexes are loaded at each origin. The reason for the
assembly of so many Mcm2-7 complexes at the origin is not clear as replication in
Xenopus egg extracts is efficient even when the number of Mcm2-7 complexes is reduced
(Mahbubani et al. 1997; Edwards et al. 2002). One proposed solution is that these extra
Mcm2-7 complexes are activated late in S phase to help unwind long stretches of
unreplicated DNA. Loading multiple helicase complexes along the DNA before
replication initiation would obviate the need to re-assemble pre-RCs during S phase.
Like other components of the pre-RC, all six Mcm2-7 subunits are AAA+-related
proteins. Not all six subunits, however, are active ATPases. Dissection of subcomplexes
of Mcm2-7 indicated that there are two major classes: catalytic and regulatory. Mcm4,6,7
has both ATPase and helicase activity (Ishimi 1997). The presence of Mcm2 is inhibitory
of the helicase activity of Mcm4,6,7 (Ishimi 1997). Addition of Mcm2,3,5 to Mcm4,6,7
resulted in a clear reduction in ATPase activity suggesting that Mcm2,3,5 might be
regulatory components of the full complex (Schwacha and Bell 2001). The ATPase
activity of Mcm2-7 is not required to bind DNA or to load other downstream replication
factors. Instead, the catalytic activity is most likely only required for DNA unwinding
(Ying and Gautier 2005). The exact mechanism by which Mcm2-7 unwinds the DNA is
not currently understood, but several mechanisms have been proposed (reviewed in
Takahashi et al. 2005).
Kinases involved in initiatingreplication
After completing the selection stage of initiation by assembling the pre-RC, two
kinases are required to activate initiation. The kinase activity of cyclin-dependent kinases
(Cdk) and Dbf4-dependent kinase results in the recruitment of other, downstream
replication factors necessary for elongation. Both Cdk and the Dbf4-dependent kinase are
serine/threonine kinases and derive substrate specificity through interactions with a
regulatory partner. In S. cerevisiae and S. pombe, there is a single Cdk, Cdc28 and Cdc2,
respectively, which acts with different regulatory cyclins during the cell cycle. In other
eukaryotes, however, there are multiple Cdks that interact with different cyclins. While
Cdks are generally stable throughout the cell cycle, cyclin abundance is regulated in a
cell-cycle dependent manner, and thus, each cyclin directs activity of a Cdk at a specific
point during the cell cycle. There are two major categories of cyclins: B-type cyclins and
G I cyclins. G I cyclins are only active during G1, while B-type cyclins are present during
S, G2 and M phases of the cell cycle. It is during the time of low B-type Cdk:cyclin
activity in G1 that pre-RCs form. To direct replication at the G1/S transition, Cdks
interact with the S-phase cyclins: Clb5/6 in S. cerevisiae,Cigl/2 in pombe and cyclin E/A
in metazoa.
Eukaryotes have a single known Dbf4-dependent kinase: Cdc7 or Hskl. The
regulatory partner of this kinase is Dbf4, which, like cyclins, is cell-cycle regulated in its
abundance. Recent evidence has shown that Cdc7 has a second regulatory partner, Drfl.
Drfl is similar to Dbf4, but homologs have been isolated only from humans and Xenopus
(Montagnoli et al. 2002; Yanow et al. 2003). This observation suggests that Drfl
provides an increased level of complexity to the control of Cdc7 in vertebrates.
Interestingly, data from Xenopus have shown that Drfl is more abundant in egg extracts
than in cells from later in Xenopus development, suggesting that Drfl could be a
developmentally regulated replication protein (Takahashi and Walter 2005; Silva et al.
2006).
All of the targets of CDK activity that must be modified to direct replication are
not currently known. The only protein known to require CDK phosphorylation for its role
in initiation is Sld2, an essential protein required for loading replication polymerases
(Masumoto et al. 2002), although this is unlikely to be the only target. A large-scale in
vitro directed screen for other CDK:Clb5 targets from S. cerevisiae indicated that many
pre-RC and replication components are phosphorylated preferentially by Clb5 (Loog and
Morgan 2005). CDK:Clb5 activity, however, is not only important for activating DNA
replication, but the activity is required for inhibiting replication after initiation (see
below). Data from multiple organisms have shown that pre-RC components are
phosphorylated in a CDK-dependent manner to inhibit re-replication. Other targets
predicted from the Clb5-specificity screen have to be tested to show if their
phosphorylation by CDK is necessary for initiation of DNA replication or to prevent
repliation.
Work in S. cerevisiae has shown that Cdc7 function is required for each origin
directly before that origin initiates (Bousset and Diffley 1998). Combined with data
showing that Cdc7:Dbf4 (DDK) are recruited to origins in vivo (Dowell et al. 1994), the
above data suggest that Cdc7 might be recruited to origins before they initiate. Many
lines of both biochemical and genetic evidence suggest that the primary target of DDK
activity is the Mcm2-7 complex (Masai and Arai 2002), although how phosphorylation
affects Mcm2-7 activity is not known. Interestingly, in vitro data from human cells
suggest that phosphorylation of Mcm2 by DDK is stimulated by prior phosphorylation of
Mcm2 by CDK (Masai et al. 2000; Montagnoli et al. 2006). There is conflicting data,
however, about whether or not CDK activity is required for DDK's association with
origin (and presumably its subsequent modification of Mcm2-7) in vivo (Jares and Blow
2000; Nougarede et al. 2000).
Trans-actingfictors downstream of pre-RCformation
After pre-RC assembly and the initiating kinase activity, a large number of other
proteins necessary for replication assemble onto the DNA. The main objective of this
next group of replication proteins is either to assemble DNA replication polymerases or
assist Mcm2-7 as the replicative helicase. These components include McmlO, Cdc45,
GINS, pol-a/primase, the leading and lagging polymerases, single-stranded binding
proteins and processivity factors.
Regulation of Replication
Once the cell has initiated DNA replication by recruiting all the necessary
components to origins of replication, it is imperative that another round of replication
does not occur until after cell division is completed. Data from several eukaryotes have
shown that multiple rounds of unscheduled replication are lethal to cells. To prevent the
inevitable genomic instability that accompanies re-replication, the cell takes many
precautions (reviewed in Diffley 2004). Because assembling the pre-RC is the first step in
initiating replication, the components of the pre-RC are the major, known targets of the
cell in preventing re-replication.
There are instances in development when cells purposely undergo multiple rounds
of re-replication or amplification (reviewed in Edgar and Orr-Weaver 2001). More
commonly called endoreduplication, this process occurs in many well studied cell types
from a variety of different organisms including adult Drosophilanurse cells, mammalian
megakaryocytes and trophoblast cells and a large number of tissue types in plants. The
process generally consists of a number of S phases separated by Gap phases with no
intervening cell division in post-mitotic cells. The difference between endoreduplication
and unscheduled re-replication is that endoreduplication is a well organized process that
often results in multiple rounds of full genome duplication. Both processes, however, are
dependent on the strict coordination of CDK activity. For endoreduplication to be
successful, many endoreduplicating cells down-regulate mitotic cyclins so that cell
division is not possible but allow for periodic expression/activity of the S phase cyclins.
In all eukaryotes studied, some of the mechanisms that prevent re-replication are
dependent on CDK activity. Several experiments have shown that in the absence of CDK
activity during G2 pre-RCs are capable of re-forming, suggesting that the presence of
CDK activity is important for preventing the pre-RC components from assembling at
origins (Hayles et al. 1994; Dahmann et al. 1995; Coverley et al. 1998). There are also,
however, some CDK-independent mechanisms, especially for the regulation of Cdtl. The
known mechanisms for how each pre-RC component is inactivated after origin initiation
are described below (Table 1).
ORC
ORC is inactivated in all organisms in a CDK-dependent manner (DePamphilis
2005). How phosphorylation affects ORC in each organism, however, differs. In S.
cerevisiae,all six subunits of ORC remain on the DNA throughout the cell cycle. After
initiation occurs and the replisome has left the origin Orc2, Orc6 and possibly Orc1 are
phosphorylated. Although studies have clearly shown that these modifications are
important for preventing re-initiation (Nguyen et al. 2001), it is not clear how they inhibit
pre-RC formation. The current theory suggests that phosphorylation of ORC creates an
inhospitable environment for recruiting other pre-RC components. Work in S. pombe
showed that SpOrc2 is phosphorylated in a CDK-dependent manner and is required to
prevent re-initiation (Vas et al. 2001). Work from both S. cerevisiae and S.pombe have
shown a role for ORC in preventing re-replication by recruiting Cdk:cyclin complexes to
origins. This mechanism will be discussed below.
In other eukaryotes, the regulation of ORC and its association with chromatin is
not as clear. DmOrc 1 is an APC substrate and is degraded after release from chromatin
(Araki et al. 2003). Recent data have suggested that this degradation occurs in G (Araki
et al. 2005), but the importance of this degradation is unclear as pre-RCs form during G1.
In human cells, there are several different reports about the nature of Orcl regulation
following initiation of replication. One study indicates that Orc 1 is ubiquitinylated in an
SCFSkp2-dependent manner and then degraded (Mendez et al. 2002); another study
suggests that Orc 1 is ubiquitinylated and comes off the DNA but is not degraded (Li and
DePamphilis 2002); and a third study suggests that Orcl remains on the DNA throughout
the cell cycle (Okuno et al. 2001). Some of these differences may be a result of the
different cell lines used to carry out the experiments. Nonetheless, it is most likely that
Orc 1 is regulated in some manner to prevent re-replication. Additionally, there are data
from Xenopus that the entire ORC complex is removed from chromatin after the pre-RC
o
a
K
rT
a0
E
y)
crj
c
C
a
.o
C
-o
a
O
u
a
a,
.0.
~0
~.)
Ct b
5
U0
,
o
Q>
Zo
E) Da
a
*
-U
as
O CLe
**
ar,00
a
t
c
ct ~
P
S*
0
E
0r
crt
0
-". on
.
a)
a0
0,
a
*
-o
0
-0
ctl
-av~
0
0ec
rd=
U
-O-
ctc
'0
8 rei0i
s
9~0C
" aE
L~
c0~
0e aa
0
aa
*
0
E
°
*
*
-o
o
.o
•o
QQ
0
z-o-T
o
-
<-0
>,
0
0
0
0 •U
g2C
•Q)
ZSc
>
0~ Con
0e
z
0
cte
o
0. ..,
~
as
I-o
_
*
*
S.0
-Da=
as
has assembled (Sun et al. 2002), but this release does not seem to be dependent on CDK
activity.
Cdc6
Cdc6 was the first component of the pre-RC whose overexpression was shown to
result in re-replication. Overexpression of the S. pombe Cdc6 homolog, Cdc 18, resulted
in up to 8C DNA content (Muzi Falconi et al. 1996; Nishitani and Nurse 1997).
Overexpressing Cdc6 in S. cerevisiae does not result in such re-replication, but
stabilization of Cdc6 does, in combination with other mutants that bypass inhibition of rereplication, help elicit a re-replication phenotype (Nguyen et al. 2001).
Unlike the majority of the ORC subunits, Cdc6 levels are tightly regulated in
yeast. After Cdc6 recruits Mcm2-7 to origin DNA in S. cerevisiae,Cdc6 is
phosphorylated by CDK and this modification leads to its recognition by an F-box
specificity-factor associated with SCF (Drury et al. 1997; Kominami and Toda 1997).
Subsequent ubiquitinylation results in the degradation of the protein.
Immunofluorescence studies from S. cerevisiae show that Cdc6 is relocalized from the
nucleus to the cytoplasm following initiation (Jong et al. 1996). Data from S. pombe
show that Cdc 18 is phosphorylated in a CDK-dependent manner and that this
phosphorylation results in degradation of Cdcl8 (Jallepalli et al. 1997). Recent studies
from S. cerevisiae have shown an additional mechanism to inhibit Cdc6 activity. Not
only does CDK phosphorylate the N-terminus of Cdc6 leading to proteolysis but the
kinase, with an associated mitotic cyclin, physically interacts with the N-terminus and
blocks the ability of the bound Cdc6 to direct pre-RC formation (Mimura et al. 2004).
This mechanism of blocking pre-RC formation could be conserved in S. pombe, as
previous work showed that Cdc2 co-purified with Cdc 18 via the N-terminus of Cdc 18
(Brown et al. 1997). Cdc6 in Xenopus might be exported via CDK-dependent
phosphorylation, but it is currently unclear if export is involved in preventing rereplication (Pelizon et al. 2000).
The regulation of Cdc6 in mammals for preventing re-replication is more
complicated as there are two populations of Cdc6: chromatin-bound and soluble
(Coverley et al. 2000). Studies suggest that the soluble fraction of Cdc6 is translocated
out of the nucleus after initiation, possibly due to CDK-dependent phosphorylation (Saha
et al. 1998; Jiang et al. 1999; Petersen et al. 1999). This population of Cdc6 may also be
degraded by being ubiquitinylated by the ubiquitin ligase APC/Cyclosome (Petersen et al.
2000). Other studies showed that Cdc6 remained in the nucleus and on chromatin in both
S and G2 phases (Okuno et al. 2001). A recent study suggests that chromatin-bound Cdc6
also is regulated through CDK-dependent phosphorylation (Alexandrow and Hamlin
2004). This group postulated that, as with CDK phosphorylation of ORC, Cdc6
phosphorylation blocks its ability to recruit Mcm2-7, even though it is still on the DNA.
Mcm2-7
Surprisingly, Mcm2-7 is not as tightly regulated as other components of the preRC. This could be because Mcm2-7 is required for elongation after initiation. The
mechanisms preventing re-replication discussed here apply to the non-chromatin-bound
population of Mcm2-7 and complexes that are no longer needed for elongation. Only in
S. cerevisiaeis Mcm2-7 known to have a clear mechanism for its removal from the DNA
after replication. CDK-dependent phosphorylation of Mcm2-7 results in the net
translocation of the Mcm2-7 complex from the nucleus to the cytoplasm (Labib et al.
1999; Nguyen et al. 2000) via a nuclear export signal (NES) on Mcm3 (Liku et al. 2005).
Perhaps because other organisms regulate Cdtl more tightly than S. cerevisiae does (see
below), S. cerevisiae must regulate Mcm2-7 in addition to other pre-RC components. In
S. pombe, Mcm2-7 has been shown to remain in the nucleus after replication (Maiorano
et al. 1996). It is possible that Mcm2-7 is removed from the DNA but remains nuclear.
These data are similar to data from mammalian cells and Xenopus (Fujita et al. 1996;
Mendez and Stillman 2000).
Cdt]
The necessity of regulating Cdtl to prevent re-replication was first demonstrated
in S. pombe (Nishitani et al. 2000; Yanow et al. 2001). Experiments overexpressing Cdtl,
in combination with Cdc6 overexpression showed increased DNA content up to 64C in
some cells. Overexpressing Cdtl by itself in S. pombe, however, does not induce rereplication (Yanow et al. 2001). In multicellular eukaryotes, such as Xenopus,
Drosophila, C. elegans and A. thaliana,overexpression of Cdtl (Castellano et al. 2001;
Thomer et al. 2004), stabilization of Cdtl (Zhong et al. 2003) or addition of recombinant
Cdtl to Xenopus egg extracts (Arias and Walter 2005; Li and Blow 2005; Maiorano et al.
2005) can induce re-replication and, in some cases, lead to apoptosis (Thomer et al.
2004). The drastic difference when overexpressing Cdtl alone in metazoa versus yeast
helps explain why there are multiple mechanisms in metazoan cells that exist to ensure
that Cdtl is not present after replication initiation.
Similar to Cdc6, Cdtl in metazoan cells is regulated by proteolysis following
DNA replication. Two different destruction pathways have been described in metazoans,
but it is currently unclear if only one or both pathways exist in each organism. Data from
human cells have shown that Cdtl is phosphorylated in a CDK-dependent manner, which
leads to ubiquitinylation by SCFSkp2 and subsequent degradation (Li et al. 2003; Liu et al.
2004; Sugimoto et al. 2004). Recent work in Xenopus has shown that Cdtl is targeted for
destruction by a different E3 ubiquitin ligase, Cul4Ddbl (Senga et al. 2006). Recognition of
Cdtl by Ddbl is dependent on Cdtl interacting with chromatin-bound PCNA (Arias and
Walter 2006). Data from C. elegans (Zhong et al. 2003), mammalian cells (Hu and Xiong
2006) and S. pombe (see below) all show a similar dependence on Cul4DDbl , suggesting
that the mechanism described in Xenopus is conserved.
Cdtl was the first component of the pre-RC that was shown to have a non-CDKdependent mechanism to inhibit its activity (Saxena and Dutta 2005). Geminin is an
inhibitor of Cdtl that disables Cdtl activity by binding to Cdtl. This inhibitor was
identified in a search for Xenopus proteins that are degraded in an APC/C-dependent
manner in mitotic egg extracts (McGarry and Kirschner 1998). The destruction of
geminin at the end of mitosis fits well with its role as a negative regulator of DNA
replication because many pre-RC components begin accumulating during the M/G1
transition. Homologs of geminin have since been found in humans, Drosophila,C.
elegans and mouse, but not in S. cerevisiae or S. pombe.
Crystalographic experiments to determine the nature of the interaction between
Cdtl and geminin from both humans and mouse show that a coiled-coiled domain on
geminin interacts with Cdtl (Lee et al. 2004; Saxena et al. 2004). An additional nearby
region on the N-terminal end of the coiled-coil domain also is important for the Cdtlgeminin interaction. Data from both mouse and Xenopus show that Cdtl has two domains
that interact with geminin (Lee et al. 2004; Ferenbach et al. 2005), one of which is also a
coiled-coil domain. It is interesting to note that the region of Cdtl to which geminin binds
is not the region of Cdtl required for promoting replication. Instead, it appears that when
the two proteins are bound to each other, a segment of geminin that does not interact with
Cdtl blocks the interaction of Cdtl with Mcm2-7 (Lee et al. 2004).
Regulation of Cdtl is drastically reduced in both S. cerevisiae and S. pombe
compared to metazoa. In S. cerevisiae, both the Cdtl mRNA transcript and Cdtl protein
are stable throughout the cell cycle (Devault et al. 2002) and Cdtl activity is regulated via
Mcm2-7. When Mcm2-7 is translocated out of the nucleus in a CDK-dependent manner,
Cdtl also is translocated (Tanaka and Diffley 2002). S. pombe Cdtl transcription and
protein levels are both regulated in coordination with regulation of Cdc18 (Nishitani et al.
2000) rather than Mcm2-7. Transcription of both Cdtl and Cdcl8 is upregulated during
G1 by the transcription factor Cdc10 and the abundance of the transcripts wane as the
cells progress through the cell cycle. Cdtl and Cdcl8 protein levels peak in late mitosis
and decrease during S phase. The mechanism of proteolysis of Cdtl, however, does differ
from that of Cdc 18. While Cdcl8 is degraded in an SCF-dependent manner, Cdtl is
degraded in a Cul4DDbl-dependent manner (Hu and Xiong 2006).
CDK recruitmentto Origins
Studies from S. cerevisiae and S. pombe, showed that CDK paired with a cyclin
partner is recruited to origins of replication (Wuarin et al. 2002; Wilmes et al. 2004). In
both organisms, if the Cdk:cyclin is unable to associate with origins, the cell becomes
sensitized to re-replication. In S. cerevisiaeCdc28 and the S phase cyclin Clb5 are
brought to origins via interactions between the hydrophobic patch on Clb5 and the three
amino acid RXL cyclin-recognition motif on Orc6. Cdc28:Clb5 is recruited to origins
directly after each origin has initiated and remains at origins. Disrupting the interaction
between Clb5 and ScOrc6 by a ScOrc6 RXL-mutant sensitized the cells to unregulated
re-replication. In S. pombe, Cdc2 and the M phase cyclin Cdcl3 are recruited to origins
through interactions with SpOrc2 (Leatherwood et al. 1996; Wuarin et al. 2002). Both
groups also showed that Cdk:cyclin is only present at origins when Mcm2-7 is not.
The exact mechanism by which recruiting Cdk:cyclin to an origin prevents rereplication is unknown. One hypothesis would be that targeting Cdk:cyclin to the origin
is necessary for the subsequent phosphorylation events that prevent re-replication (ORC,
Cdc6, Cdtl, Mcm2-7). Previous work in S. pombe has shown that phosphorylation of
SpOrc2 by Cdc2:Cdc 13 is important for preventing re-replication (Vas et al. 2001). When
Cdc2/Cdc 13 activity is removed from cells to induce re-replication, however, SpOrc2 is
still phosphorylated. It is unclear if Cdc2/Cdcl3 is generally responsible for
phosporylating SpOrc2, but a different kinase activity can phosphorylate SpOrc2 in the
absence of Cdc2/Cdc 13 activity. Cdk:cyclin recruitment at origins also might prevent
pre-RC formation by providing steric hindrance. Further experiments need to be
conducted to resolve this mechanism.
Chromatinregulatingreplicationinitiation
The majority of work studying prevention of re-replication has centered on
mechanisms involving trans-actingfactors. There is the formal possibility, however, that
chromatin structure affects replication initiation. As discussed above, chromatin plays a
role in origin selection and activation as shown in both S. cerevisiae and Drosophila.
Because origin selection takes place at the M/G1 transition, the chromatin at that point in
the cell cycle must be favorable for establishing origins at specific sites. Chromatin
structure in late S and G2 phase could be affected by cell-cycle dependent changes in the
transcriptional program, chromatid cohesion or condensation. It is possible that these
different chromatin structures help to exclude certain trans-actingreplication factors,
whether they are pre-RC components or elongation factors, from associating with DNA.
Conclusions of Re-Replication Control
The many levels of control that prevent re-replication presented here underscore
the importance of preventing unscheduled re-initiation of DNA replication. Each member
of the pre-RC, in all eukaryotes studied, is targeted to become inactive as soon as its role
in initiation replication or elongation is completed. Several components of the pre-RC are
even targeted by multiple mechanisms. It is important to note, however, that the
mechanism of inactivation for each component varies among organisms. Although Cdc6
is degraded very quickly in both S. cerevisiae and S. pombe, it might not be degraded at
all in mammalian cells. Similarly, Cdtl is regulated by translocation through its
interaction with Mcm2-7 in S. cerevisiae, but there are multiple mechanisms that
inactivate Cdtl in metazoa. One possibility for CDK-independent inhibition of Cdtl
might be because CDK activity is targeted in replication/DNA damage checkpoints in
metazoa and S. pombe. Reducing CDK activity directed by B-type cyclins to arrest the
cell cycle during a checkpoint would create a G -like state and thus pre-RCs could form.
Therefore, having a CDK-independent mechanism to inhibit Cdtl and pre-RC formation
would be essential.
Thesis Summary
I have conducted experiments to understand the mechanisms preventing rereplication using the yeast S. cerevisiae as a model organism. The first section of this
thesis will describe experiments that try to uncover why certain regions of the S.
cerevisiae genome are more susceptible to re-replication than others. I was able to
identify those origins that are capable of re-initiating and show that formation of a preRC does not necessarily lead to re-initiation. These results gave a new way to classify
origins in S. cerevisiae, which may be helpful for future studies about the efficiency or
mechanism of origin activation. These data also suggested that factors other than pre-RC
components might be targeted for re-replication control. The next section of this thesis
describes experiments to understand how phosphorylation of Orc2 and Orc6 contribute to
preventing re-replication. These experiments are not complete, but the preliminary data
suggest that phosphorylation of the two subunits have two different roles. Orc2
phosphorylation is likely to directly prevent pre-RC components from associating with
origins while phosphorylation of Orc6 may help stablilize Cdk:cyclin complexes at
origins to prevent re-replication.
References
Abdurashidova, G., Danailov, M.B., Ochem, A., Triolo, G., Djeliova, V., Radulescu, S.,
Vindigni, A., Riva, S., and Falaschi, A. 2003. Localization of proteins bound to a
replication origin of human DNA along the cell cycle. Embo J 22(16): 4294-4303.
Adachi, Y., Usukura, J., and Yanagida, M. 1997. A globular complex formation by Ndal
and the other five members of the MCM protein family in fission yeast. Genes
Cells 2(7): 467-479.
Aggarwal, B.D. and Calvi, B.R. 2004. Chromatin regulates origin activity in Drosophila
follicle cells. Nature 430(6997): 372-376.
Alexandrow, M.G. and Hamlin, J.L. 2004. Cdc6 chromatin affinity is unaffected by
serine-54 phosphorylation, S-phase progression, and overexpression of cyclin A.
Mol Cell Biol 24(4): 1614-1627.
Altman, A.L. and Fanning, E. 2004. Defined sequence modules and an architectural
element cooperate to promote initiation at an ectopic mammalian chromosomal
replication origin. Mol Cell Biol 24(10): 4138-4150.
Aparicio, J.G., Viggiani, C.J., Gibson, D.G., and Aparicio, O.M. 2004. The Rpd3-Sin3
histone deacetylase regulates replication timing and enables intra-S origin control
in Saccharomyces cerevisiae.Mol Cell Biol 24(11): 4769-4780.
Aparicio, O.M., Weinstein, D.M., and Bell, S.P. 1997. Components and dynamics of
DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and
Cdc45p during S phase. Cell 91(1): 59-69.
Araki, M., Wharton, R.P., Tang, Z., Yu, H., and Asano, M. 2003. Degradation of origin
recognition complex large subunit by the anaphase-promoting complex in
Drosophila.Embo J 22(22): 6115-6126.
Araki, M., Yu, H., and Asano, M. 2005. A novel motif governs APC-dependent
degradation of DrosophilaORC in vivo. Genes Dev 19(20): 2458-2465.
Arias, E.E. and Walter, J.C. 2005. Replication-dependent destruction of Cdtl limits DNA
replication to a single round per cell cycle in Xenopus egg extracts. Genes Dev
19(1): 114-126.
-. 2006. PCNA functions as a molecular platform to trigger Cdtl destruction and prevent
re-replication. Nat Cell Biol 8(1): 84-90.
Austin, R.J., Orr-Weaver, T.L., and Bell, S.P. 1999. DrosophilaORC specifically binds
to ACE3, an origin of DNA replication control element. Genes Dev 13(20): 26392649.
Bell, S.P. and Dutta, A. 2002. DNA replication in eukaryotic cells. Annu Rev Biochem
71: 333-374.
Bell, S.P. and Stillman, B. 1992. ATP-dependent recognition of eukaryotic origins of
DNA replication by a multiprotein complex. Nature 357(6374): 128-134.
Bielinsky, A.K., Blitzblau, H., Beall, E.L., Ezrokhi, M., Smith, H.S., Botchan, M.R., and
Gerbi, S.A. 2001. Origin recognition complex binding to a metazoan replication
origin. Curr Biol 11(18): 1427-1431.
Bousset, K. and Diffley, J.F. 1998. The Cdc7 protein kinase is required for origin firing
during S phase. Genes Dev 12(4): 480-490.
Bowers, J.L., Randell, J.C., Chen, S., and Bell, S.P. 2004. ATP hydrolysis by ORC
catalyzes reiterative Mcm2-7 assembly at a defined origin of replication. Mol Cell
16(6): 967-978.
Broach, J.R., Li, Y.Y., Feldman, J., Jayaram, M., Abraham, J., Nasmyth, K.A., and
Hicks, J.B. 1983. Localization and sequence analysis of yeast origins of DNA
replication. Cold Spring Harb Symp Quant Biol 47 Pt 2: 1165-1173.
Brown, G.W., Jallepalli, P.V., Huneycutt, B.J., and Kelly, T.J. 1997. Interaction of the S
phase regulator cdc 18 with cyclin-dependent kinase in fission yeast. Proc Natl
Acad Sci U S A 94(12): 6142-6147.
Castellano, M.M., del Pozo, J.C., Ramirez-Parra, E., Brown, S., and Gutierrez, C. 2001.
Expression and stability of Arabidopsis CDC6 are associated with
endoreplication. Plant Cell 13(12): 2671-2686.
Celniker, S.E., Sweder, K., Srienc, F., Bailey, J.E., and Campbell, J.L. 1984. Deletion
mutations affecting autonomously replicating sequence ARS 1 of Saccharomyces
cerevisiae.Mol Cell Biol 4(11): 2455-2466.
Chesnokov, I., Remus, D., and Botchan, M. 2001. Functional analysis of mutant and
wild-type Drosophilaorigin recognition complex. Proc Natl Acad Sci U S A
98(21): 11997-12002.
Chong, J.P., Hayashi, M.K., Simon, M.N., Xu, R.M., and Stillman, B. 2000. A doublehexamer archaeal minichromosome maintenance protein is an ATP-dependent
DNA helicase. Proc Natl Acad Sci U S A 97(4): 1530-1535.
Chuang, R.Y., Chretien, L., Dai, J., and Kelly, T.J. 2002. Purification and
characterization of the Saccharomyces cerevisiaeorigin recognition complex:
interaction with origin DNA and Cdcl8 protein. JBiol Chem 277(19): 1692016927.
Chuang, R.Y. and Kelly, T.J. 1999. The fission yeast homologue of Orc4p binds to
replication origin DNA via multiple AT-hooks. Proc Natl Acad Sci U S A 96(6):
2656-2661.
Claycomb, J.M., MacAlpine, D.M., Evans, J.G., Bell, S.P., and Orr-Weaver, T.L. 2002.
Visualization of replication initiation and elongation in Drosophila.J Cell Biol
159(2): 225-236.
Cook, J.G., Chasse, D.A., and Nevins, J.R. 2004. The regulated association of Cdtl with
minichromosome maintenance proteins and Cdc6 in mammalian cells. J Biol
Chem 279(10): 9625-9633.
Costa, A., Pape, T., van Heel, M., Brick, P., Patwardhan, A., and Onesti, S. 2006.
Structural studies of the archaeal MCM complex in different functional states. J
Struct Biol.
Coverley, D., Pelizon, C., Trewick, S., and Laskey, R.A. 2000. Chromatin-bound Cdc6
persists in S and G2 phases in human cells, while soluble Cdc6 is destroyed in a
cyclin A-cdk2 dependent process. J Cell Sci 113 ( Pt 11): 1929-1938.
Coverley, D., Wilkinson, H.R., Madine, M.A., Mills, A.D., and Laskey, R.A. 1998.
Protein kinase inhibition in G2 causes mammalian Mcm proteins to reassociate
with chromatin and restores ability to replicate. Exp Cell Res 238(1): 63-69.
Cvetic, C. and Walter, J.C. 2005. Eukaryotic origins of DNA replication: could you
please be more specific? Semin Cell Dev Biol 16(3): 343-353.
Dahmann, C., Diffley, J.F., and Nasmyth, K.A. 1995. S-phase-promoting cyclindependent kinases prevent re-replication by inhibiting the transition of replication
origins to a pre-replicative state. Curr Biol 5(11): 1257-1269.
DePamphilis, M.L. 2003. The 'ORC cycle': a novel pathway for regulating eukaryotic
DNA replication. Gene 310: 1-15.
De Pamphilis, M.L. 2005. Cell cycle dependent regulation of the origin recognition
complex. Cell Cycle 4(1): 70-79.
Devault, A., Vallen, E.A., Yuan, T., Green, S., Bensimon, A., and Schwob, E. 2002.
Identification of Tahl 1/Sid2 as the ortholog of the replication licensing factor
Cdtl in Saccharomyces cerevisiae. Curr Biol 12(8): 689-694.
Diffley, J.F. 2004. Regulation of early events in chromosome replication. Curr Biol
14(18): R778-786.
Diffley, J.F. and Stillman, B. 1988. Purification of a yeast protein that binds to origins of
DNA replication and a transcriptional silencer. Proc Natl Acad Sci U S A 85(7):
2120-2124.
Dijkwel, P.A. and Hamlin, J.L. 1995. The Chinese hamster dihydrofolate reductase origin
consists of multiple potential nascent-strand start sites. Mol Cell Biol 15(6): 30233031.
Dowell, S.J., Romanowski, P., and Diffley, J.F. 1994. Interaction of Dbf4, the Cdc7
protein kinase regulatory subunit, with yeast replication origins in vivo. Science
265(5176): 1243-1246.
Drury, L.S., Perkins, G., and Diffley, J.F. 1997. The Cdc4/34/53 pathway targets Cdc6p
for proteolysis in budding yeast. Embo J 16(19): 5966-5976.
Edgar, B.A. and Orr-Weaver, T.L. 2001. Endoreplication cell cycles: more for less. Cell
105(3): 297-306.
Edwards, M.C., Tutter, A.V., Cvetic, C., Gilbert, C.H., Prokhorova, T.A., and Walter,
J.C. 2002. MCM2-7 complexes bind chromatin in a distributed pattern
surrounding the origin recognition complex in Xenopus egg extracts. J Biol Chem
277(36): 33049-33057.
Erzberger, J.P. and Berger, J.M. 2006. Evolutionary relationships and structural
mechanisms of aaa+ proteins. Annu Rev Biophys Biomol Struct 35: 93-114.
Ferenbach, A., Li, A., Brito-Martins, M., and Blow, J.J. 2005. Functional domains of the
Xenopus replication licensing factor Cdtl. Nucleic Acids Res 33(1): 316-324.
Fletcher, R.J., Bishop, B.E., Leon, R.P., Sclafani, R.A., Ogata, C.M., and Chen, X.S.
2003. The structure and function of MCM from archaeal M.
Thermoautotrophicum. Nat Struct Biol 10(3): 160-167.
Friedman, K.L., Brewer, B.J., and Fangman, W.L. 1997. Replication profile of
Saccharomyces cerevisiae chromosome VI. Genes Cells 2(11): 667-678.
Friedman, K.L., Diller, J.D., Ferguson, B.M., Nyland, S.V., Brewer, B.J., and Fangman,
W.L. 1996. Multiple determinants controlling activation of yeast replication
origins late in S phase. Genes Dev 10(13): 1595-1607.
Fujita, M., Kiyono, T., Hayashi, Y., and Ishibashi, M. 1996. hCDC47, a human member
of the MCM family. Dissociation of the nucleus-bound form during S phase. J
Biol Chem 271(8): 4349-4354.
Gambus, A., Jones, R.C., Sanchez-Diaz, A., Kanemaki, M., van Deursen, F., Edmondson,
R.D., and Labib, K. 2006. GINS maintains association of Cdc45 with MCM in
replisome progression complexes at eukaryotic DNA replication forks. Nat Cell
Biol 8(4): 358-366.
Giordano-Coltart, J., Ying, C.Y., Gautier, J., and Hurwitz, J. 2005. Studies of the
properties of human origin recognition complex and its Walker A motif mutants.
Proc Natl Acad Sci U S A 102(1): 69-74.
Goldman, M.A., Holmquist, G.P., Gray, M.C., Caston, L.A., and Nag, A. 1984.
Replication timing of genes and middle repetitive sequences. Science 224(4650):
686-692.
Gopalakrishnan, V., Simancek, P., Houchens, C., Snaith, H.A., Frattini, M.G., Sazer, S.,
and Kelly, T.J. 2001. Redundant control of rereplication in fission yeast. Proc
Natl Acad Sci U S A 98(23): 13114-13119.
Hartwell, L.H. 1976. Sequential function of gene products relative to DNA synthesis in
the yeast cell cycle. J Mol Biol 104(4): 803-817.
Harvey, K.J. and Newport, J. 2003. Metazoan origin selection: origin recognition
complex chromatin binding is regulated by CDC6 recruitment and ATP
hydrolysis. J Biol Chem 278(49): 48524-48528.
Hayles, J., Fisher, D., Woollard, A., and Nurse, P. 1994. Temporal order of S phase and
mitosis in fission yeast is determined by the state of the p34cdc2-mitotic B cyclin
complex. Cell 78(5): 813-822.
Hofmann, J.F. and Beach, D. 1994. cdtl is an essential target of the CdclO/Sctl
transcription factor: requirement for DNA replication and inhibition of mitosis.
Embo J 13(2): 425-434.
Hu, J. and Xiong, Y. 2006. An evolutionarily conserved function of proliferating cell
nuclear antigen for Cdtl degradation by the Cul4-Ddbl ubiquitin ligase in
response to DNA damage. J Biol Chem 281(7): 3753-3756.
Hua, X.H., Yan, H., and Newport, J. 1997. A role for Cdk2 kinase in negatively
regulating DNA replication during S phase of the cell cycle. J Cell Biol 137(1):
183-192.
Ishimi, Y. 1997. A DNA helicase activity is associated with an MCM4, -6, and -7 protein
complex. J Biol Chem 272(39): 24508-24513.
Jallepalli, P.V., Brown, G.W., Muzi-Falconi, M., Tien, D., and Kelly, T.J. 1997.
Regulation of the replication initiator protein p65cdc18 by CDK phosphorylation.
Genes Dev 11(21): 2767-2779.
Jares, P. and Blow, J.J. 2000. Xenopus cdc7 function is dependent on licensing but not on
XORC, XCdc6, or CDK activity and is required for XCdc45 loading. Genes Dev
14(12): 1528-1540.
Jiang, W., Wells, N.J., and Hunter, T. 1999. Multistep regulation of DNA replication by
Cdk phosphorylation of HsCdc6. Proc Natl Acad Sci U S A 96(11): 6193-6198.
Jong, A., Young, M., Chen, G.C., Zhang, S.Q., and Chan, C. 1996. Intracellular location
of the Saccharomyces cerevisiaeCDC6 gene product. DNA Cell Biol 15(10): 883895.
Keller, C., Ladenburger, E.M., Kremer, M., and Knippers, R. 2002. The origin
recognition complex marks a replication origin in the human TOP1 gene
promoter. J Biol Chem 277(35): 31430-31440.
Klemm, R.D., Austin, R.J., and Bell, S.P. 1997. Coordinate binding of ATP and origin
DNA regulates the ATPase activity of the origin recognition complex. Cell 88(4):
493-502.
Klemm, R.D. and Bell, S.P. 2001. ATP bound to the origin recognition complex is
important for preRC formation. Proc Natl Acad Sci U S A 98(15): 8361-8367.
Kominami, K. and Toda, T. 1997. Fission yeast WD-repeat protein pop regulates
genome ploidy through ubiquitin-proteasome-mediated degradation of the CDK
inhibitor Ruml and the S-phase initiator Cdcl8. Genes Dev 11(12): 1548-1560.
Kong, D. and DePamphilis, M.L. 2001. Site-specific DNA binding of the Saccharomyces
cerevisiaeorigin recognition complex is determined by the Orc4 subunit. Mol
Cell Biol 21(23): 8095-8103.
Labib, K., Diffley, J.F., and Kearsey, S.E. 1999. Gi-phase and B-type cyclins exclude the
DNA-replication factor Mcm4 from the nucleus. Nat Cell Biol 1(7): 415-422.
Labib, K., Tercero, J.A., and Diffley, J.F. 2000. Uninterrupted MCM2-7 function
required for DNA replication fork progression. Science 288(5471): 1643-1647.
Leatherwood, J., Lopez-Girona, A., and Russell, P. 1996. Interaction of Cdc2 and Cdcl8
with a fission yeast ORC2-like protein. Nature 379(6563): 360-363.
Lee, C., Hong, B., Choi, J.M., Kim, Y., Watanabe, S., Ishimi, Y., Enomoto, T., Tada, S.,
Kim, Y., and Cho, Y. 2004. Structural basis for inhibition of the replication
licensing factor Cdtl by geminin. Nature 430(7002): 913-917.
Lee, J.K. and Hurwitz, J. 2000. Isolation and characterization of various complexes of the
minichromosome maintenance proteins of Saccharomyces cerevisiae. J Biol
Chem 275(25): 18871-18878.
Lee, J.K., Moon, K.Y., Jiang, Y., and Hurwitz, J. 2001. The Saccharomyces cerevisiae
origin recognition complex interacts with multiple AT-rich regions of the
replication origin DNA by means of the AT-hook domains of the spOrc4 protein.
Proc Natl Acad Sci U S A 98(24): 13589-13594.
Li, A. and Blow, J.J. 2005. Cdtl downregulation by proteolysis and geminin inhibition
prevents DNA re-replication in Xenopus. Embo J 24(2): 395-404.
Li, C.J. and DePamphilis, M.L. 2002. Mammalian Orcl protein is selectively released
from chromatin and ubiquitinated during the S-to-M transition in the cell division
cycle. Mol Cell Biol 22(1): 105-116.
Li, X., Zhao, Q., Liao, R., Sun, P., and Wu, X. 2003. The SCF(Skp2) ubiquitin ligase
complex interacts with the human replication licensing factor Cdtl and regulates
Cdtl degradation. J Biol Chem 278(33): 30854-30858.
Liku, M.E., Nguyen, V.Q., Rosales, A.W., Irie, K., and Li, J.J. 2005. CDK
phosphorylation of a novel NLS-NES module distributed between two subunits of
the Mcm2-7 complex prevents chromosomal rereplication. Mol Biol Cell 16(10):
5026-5039.
Lin, C.M., Fu, H., Martinovsky, M., Bouhassira, E., and Aladjem, M.I. 2003. Dynamic
alterations of replication timing in mammalian cells. CurrBiol 13(12): 10191028.
Lipford, J.R. and Bell, S.P. 2001. Nucleosomes positioned by ORC facilitate the
initiation of DNA replication. Mol Cell 7(1): 21-30.
Liu, E., Li, X., Yan, F., Zhao, Q., and Wu, X. 2004. Cyclin-dependent kinases
phosphorylate human Cdtl and induce its degradation. J Biol Chem 279(17):
17283-17288.
Loog, M. and Morgan, D.O. 2005. Cyclin specificity in the phosphorylation of cyclindependent kinase substrates. Nature 434(7029): 104-108.
MacAlpine, D.M. and Bell, S.P. 2005. A genomic view of eukaryotic DNA replication.
Chromosome Res 13(3): 309-326.
MacAlpine, D.M., Rodriguez, H.K., and Bell, S.P. 2004. Coordination of replication and
transcription along a Drosophilachromosome. Genes Dev 18(24): 3094-3105.
Mahbubani, H.M., Chong, J.P., Chevalier, S., Thommes, P., and Blow, J.J. 1997. Cell
cycle regulation of the replication licensing system: involvement of a Cdkdependent inhibitor. J Cell Biol 136(1): 125-135.
Maiorano, D., Krasinska, L., Lutzmann, M., and Mechali, M. 2005. Recombinant Cdtl
induces rereplication of G2 nuclei in Xenopus egg extracts. CurrBiol 15(2): 146153.
Maiorano, D., Moreau, J., and Mechali, M. 2000. XCDT1 is required for the assembly of
pre-replicative complexes in Xenopus laevis. Nature 404(6778): 622-625.
Maiorano, D., Rul, W., and Mechali, M. 2004. Cell cycle regulation of the licensing
activity of Cdtl in Xenopus laevis. Exp Cell Res 295(1): 138-149.
Maiorano, D., Van Assendelft, G.B., and Kearsey, S.E. 1996. Fission yeast cdc21, a
member of the MCM protein family, is required for onset of S phase and is
located in the nucleus throughout the cell cycle. Embo J 15(4): 861-872.
Marahrens, Y. and Stillman, B. 1992. A yeast chromosomal origin of DNA replication
defined by multiple functional elements. Science 255(5046): 817-823.
Masai, H. and Arai, K. 2002. Cdc7 kinase complex: a key regulator in the initiation of
DNA replication. J Cell Physiol 190(3): 287-296.
Masai, H., Matsui, E., You, Z., Ishimi, Y., Tamai, K., and Arai, K. 2000. Human Cdc7related kinase complex. In vitro phosphorylation of MCM by concerted actions of
Cdks and Cdc7 and that of a criticial threonine residue of Cdc7 bY Cdks. J Biol
Chem 275(37): 29042-29052.
Masumoto, H., Muramatsu, S., Kamimura, Y., and Araki, H. 2002. S-Cdk-dependent
phosphorylation of Sld2 essential for chromosomal DNA replication in budding
yeast. Nature 415(6872): 651-655.
McGarry, T.J. and Kirschner, M.W. 1998. Geminin, an inhibitor of DNA replication, is
degraded during mitosis. Cell 93(6): 1043-1053.
Mendez, J. and Stillman, B. 2000. Chromatin association of human origin recognition
complex, cdc6, and minichromosome maintenance proteins during the cell cycle:
assembly of prereplication complexes in late mitosis. Mol Cell Biol 20(22): 86028612.
-. 2003. Perpetuating the double helix: molecular machines at eukaryotic DNA
replication origins. Bioessays 25(12): 1158-1167.
Mendez, J., Zou-Yang, X.H., Kim, S.Y., Hidaka, M., Tansey, W.P., and Stillman, B.
2002. Human origin recognition complex large subunit is degraded by ubiquitinmediated proteolysis after initiation of DNA replication. Mol Cell 9(3): 481-491.
Mimura, S., Seki, T., Tanaka, S., and Diffley, J.F. 2004. Phosphorylation-dependent
binding of mitotic cyclins to Cdc6 contributes to DNA replication control. Nature
431(7012): 1118-1123.
Mizushima, T., Takahashi, N., and Stillman, B. 2000. Cdc6p modulates the structure and
DNA binding activity of the origin recognition complex in vitro. Genes Dev
14(13): 1631-1641.
Montagnoli, A., Bosotti, R., Villa, F., Rialland, M., Brotherton, D., Mercurio, C.,
Berthelsen, J., and Santocanale, C. 2002. Drfl, a novel regulatory subunit for
human Cdc7 kinase. Embo J 21(12): 3171-3181.
Montagnoli, A., Valsasina, B., Brotherton, D., Troiani, S., Rainoldi, S., Tenca, P.,
Molinari, A., and Santocanale, C. 2006. Identification of Mcm2 phosphorylation
sites by S-phase-regulating kinases. J Biol Chem 281(15): 10281-10290.
Muzi Falconi, M., Brown, G.W., and Kelly, T.J. 1996. cdcl8+ regulates initiation of
DNA replication in Saccharomyces cerevisiae.Proc Natl Acad Sci U S A 93(4):
1566-1570.
Nguyen, V.Q., Co, C., Irie, K., and Li, J.J. 2000. Clb/Cdc28 kinases promote nuclear
export of the replication initiator proteins Mcm2-7. Curr Biol 10(4): 195-205.
Nguyen, V.Q., Co, C., and Li, J.J. 2001. Cyclin-dependent kinases prevent DNA rereplication through multiple mechanisms. Nature 411(6841): 1068-1073.
Nishitani, H., Lygerou, Z., Nishimoto, T., and Nurse, P. 2000. The Cdtl protein is
required to license DNA for replication in fission yeast. Nature 404(6778): 625628.
Nishitani, H. and Nurse, P. 1997. The cdcl8 protein initiates DNA replication in fission
yeast. Prog Cell Cycle Res 3: 135-142.
Nougarede, R., Della Seta, F., Zarzov, P., and Schwob, E. 2000. Hierarchy of S-phasepromoting factors: yeast Dbf4-Cdc7 kinase requires prior S-phase cyclindependent kinase activation. Mol Cell Biol 20(11): 3795-3806.
Ogawa, Y., Takahashi, T., and Masukata, H. 1999. Association of fission yeast Orpl and
Mcm6 proteins with chromosomal replication origins. Mol Cell Biol 19(10):
7228-7236.
Okuno, Y., McNairn, A.J., den Elzen, N., Pines, J., and Gilbert, D.M. 2001. Stability,
chromatin association and functional activity of mammalian pre-replication
complex proteins during the cell cycle. Embo J 20(15): 4263-4277.
Pacek, M., Tutter, A.V., Kubota, Y., Takisawa, H., and Walter, J.C. 2006. Localization of
MCM2-7, Cdc45, and GINS to the site of DNA unwinding during eukaryotic
DNA replication. Mol Cell 21(4): 581-587.
Palzkill, T.G. and Newlon, C.S. 1988. A yeast replication origin consists of multiple
copies of a small conserved sequence. Cell 53(3): 441-450.
Pelizon, C., Madine, M.A., Romanowski, P., and Laskey, R.A. 2000. Unphosphorylatable
mutants of Cdc6 disrupt its nuclear export but still support DNA replication once
per cell cycle. Genes Dev 14(19): 2526-2533.
Petersen, B.O., Lukas, J., Sorensen, C.S., Bartek, J., and Helin, K. 1999. Phosphorylation
of mammalian CDC6 by cyclin A/CDK2 regulates its subcellular localization.
Embo J 18(2): 396-410.
Petersen, B.O., Wagener, C., Marinoni, F., Kramer, E.R., Melixetian, M., Lazzerini
Denchi, E., Gieffers, C., Matteucci, C., Peters, J.M., and Helin, K. 2000. Cell
cycle- and cell growth-regulated proteolysis of mammalian CDC6 is dependent on
APC-CDH1. Genes Dev 14(18): 2330-2343.
Randell, J.C., Bowers, J.L., Rodriguez, H.K., and Bell, S.P. 2006. Sequential ATP
hydrolysis by Cdc6 and ORC directs loading of the Mcm2-7 helicase. Mol Cell
21(1): 29-39.
Rao, H. and Stillman, B. 1995. The origin recognition complex interacts with a bipartite
DNA binding site within yeast replicators. Proc Natl Acad Sci U S A 92(6): 22242228.
Remus, D., Beall, E.L., and Botchan, M.R. 2004. DNA topology, not DNA sequence, is a
critical determinant for DrosophilaORC-DNA binding. Embo J 23(4): 897-907.
Rialland, M., Sola, F., and Santocanale, C. 2002. Essential role of human CDT 1 in DNA
replication and chromatin licensing. J Cell Sci 115(Pt 7): 1435-1440.
Royzman, I., Austin, R.J., Bosco, G., Bell, S.P., and Orr-Weaver, T.L. 1999. ORC
localization in Drosophilafollicle cells and the effects of mutations in dE2F and
dDP. Genes Dev 13(7): 827-840.
Saha, P., Chen, J., Thome, K.C., Lawlis, S.J., Hou, Z.H., Hendricks, M., Parvin, J.D., and
Dutta, A. 1998. Human CDC6/Cdcl8 associates with Orc and cyclin-cdk and is
selectively eliminated from the nucleus at the onset of S phase. Mol Cell Biol
18(5): 2758-2767.
Saha, S., Shan, Y., Mesner, L.D., and Hamlin, J.L. 2004. The promoter of the Chinese
hamster ovary dihydrofolate reductase gene regulates the activity of the local
origin and helps define its boundaries. Genes Dev 18(4): 397-410.
Sato, M., Gotow, T., You, Z., Komamura-Kohno, Y., Uchiyama, Y., Yabuta, N., Nojima,
H., and Ishimi, Y. 2000. Electron microscopic observation and single-stranded
DNA binding activity of the Mcm4,6,7 complex. J Mol Biol 300(3): 421-431.
Saxena, S. and Dutta, A. 2005. Geminin-Cdtl balance is critical for genetic stability.
Mutat Res 569(1-2): 111-121.
Saxena, S., Yuan, P., Dhar, S.K., Senga, T., Takeda, D., Robinson, H., Kornbluth, S.,
Swaminathan, K., and Dutta, A. 2004. A dimerized coiled-coil domain and an
adjoining part of geminin interact with two sites on Cdtl for replication
inhibition. Mol Cell 15(2): 245-258.
Schubeler, D., Scalzo, D., Kooperberg, C., van Steensel, B., Delrow, J., and Groudine, M.
2002. Genome-wide DNA replication profile for Drosophilamelanogaster: a link
between transcription and replication timing. Nat Genet 32(3): 438-442.
Schwacha, A. and Bell, S.P. 2001. Interactions between two catalytically distinct MCM
subgroups are essential for coordinated ATP hydrolysis and DNA replication. Mol
Cell 8(5): 1093-1104.
Senga, T., Sivaprasad, U., Zhu, W., Park, J.H., Arias, E.E., Walter, J.C., and Dutta, A.
2006. PCNA is a cofactor for Cdtl degradation by CUL4/DDB 1-mediated Nterminal ubiquitination. J Biol Chem 281(10): 6246-6252.
Silva, T., Bradley, R.H., Gao, Y., and Coue, M. 2006. Xenopus CDC7/DRF1 complex is
required for the initiation of DNA replication. J Biol Chem 281(17): 1156911576.
Speck, C., Chen, Z., Li, H., and Stillman, B. 2005. ATPase-dependent cooperative
binding of ORC and Cdc6 to origin DNA. Nat Struct Mol Biol 12(11): 965-971.
Stambrook, P.J. and Flickinger, R.A. 1970. Changes i chromosomal DNA replication
tterns in developing frog embryos. J Exp Zool 174(1): 101-113.
Stinchcomb, D.T., Struhl, K., and Davis, R.W. 1979. Isolation and characterisation of a
yeast chromosomal replicator. Nature 282(5734): 39-43.
Sugimoto, N., Tatsumi, Y., Tsurumi, T., Matsukage, A., Kiyono, T., Nishitani, H., and
Fujita, M. 2004. Cdtl phosphorylation by cyclin A-dependent kinases negatively
regulates its function without affecting geminin binding. J Biol Chem 279(19):
19691-19697.
Sun, W.H., Coleman, T.R., and DePamphilis, M.L. 2002. Cell cycle-dependent regulation
of the association between origin recognition proteins and somatic cell chromatin.
Embo J 21(6): 1437-1446.
Tada, S., Chong, J.P., Mahbubani, H.M., and Blow, J.J. 1999. The RLF-B component of
the replication licensing system is distinct from Cdc6 and functions after Cdc6
binds to chromatin. Curr Biol 9(4): 211-214.
Takahashi, T.S. and Walter, J.C. 2005. Cdc7-Drfl is a developmentally regulated protein
kinase required for the initiation of vertebrate DNA replication. Genes Dev
19(19): 2295-2300.
Takahashi, T.S., Wigley, D.B., and Walter, J.C. 2005. Pumps, paradoxes and
ploughshares: mechanism of the MCM2-7 DNA helicase. Trends Biochem Sci
30(8): 437-444.
Tanaka, S. and Diffley, J.F. 2002. Interdependent nuclear accumulation of budding yeast
Cdtl and Mcm2-7 during G1 phase. Nat Cell Biol 4(3): 198-207.
Thomer, M., May, N.R., Aggarwal, B.D., Kwok, G., and Calvi, B.R. 2004. Drosophila
double-parked is sufficient to induce re-replication during development and is
regulated by cyclin E/CDK2. Development 131(19): 4807-4818.
Tsuyama, T., Tada, S., Watanabe, S., Seki, M., and Enomoto, T. 2005. Licensing for
DNA replication requires a strict sequential assembly of Cdc6 and Cdtl onto
chromatin in Xenopus egg extracts. Nucleic Acids Res 33(2): 765-775.
Vas, A., Mok, W., and Leatherwood, J. 2001. Control of DNA rereplication via Cdc2
phosphorylation sites in the origin recognition complex. Mol Cell Biol 21(17):
5767-5777.
Vashee, S., Cvetic, C., Lu, W., Simancek, P., Kelly, T.J., and Walter, J.C. 2003.
Sequence-independent DNA binding and replication initiation by the human
origin recognition complex. Genes Dev 17(15): 1894-1908.
Vogelauer, M., Rubbi, L., Lucas, I., Brewer, B.J., and Grunstein, M. 2002. Histone
acetylation regulates the time of replication origin firing. Mol Cell 10(5): 12231233.
Wang, L., Lin, C.M., Brooks, S., Cimbora, D., Groudine, M., and Aladjem, M.I. 2004.
The human beta-globin replication initiation region consists of two modular
independent replicators. Mol Cell Biol 24(8): 3373-3386.
Whittaker, A.J., Royzman, I., and Orr-Weaver, T.L. 2000. Drosophiladouble parked: a
conserved, essential replication protein that colocalizes with the origin recognition
complex and links DNA replication with mitosis and the down-regulation of S
phase transcripts. Genes Dev 14(14): 1765-1776.
Wilmes, G.M., Archambault, V., Austin, R.J., Jacobson, M.D., Bell, S.P., and Cross, F.R.
2004. Interaction of the S-phase cyclin Clb5 with an "RXL" docking sequence in
the initiator protein Orc6 provides an origin-localized replication control switch.
Genes Dev 18(9): 981-991.
Wilmes, G.M. and Bell, S.P. 2002. The B2 element of the Saccharomyces cerevisiae
ARS 1 origin of replication requires specific sequences to facilitate pre-RC
formation. Proc Natl Acad Sci U S A 99(1): 101-106.
Wuarin, J., Buck, V., Nurse, P., and Millar, J.B. 2002. Stable association of mitotic cyclin
B/Cdc2 to replication origins prevents endoreduplication. Cell 111(3): 419-431.
Wyrick, J.J., Aparicio, J.G., Chen, T., Barnett, J.D., Jennings, E.G., Young, R.A., Bell,
S.P., and Aparicio, O.M. 2001. Genome-wide distribution of ORC and MCM
proteins in S. cerevisiae: high-resolution mapping of replication origins. Science
294(5550): 2357-2360.
Yabuta, N., Kajimura, N., Mayanagi, K., Sato, M., Gotow, T., Uchiyama, Y., Ishimi, Y.,
and Nojima, H. 2003. Mammalian Mcm2/4/6/7 complex forms a toroidal
structure. Genes Cells 8(5): 413-421.
Yanow, S.K., Gold, D.A., Yoo, H.Y., and Dunphy, W.G. 2003. Xenopus Drfl, a regulator
of Cdc7, displays checkpoint-dependent accumulation on chromatin during an Sphase arrest. J Biol Chem 278(42): 41083-41092.
49
Yanow, S.K., Lygerou, Z., and Nurse, P. 2001. Expression of Cdcl8/Cdc6 and Cdtl
during G2 phase induces initiation of DNA replication. Embo J 20(17): 46484656.
Ying, C.Y. and Gautier, J. 2005. The ATPase activity of MCM2-7 is dispensable for preRC assembly but is required for DNA unwinding. Embo J 24(24): 4334-4344.
Zhang, H. and Tower, J. 2004. Sequence requirements for function of the Drosophila
chorion gene locus ACE3 replicator and ori-beta origin elements. Development
131(9): 2089-2099.
Zhong, W., Feng, H., Santiago, F.E., and Kipreos, E.T. 2003. CUL-4 ubiquitin ligase
maintains genome stability by restraining DNA-replication licensing. Nature
423(6942): 885-889.
Zou, L. and Stillman, B. 2000. Assembly of a complex containing Cdc45p, replication
protein A, and Mcm2p at replication origins controlled by S-phase cyclindependent kinases and Cdc7p-Dbf4p kinase. Mol Cell Biol 20(9): 3086-3096.
Chapter II
Genome-wide Analysis of Re-replication Reveals Inhibitory
Controls that Target Multiple Stages of Replication Initiation
An earlier version of this work was published in 2006 under the same title (Mol Biol Cell
17: 2415-2423). The authors were Robyn E. Tanny, David M. MacAlpine, Hannah G.
Blitzblau and Stephen P. Bell. The experiments and analysis shown in Figures 1, 2A, 3,
5, and 6 and Table 1 were performed by RET. The genome-wide location analysis
presented in Figure 2B was performed by RET and HGB. The method of array analysis
was designed by MDM. The analysis in Figure 4 was performed by MDM and RET.
I would like to thank Rick Young for providing access to the design of the 44K Agilent
DNA microarrays and Tony Lee for technical help using the DNA microarrays; Milan de
Vries, Erik Andersen, Joachim Li, Terry Orr-Weaver and Angelika Amon for helpful
discussion and comments on the manuscript; and Joachim Li for sharing unpublished
data.
Summary
DNA replication must be tightly controlled during each cell cycle to prevent unscheduled
replication and ensure proper genome maintenance. The currently known controls that
prevent re-replication act redundantly to inhibit pre-Replicative Complex (pre-RC)
assembly outside of the G1 phase of the cell cycle. The yeast Saccharomyces cerevisisae
has been a useful model organism to study how eukaryotic cells prevent replication
origins from re-initiating during a single cell cycle. Using a re-replication-sensitive strain
and DNA microarrays, we map sites across the S. cerevisiae genome that are rereplicated as well as sites of pre-RC formation during re-replication. Only a fraction of
the genome is re-replicated by a subset of origins, some of which are capable of multiple
re-initiation events. Translocation experiments demonstrate that origin-proximal
sequences are sufficient to pre-dispose an origin to re-replication. Origins that re-initiate
are largely limited to those that can recruit Mcm2-7 under re-replicating conditions,
however, the formation of a pre-RC is not sufficient for re-initiation. Our findings allow
us to categorize origins with respect to their propensity to re-initiate and demonstrate that
pre-RC formation is not the only target for the mechanisms that prevent genomic rereplication.
Introduction
Eukaryotic DNA replication is tightly controlled to ensure that the genome is
copied exactly once before chromosome segregation and cytokinesis. Inappropriate
replication after S phase leads to severe DNA damage (Green and Li 2005) and cell death
(Yanow et al. 2001; Melixetian et al. 2004; Wilmes et al. 2004). To prevent these
catastrophic effects, cells use multiple overlapping mechanisms to prevent unscheduled
replication (Diffley 2004; Blow and Dutta 2005).
The initiation of eukaryotic DNA replication is divided into two stages: origin
selection and origin activation. Origins of DNA replication are selected by the formation
of the pre-Replicative Complex (pre-RC) (Mendez and Stillman 2003). The first event in
pre-RC formation is the binding of the Origin Recognition Complex (ORC) to origin
DNA. During G1, ORC recruits other members of the pre-RC, including Cdc6 and Cdtl.
Together these proteins load the six-subunit Mini-Chromosome Maintenance complex
(Mcm2-7), the putative replicative helicase (Takahashi et al. 2005), onto origin DNA. As
cells enter S phase, origins are activated by cyclin-dependent kinases (CDKs) and the
Dbf4-dependent kinase (Bell and Dutta 2002). These kinases target both pre-RC
components and other replication factors to trigger the recruitment of replication proteins
necessary for origin unwinding and DNA synthesis.
Eukaryotic chromosomes require multiple origins spread over their length to
ensure that each chromosome is copied during S phase. Although pre-RCs are assembled
at all potential origins during G1, origins are not all activated at the same time. A
temporal replication program leads to the activation of each origin at a characteristic time
during S phase with some origins initiating early in S-phase, others later, and still others
not at all (Donaldson 2005). The mechanisms controlling this program are poorly
understood, but specific cyclins (Donaldson et al. 1998; Hu and Aparicio 2005),
checkpoint proteins (Santocanale and Diffley 1998; Shirahige et al. 1998) and levels of
chromosome acetylation (Vogelauer et al. 2002; Aparicio et al. 2004) have each been
shown to affect this temporal program.
Once an origin has initiated, multiple mechanisms exist in all eukaryotes to
prevent inappropriate re-initiation from occurring within the same cell cycle
(Gopalakrishnan et al. 2001; Nguyen et al. 2001; Yanow et al. 2001). Although the exact
mechanisms of inhibition differ in all eukaryotes studied, CDK-dependent
phosphorylation targets pre-RC components to prevent new pre-RC formation after cells
exit GI (Machida et al. 2005). By oscillating between low (Gl) and high (S, G2, M)
CDK activity, pre-RCs can only form and be activated once per cell cycle. Multi-cellular
eukaryotes have at least one additional CDK-independent inhibitor of re-replication
called geminin. This protein binds and inhibits Cdtl (Wohlschlegel et al. 2000), thereby
preventing new pre-RC formation outside of the GI phase (Mihaylov et al. 2002;
Melixetian et al. 2004; Zhu et al. 2004).
In B-type CDKs, which are composed of the Cdkl/Cdc28 kinase and one of six
different B-type cyclins (Clbl-6), inhibit pre-RC formation by phosphorylating three
components of the pre-RC (Nguyen et al. 2001). The resulting modifications have distinct
consequences for each target. Phosphorylation of Cdc6 and Mcm2-7 leads to degradation
(Elsasser et all. 1999; Drury et al. 2000) and export to the cytoplasm (Labib et al. 1999;
Nguyen et al. 2000), respectively. Cdc28 also phosphorylates at least two of the six ORC
subunits, Orc2 and Orc6 (Nguyen et al. 2001), but how these modifications inhibit ORC's
role in pre-RC formation is currently unknown. All of the phosphorylation events
described above prevent new pre-RC formation, which, in turn, prevents re-initiation. In
addition to these mechanisms, direct interactions between ORC and cyclins prevent preRC formation in S. pombe (Wuarin et al. 2002) and S. cerevisiae (Wilmes et al. 2004).
In S. cerevisiae,the controls against re-initiation can be overcome by disrupting
three of the CDK-dependent mechanisms described above. A strain modified to express
non-degradable Cdc6, constitutively localize Mcm2-7 to the nucleus and inhibit
phosphorylation of Orc2 and Orc6, can initiate a second round of initiation during a
single cell cycle (Nguyen et al. 2001). Disrupting the interaction between the S-phase
cyclin, Clb5, and the smallest ORC subunit Orc6 (in addition to the above mutations)
results in further re-replication (Wilmes et al. 2004). Analysis of DNA content from rereplicating S. cerevisiae strains has shown that the majority of cells in the population do
not fully re-replicate their genome. Interestingly, when a subset of origins was monitored
for the ability to initiate during re-replication, only some of those tested showed reinitiation (Nguyen et al. 2001). These data suggest that not all origins are sensitive to reinitiation.
To gain insight into how the genome protects itself from re-replication, we
bypassed all known re-replication control mechanisms in S. cerevisiae and identified
origins across genome that re-initiated. We show that re-replication initiates from a
subset of origins used in S phase, that the sensitivity to re-replication varies between
origins and that some origins are capable of re-initiating multiple times. Finally, we also
show that Mcm2-7 loading is required, but not sufficient, for origins to re-initiate,
indicating that there are layers of control beyond those inhibiting pre-RC formation that
prevent re-replication.
Results
Re-replicationinitiates at distinct sites in the genome
To assess the extent of re-replication across the S. cerevisiae genome, we used
DNA microarrays to determine changes in DNA copy number as cells underwent rereplication. This technique has been used previously to identify sites of replication
initiation by detecting newly synthesized DNA as cells pass through S-phase
(Raghuraman et al. 2001; Yabuki et al. 2002). Our experiments were conducted using an
S. cerevisiae strain with mutations that overcome all currently known mechanisms that
prevent re-initiation (Wilmes et al. 2004). Re-replication in this strain is controlled using
a galactose-inducible, non-degradable Cdc6. To ensure that all observed replication was
due to re-replication, cells were arrested in G2/M prior to the induction of re-replication
(Figure lA). DNA was isolated from re-replicating cells at various time points after
addition of galactose (Figure IB). Unreplicated DNA isolated from Gl-arrested cells
served as a hybridization reference. The two populations of DNA were differentially
labeled and co-hybridized to a high-density DNA microarray with 44,000 features
distributed throughout the genome (Pokholok et al. 2005). Initial experiments showed
that cells after three hours of Cdc6 induction had significant re-replication (Figure 1B),
thus this time point was used in all subsequent experiments.
Analysis of three independent experiments showed that re-replication occurs at
specific sites in the genome. To visualize the sites of re-replication, the log ratio of rereplicated/unreplicated DNA for each spot on the array was plotted as a function of its
position along the chromosome (Figure 2A). The resulting profiles have distinct peaks,
identifying sequences present in elevated copy number and that have re-replicated.
Control experiments using strains lacking the genetic changes required for re-replication
showed no significant variation in DNA copy number across the genome (Supplemental
Figure 1).
Figure 1.
GAL-cdc6dn
mcm7-NLS
orc6-ps,rxl
orc2-ps
+ nocodazole
induce re-replication
with galactose
I
3hr
collect cells
isolate DNA
hybridize to array
2C
4C
Hrs post addition
of galactose
Figure 1. Multiple pre-RC mutations result in induced re-replication (A) An outline of
the re-replication experiment. Re-replication-sensitive cells were grown to an OD 600 of
0.4 in YPD and then arrested in nocodazole. After the cells were arrested, galactose was
added to induce expression of Cdc6AN. After 3 hrs, cells were collected for further
experiments. (B) FACS analysis of the re-replication-sensitive strain SB 1507 (See Table
3) several hours after induction of re-replication.
Re-Replication initiatesfrom sites of G1 pre-RCformation
Peaks in the re-replication profile represent the most frequently re-replicated
sequences, suggesting that they are sites of re-initiation. To determine if these sites are
concomitant with previously identified, potential origins, we compared the re-replication
profile to sites of G1 pre-RC formation in wild-type cells as determined by genome-wide
location analysis of Mcm2-7. This comparison allowed us to determine if peaks of rereplication co-localized with sites that have the capability to initiate replication during S
phase.
To compare the re-replication profile and G1 Mcm2-7 binding sites, we
determined the midpoint of the peaks in each of the data sets. Before analysis, we
applied a smoothing algorithm (see Experimental Procedures) to the re-replication profile
to help delineate the peaks by reducing random noise (Figure 2B gray histogram,
Supplemental Figure 2). Initial analysis showed that peaks on the re-replication profile
substantially overlapped sites of Mcm2-7 binding (Figure 2B black histogram,
Supplementary Figure 3). To conduct a more quantitative analysis, a peak-finding
algorithm (see Experimental Procedures) was used to define the midpoints of the peaks
along the chromosome in both data sets. We monitored the overlap between peaks on the
re-replication profile and sites of Mcm2-7 binding using a range of window sizes and
found that a 7.5 kb window was optimal. Using this window size, 82 % of re-replication
peaks overlapped with Mcm2-7 binding sites (Table 1). We noted that the peak-finding
algorithm was not able to identify all sites of re-replication and thus possible re-initiation
(e.g. peaks at chromosome ends; see Supplemental Figure 4). Accounting for these uncalled initiation sites in the re-replication data set, the final percent of re-replication peaks
that are within 7.5 kb of an Mcm2-7 binding site is 91%. We conclude that re-replication
largely occurred at sites that normally direct pre-RC formation during G1.
Although nearly all sites of re-replication overlapped with Mcm2-7 binding sites,
the converse was not true. There were many sites of G1 pre-RC formation that did not
align with peaks of re-replication. Using the same computational-based analysis as
described above, we found that only 31% of all sites of pre-RC formation during G 1
showed significant re-replication (Table 1). Together, our data show on a genome-wide
Figure 2.
A
"O
CL
a-I.o
-o
I-0)
OI
I
I
I
I
I
I
I
200
400
600
800
1000
1200
1400
Chr. IV Position (kb)
9:
,C
O
,8
L\ QI;
Q·~:
P~'
(0
cz
(1
0
LO)
L
") (1.
aI- o')
Co
0-Icz
4I-
ocz
CNE00
0) a
-a)
D)
0)
200
400
600
800
1000
Chr. IV Position (kb)
1200
1400
Figure 2. Analysis of genome-wide re-replication (A) Re-replication is detected by copy
number analysis using DNA microarrays. DNA from re-replicating cells and from G1arrested cells was differentially labeled and co-hybridized to a high-density DNA
microarray. The log ratio replicated/unreplicated (refered to as "Relative Enrichment
(logCy3/Cy5)") for each spot was plotted as a function of its position along the
chromosome. Chromosome IV (See Supplementary Figure 2 for other chromosomes) is
shown here as an example. (B) Sites of re-replication initiation are associated with G1
Mcm2-7 binding sites. A smoothing algorithm and a significance cut-off was applied to
the re-replication data (see Materials and Methods) and plotted here for Chromosome IV
(gray histogram). Gl Mcm2-7 binding sites (black histogram), determined by genomewide location analysis, are superimposed on top of the re-replication data. Key sites
discussed throughout the text, ARS1, ARS418, ARS428 and iYDR309C, are marked with a
gray dashed line
0,
-~
cca
-U
C.) .
.,
-
E-
eeC;- 1
C-)3
"ct
=-)-
0O f
c· -
©
cz
C-)
o.
o
CC
-=
c
0
.)
• ,"
C)-)
o
z,-
M
C4 co
m
C
C
c-
ric
)
Ia-)
2
cl
C
00
oo
--
-
:r=
0
u
0=
ca
.OC
~cu
ao
ca
13
as
cCC.
0i
C-)
U
C.)
Cd
~C-Q)
C -)
e=
0
C-
I
-C
o
.
" '
-)
'l
-& -
a eZ o
-
a
u
(
C-)
C.)s
O-
d>'=
E-.
I
zD
-e
g
*a
~
-
0
level that not all potential sites of initiation can re-replicate and, therefore, that the extent
of protection from re-replication is not uniform across the genome.
OriginsDirectRe-replication
To address directly if origin sequences are required for re-replication, we asked if
moving an origin sequence associated with a peak of re-replication was sufficient to
establish a new site of re-replication in the genome. These experiments focused on the
ARS418 locus, which is a site of Gl pre-RC formation (Figure 2B black histogram),
provides origin function on a plasmid (data not shown), is a peak on an S-phase timing
curve (Raghuraman et al. 2001; Yabuki et al. 2002; MacAlpine and Bell 2005) (data not
shown), and is closely associated with a prominent peak on the re-replication profile
(Figure 2B gray histogram). 600 bp surrounding the ARS418 locus was integrated at an
ectopic intergenic region (iYDR309C) that showed little, if any, re-replication (Figure 3A
gray histogram and 5B closed circles). Using the re-replication-sensitive strain containing
the ectopic ARS418, we performed the same re-replication experiment described above.
The resulting re-replication profile showed that the insertion of ARS418 at the iYDR309C
locus induced substantial re-replication (Figure 3B gray histogram) as compared to the
strain without the ectopic ARS418 (Figure 3A and Figure 3B dashed line). We also
ectopically inserted 200 bp surrounding another re-replicating origin into iYDR309C:
ARS214 (See dotted black line on Chr II in Supplementary Figure 2 for location). This
second origin also induced re-replication at iYDR309C (Supplementary Figure 5). Thus,
moving only origin-proximal DNA is sufficient to direct re-replication at a new locus.
To demonstrate that the origin was necessary for the new re-replication peak, we mutated
the ectopically-inserted ARS418 so that it was no longer functional. Our lab recently
refined an algorithm (Breier et al. 2004) to identify functional ARS Consensus Sequences
(ACS) across the S. cerevisiae genome (manuscript in preparation). Using this algorithm,
we predicted the site of the essential ACS of ARS418 and mutated this sequence. This
mutation eliminated the function of ARS418 on a plasmid (data not shown). The mutant
ARS418 was integrated at iYDR309C and the re-replication of this strain was analyzed by
microarray (Figure 3C gray histogram). Unlike the wild type ARS418, the mutant ARS418
did not induce re-replication at iYDR309C, showing that the same sequence that is
co
cl
Pr
0"L
8*0
9"0
V'0
Z'O
0"0
peoeo!ldeJun/peeoW!ldeJ-eJ 6ol
0
C
coo
cc
rc
0"1
Z'O
pelo!IdaeJun/paelo!ldeJ-eJ 6ol
8"0
9"0
tl'O
8"0
9"0
"7Q
0"0
0
o
Nm
cmp
C
,)
0"L
pae.o!ldaejun/pe.o!Ildoi-ea
'O
bol
0"0
Figure 3. An origin sequence directs re-initiation (A) The re-replication profile
surrounding iYDR309C, a segment that does not re-replicate, in the absence of an ectopic
origin is depicted as both the gray histogram and the black dashed line. (B) ARS418, an
origin that is associated with a peak on the re-replication profile, directs re-replication at
an ectopic locus. The 600 bp intergenic region containing ARS418 was moved to
iYDR309C. Re-replication was induced and the resulting DNA was hybridized to a lowdensity DNA microarray (gray histogram, Chr IV 800 kb- 1400 kb). Superimposed on
top is the re-replication profile from the strain without the ectopic ARS418 (black dashed
line). (C) An origin with a mutant ACS is not capable of directing re-replication. The
essential ACS of ARS418 was mutated and integrated into the re-replicating strain. Rereplication was induced and the resulting DNA hybridized on to a low-density array (gray
histogram, Chr IV 800 kb - 1400 kb). The re-replication profile of the strain without the
ectopic mutant ARS418 is superimposed on top (black-dashed line).
required for origin function in a plasmid context during normal S phase is also required
to direct re-replication. This observation is consistent with previously published data
concerning ARS305 (Nguyen et al. 2001).
Timing of initiationduring S-phase does not correlate with the ability to re-replicate
Having demonstrated that sites of re-initiation correspond to a subset of potential
origins, we asked if sites of re-initiation represented a particular class of origins. We
compared origins that re-initiate to the time of initiation of those same origins during S
phase. We used a previously described protocol (Yabuki et al. 2002) to identify origins
that initiated in the presence of hydroxyurea (HU). HU allows early origins to initiate but
inhibits activation from later-initiating origins of replication (Santocanale and Diffley
1998; Shirahige et al. 1998).
Comparing the profile generated in the presence of HU with the re-replication
profile showed that some of the re-initiating origins are early, but not all. Similarly, there
are early origins that do not re-replicate. Using a window of 7.5 kb and computationallybased analysis, 48% of re-replication peaks are associated with HU-initiating origins
(Table 1). Conversely, 52% of HU-initiating origins re-replicate. These data suggest that
there is not a strong correlation between origins that re-replicate and when that origin
initiates during S phase. Thus, the factors that determine timing of initiation in S phase
are not the same as the factors that sensitize origins to re-replication during G2/M.
The telomeres and centromeres of the S. cerevisiae genome are specialized
regions of the genome that replicate at specific times during S-phase (telomeres replicate
late whereas centromeres replicate early), so we also analyzed the ability of these regions
to re-replicate. The sub-telomeric chromosomal regions appeared over-represented in the
re-replicated fraction of the DNA. To examine this feature further, we plotted the relative
level of re-replication for each point on the array as a function of its distance from the
telomere (Figure 4A, black plot). For comparison, we plotted the relative level of rereplication for a wild-type strain under re-replicating conditions (Figure 4A, gray plot).
The resulting plot showed a positive correlation between the proximity of a sequence to
the telomere and its extent of re-replication. We also plotted each point on the array as a
Figure 4.
A
Cz
CL
oC
a)
a)
a,
0
50
100
150
200
250
300
250
300
Distance From Telomere (kb)
0)
0B
V
.-o
0)
a)
a)
a)
L.,
0)
0
50
100
150
200
Distance From Centromere (kb)
Figure 4. Sub-telomeric regions have a high probability of re-replicating (A) There is a
positive correlation between the proximity of a sequence to the telomere and its
probability of re-replicating. The relative enrichment for each spot on the microarray was
plotted as a function of its distance to the closest telomere for both the re-replicating
strain (black) and wild-type strain (gray) three hours after addition of galactose. (B)
There is no correlation between re-replication and proximity to centromeres. The relative
enrichment for each spot on the microarray was plotted as a function of its distance to the
centromere for both the re-replicating strain (black) and wild-type strain (gray) three
hours after addition of galactose
function of its distance from the centromere (Figure 4B, black plot) and found that there
was no correlation between distance from the centromere and sensitivity to re-replication.
Originscan re-initiatemultiple times
FACS analysis three hours after induction of re-replication shows that most cells
in the population have -3C DNA content, however, some cells appear to have DNA
content greater than 4C (Figure 1B). The existence of cells with >4C DNA content
suggests that at least a subset of origins is capable of multiple rounds of re-initiation. To
determine if origins can re-initiate more than once, we used a density transfer approach to
monitor the extent of re-replication at particular regions.
Cells were labeled with dense isotopes as outlined in Figure 5A. As illustrated, at
the nocodazole arrest, cells will have passed through S phase and therefore have one
heavy and one light DNA strand. Induction of re-replication in the nocodazole-arrested
cells will result in a third species of DNA composed of entirely light DNA strands. If a
segment of DNA re-replicates exactly once then the ratio of Light-Light (LL) DNA to
Heavy-Light (HL) DNA will be 1:1. If a segment has re-replicated more than once, the
ratio will increase.
We examined several sites that represented different features of the re-replication
profile to determine their extent of re-replication. We tested two origins that were
prominent sites of re-initiation (ARS418 and ARS428; see Figure 2B), two origins that did
not seem to be efficient sites of re-initiation (ARS1 and ARS1413; see Figure 2B and
Supplemental Figure 2), and one sequence that was not substantially re-replicated,
iYDR309C (Figure 2B). Consistent with their prominence in the re-replication profiles,
both ARS418 and ARS428 have at least twice as much LL DNA as HL DNA (Figure 5B
closed triangles and open squares). Consistent with the re-replication profile, these data
definitively demonstrate that some origins are capable of re-initiating multiple times.
iYDR309C, however, showed no LL DNA indicating that other regions of the genome do
not re-replicate at all. Together, these data strongly support the model that re-replication
is limited across the genome but that origins that re-initiate can do so more than once.
Figure 5.
release into
heavy medium
(C13,N
15
light medium (C 12,N14)
+ a-Factor
)
release into
nocodazole
add galactose to
induce re-replication
0000000
HL
never re-replicates
re-replicates once
re-replicates more than once
o
A
ARS418
o
ARS428
*
ARS1
LL
o ARS1413
*
LO
0
/
iYDR309C
\
,A
_
\ Ao[
\
LO
0
o
C
·
Fraction Number
Figure 5. Origins are capable of re-initiating multiple times (A) Diagram of density
transfer experiment. A cartoon depicts what products will look like during the experiment
with "heavy" DNA strands shown in black and 'light' DNA strands shown in gray. The
table briefly describes possible results. (B) ARS428 and ARS418 re-initiate multiple
times. DNA from cells that underwent density transfer protocol described in A was
fractionated by CsCl gradient. The resulting fractions were probed for three different
classes of DNA sequences as determined by DNA microarray: two origins of re-initiation
(ARS418 closed triangles, ARS428 open squares), two origins that are re-replicated, but
are not sites of re-initiation (ARS1 filled squares, ARS1413 open circles) and an intergenic
sequence that does not re-replicate (iYDR309C filled circles). The data were normalized
by setting the peak of the HL density to a copy number of one.
Pre-RCformation is not the only determinant of the ability to re-replicate
We have shown that not all sites of GI pre-RC formation re-initiate. Since
previous data strongly suggest that Mcm2-7 loading onto origin DNA is required for reinitiation (Nguyen et al. 2001), there are two possible explanations for only a subset of
these Gl pre-RC sites undergoing re-replication. First, it is possible that Mcm2-7 is only
recruited to those origins that re-initiate. Alternatively, similar to the pre-RCs assembled
in G1, Mcm2-7 could load at all potential origins, but only a subset is competent to reinitiate. To distinguish between these hypotheses, we asked where pre-RCs were formed
during re-replication using Mcm2-7 genome-wide location analysis. To avoid confusing
sites of pre-RC formation with fork movement, samples were taken 45 minutes after
induction when re-replication is limited as determined by FACS (Figure IB) and array
analysis (data not shown).
We first asked if Mcm2-7 binds to the same sites during re-replication as seen
during G1. Since both genome-wide location analysis data sets have narrow peaks
(compared to the re-replication profile), we could use a much smaller window when
comparing G1 and re-replication Mcm2-7 binding sites. Using a 1 kb window, 92% of
the re-replication Mcm2-7 binding sites overlap with Gl Mcm2-7 binding sites (Table 1).
In contrast, only 45% of Gl Mcm2-7 binding sites overlap with re-replication Mcm2-7
binding sites (Figure 6A, Table 1 and Supplementary Figure 3), demonstrating that only a
subset of sites that assemble pre-RCs in Gl also do so in re-replicating cells.
We were concerned that Mcm2-7 associated with a subset of origins during rereplication because in the re-replication-sensitive strain, which has several ORC
mutations, ORC only associated with the same subset of origins. To determine the
location of ORC binding during re-replication, we performed ORC genome-wide location
analysis as described above (Figure 6A and Supplemental Figure 3). We found that the
majority of G1 Mcm2-7 binding sites overlap with sites of re-replication ORC binding
sites (Table 1), suggesting that ORC containing two non-phosphorylatable subunits can
bind to most potential origins. Therefore, ORC binding does not limit Mcm2-7 loading.
Similar to Gl Mcm2-7 binding sites, only 52% of re-replication ORC binding sites are
Figure 6.
A
G1 Mcm2-7
Re-replication ORC
* Re-replication Mcm2-7
I
I
I
I
I
I
I
200
400
600
800
1000
1200
1400
Chr. IVPosition (kb)
70
Q)
O
C)I
•0
4-0
'0c
._o
-C\1
.E-.
O0
oOCr
O
-
\1
Co
LII
0)
200
400
600
o
U
---
I
800
I
1000
Chr. IVPosition (kb)
LMoI
0C
--
I
1200
0
1400
n
L
Figure 6. Recruitment of Mcm2-7 is not sufficient for re-initiation (A) Mcm2-7 binds
only a fraction of possible origins during re-replication. Genome-wide location analysis
of Mcm2-7 and ORC was performed 45 minutes after induction of re-replication. The
binding sites of Mcm2-7 during re-replication (black circles) were compared to binding
sites of ORC during re-replication (dark gray circles) and binding sites of Mcm2-7 during
G1 (light gray circles). Plotted are only the points on the array that satisfied the
significance cut-off (see Materials and Methods) for each of the data sets. (B) Mcm2-7
binds to origins that do not re-initiate. The binding sites of Mcm2-7 (black histogram) are
overlaid on top of the re-replication profile for Chromosome IV (gray histogram). Each
peak of re-replication is associated with an Mcm2-7 binding site, but the converse is not
true.
associated with a re-replication Mcm2-7 binding site. Thus the reduction in pre-RC
formation during re-replication is not due to a reduced number of ORC binding sites.
We then determined how many sites of re-initiation overlap with re-replication
Mcm2-7 binding sites. We used the same approach to compare these two data sets as
when we compared the re-replication profile to G1 Mcm2-7 binding sites. We found that
71% of the re-replication profile peaks overlapped with a re-replication Mcm2-7 peak
within a 7.5kb window (Table 1). Taking into account the peaks that were not identified
by the peak-finding algorithm (Supplemental Figure 4), the percentage increased to 80%.
These comparisons show that Mcm2-7 is found at most sites of re-initiation supporting
the model that Mcm2-7 is required at origins that re-initiate.
We then asked what percentage of re-replication Mcm2-7 binding sites
overlapped with sites of re-replication. 51% of re-replication Mcm2-7 binding sites
overlapped with re-replication peaks (Table 1) suggesting that only a subset of sites that
exhibit Mcm2-7 association during induced re-replication go on to re-initiate (Figure 6B
and Supplemental Figure 3). We also measured the inter-origin distance between sites of
re-replication as well as the distance between pre-RC binding during re-replication
(Supplemental Figure 5). The median distance between origins that initiate during rereplication is 84 kb, but the median distance between Mcm2-7 binding sites during rereplication is only 57 kb. Thus, there are substantially more Mcm2-7 binding sites during
induced re-replication than there are re-replication initiation sites.
These data support the first hypothesis presented above, which stated that reinitiation was limited to sites that load Mcm2-7 during re-replication. We found,
however, that loading of Mcm2-7 was not sufficient to induce re-initiation as there were
many origins throughout the genome that loaded Mcm2-7 but did not re-replicate (Figure
6B). With respect to the ability to re-replicate, sites of GI pre-RC formation can be
grouped into three classes: those that do not form pre-RCs during re-replication, those
that form pre-RC's but do not re-initiate and those that form pre-RCs and re-initiate. The
recruitment of' Mcm2-7, therefore, is not the only obstacle to re-replication and there
must be other levels of control that act after pre-RC formation to prevent re-initiation.
Discussion
Prevention of re-replication during a single cell cycle is critical for cell survival.
Without such control, cells undergo gross chromosomal damage (Green and Li 2005) and
eventually death (Nguyen et al. 2001). Here, we have monitored the increase in DNA
copy number and pre-RC formation during re-replication of the S. cerevisiae genome. We
found that re-replication initiates from specific sites in the genome and that these sites are
coincident with origins of replication. Our findings allow us to catergorize origins with
respect to their propensity to re-initiate and demonstrate that pre-RC formation is not the
only target for mechanisms that prevent genomic re-replication.
In the course of these studies, we determined that at least 123 sites in the genome
are capable of re-initiation. Concurrently with this study, Green et al. followed up
previous publications and also determined sites in the genome that are capable of reinitiating using a strain that has one less mutation and is a different genetic background
(Green et al. 2006). A comparison between the results from each group show that 53% of
our re-initiating sites (65 total) overlap with a re-initiating site in the Green et al. data set
within 10 kb. The differences between the strains used might affect how the genome rereplicates, therefore we would not expect a complete overlap of sites of re-initiation.
However, we expect that the more sensitive re-initiation sites would be more likely to
overlap. Of the 30 most-efficient re-initiation sites (determined by the height of the reinitiation peak) in our data set, 77% overlap with a peak in the Green et al. data set within
10 kb. This is more than a 25% increase over the entire data set, suggesting that there is a
significant proportion of sites that re-initiate despite strain background, mutations,
methodology and analysis.
Limited replicationfork processivityprevents complete genome re-replication
The extent of re-replication varies widely over the genome, including substantial
regions that show little or no re-replication. The differences in the amount of rereplication are likely to be due to a combination of asynchronous re-replication,
inefficient re-replication, low replication fork processivity (see below) and the ability of
some sequences to re-initiate more than once. The height of the peaks reflects two
features of a re-replicating origin: (1) the percentage of cells in which these origin reinitiated, and (2) the number of rounds of re-initiation the associated origin(s) underwent
(see Figure 5).
The lack of full-genome re-replication suggests that the replication forks derived
from flanking origins stop before replicating the intervening DNA. These data are
consistent with previously reported 2D-gel data (Nguyen et al. 2001) suggesting that
replication forks have trouble reaching a site 30-35 kb from an origin. The inability of
forks derived from adjacent origins to fully replicate intervening regions could be due to
a reduced number of sites of initiation or from reduced processivity of forks. Although
there is a notable increase in the inter-origin distance during re-replication (84 kb as
compared to 43 kb in S phase; see Supplemental Figure 5), this change cannot fully
explain the incomplete re-replication. It is known that origins separated by 100 kb can
replicate the intervening DNA without affecting chromosome stability or cell viability
(Dershowitz and Newlon 1993). Thus, reduced fork processivity must play a role in the
incomplete nature of re-replication.
Multiple factors could contribute to reduced fork processivity during rereplication. One possibility is that fork processivity could be affected by changes in
chromatin that occur during G2/M. Alternatively, the "forks chasing forks" generated
after multiple initiation events from the same origin could contribute to reduced
processivity. Recent studies showed that the DNA damage response is elicited in S.
cerevisiaewhen re-replication is induced (Archambault et al. 2005; Green and Li 2005).
Both groups proposed that one likely source for damaged DNA was fork collapse after
two replication forks followed one another too closely. This idea is supported by data
mapping replication from the chorion amplicon in D. melanogaster, which suggested that
multiple initiation events impeded fork movement (Claycomb et al. 2002). Consistent
with the latter model, our density transfer experiments show that multiple rounds of reinitiation occur at a subset of origins (Figure 5).
What determines origin sensitivity to re-initiation?
Our studies clearly show that the sequences within a few hundred base pairs of an
origin are sufficient to direct re-initiation. This is in contrast to the sequence determinants
that control replication timing (Friedman et al. 1996), which include large regions of
DNA (>10 kb) surrounding the origin. Consistent with this difference in sequence
determinants, we did not observe a correlation between an origin's ability to re-replicate
and its time of replication.
Although origin-proximal sequences are sufficient to direct ectopic re-replication,
the site of insertion may influence the extent of the resulting re-replication. For example,
we see that the efficiency of re-replication directed by ARS418 is reduced at the ectopic
locus. This difference suggests that the surrounding chromatin structure influences the
efficiency of re-replication. We noted that a nearby site showed increased re-replication
after ARS418 insertion (Figure 3B). We do not know if this increase is due to passive rereplication by replication forks derived from the ectopic origin or if the ectopic origin can
stimulate re-initiation at this neighboring site.
One case in which there may be a more global influence on the sensitivity to rereplication is at the telomere. We found that proximity to telomeres was associated with
an increased likelihood of re-replication. One possible reason for this particular
sensitivity to re-replication is the high density of pre-RC formation at telomeres
(Supplemenary Figure 2) (Wyrick et al. 2001).
Formationofa pre-RC is not sufficient to induce re-replicationduring G2
Only a subset of the sites that assemble pre-RCs during the induction of rereplication go on to initiate. It is possible that the origins that load pre-RCs but do not reinitiate are simply S-phase inactive origins. Unlike many inactive origins in S-phase,
however, in numerous instances these sites of pre-RC formation are never re-replicated
and therefore are not inactivated by passive replication. Additionally, several of these
non-re-initiating sites that assemble pre-RCs overlap with active S-phase origins (e.g.
ChrV at 406996 bp and ChrXI at 257488 bp) (MacAlpine and Bell 2005). Thus far, the
described mechanisms in every organism that prevent re-replication target pre-RC
formation (Blow and Dutta 2005; Machida et al. 2005). Our results indicate the existence
of additional mechanisms in S. cerevisiae that prevent pre-RC formation as well as
mechanisms that prevent licensed origins from being activated.
The presence of many ORC binding sites during re-replication that are not
associated with Mcm2-7 suggests that even in the re-replication-sensitive strain there are
still intact controls preventing pre-RC formation. There are several possible targets for
this residual regulation. For example, only two of the three ORC subunits that have CDK
phosphorylation sites are mutated to be non-phosphorylatable in the re-replicationsensitive strain. It is possible that CDK-dependent phosphorylation of the third
phosphorylated ORC subunit, Orc 1, can prevent pre-RC formation at some potential
origins. Pre-RC formation also requires the presence of Cdtl (Maiorano et al. 2000). In
S. cerevisiaea role for Cdtl in preventing re-replication has not been identified, although
it has been shown to be important in other organisms (Blow and Dutta 2005). If Cdtl is
limiting during re-replication this could prevent efficient Mcm2-7 loading onto origins.
Although residual mechanisms preventing pre-RCs from forming likely exist,
they do not explain why Mcm2-7 can load more efficiently at some origins rather than
others. One possibility is that pre-RC components, other than ORC, are excluded from
associating with certain origins due to a change in chromatin structure. As cells proceed
towards mitosis, the chromatin undergoes structural changes due to cohesion,
condensation and changes in the transcriptional program. The affect of these changes
may alter the local chromatin structure surrounding certain origins, making them
inaccessible to pre-RC formation.
The numerous sites of pre-RCs formation that do not re-initiate indicate that there
are levels of re-replication control that prevent pre-RC activation rather than pre-RC
formation. One such control could be the alterations in chromatin structure as discussed
above. Although local changes may not hinder pre-RC association, it may exclude
association of downstream replication factors (Mendez and Stillman 2003). Alternatively,
factors required for pre-RC activation may be limiting during G2/M. Finally, recent
reports (Archambault et al. 2005; Green and Li 2005) have shown that the DNA damage
response is activated, including the Rad53 kinase, in S. cerevisiae during re-replication.
Because activated Rad53 has been shown to suppress origin activation in some
circumstances, it is possible that the activation of Rad53 during the DNA damage
response suppresses re-initiation from some origins. Future experiments will be necessary
to address whether these or other, as of yet unknown mechanisms, provide further
safeguards against activation of initiation to prevent re-replication during the same cell
cycle.
Experimental Procedures
Plasmids
To integrate ARS418 at iYDR309c, plasmid pLys2-418-309CB was generated by
first amplifying the intergenic region containing ARS418 using primers SB2558 and
SB2559 (see Table 2 for primer sequence) and putting the resulting DNA into the PstI
and XbalI sites of pUC1 19-Lys2 to create pLys2-418. The intergenic region between
YDR309C and YDR310C was then amplified using primers SB2664 and SB2665 and
inserted into the SphI site in pLys2-418. To integrate the mutant ARS418 at iYDR309C,
plasmid pLys2-418mut-309CB was generated by QuikChange XL (Stratagene)
mutagenesis, using primers SB2753 and SB2754. The mutant ARS418 was then amplified
using primers SB2 and SB2273 and inserted into the PstI/SacI sites of pLys2-418-309CB.
ARS214 was amplified from the genome using primer setACS_2_408 and inserted into
the EcoRI/HinDIII sites of pARS 1, replacing ARS]. The origin was then amplified using
primers SB3182 and SB3183 and inserted into the PstI/SacI sites of pLys2-418-309CB,
replacing ARS418.
Strains
All strains in this study are previously described except SB 1808, SB 1809,
SB2023,SB2052 and SB2125 (See Table 3 for genotypes). For density transfer, strains
SB1808 and SB1809 were made ADE2 by transforming SB1507 or W303BLa with
plasmid pASZ10 (Stotz and Linder 1990) that had been linearized by BglII. To integrate
ARS418 into the iYDR09c locus, strain SB 1507 was transformed with BsmI-linearized
pLys2-418-309CB (SB2023) or pLys2-mut418-309CB (SB2052). To integrate ARS214
into the iYDR309C locus, strain SB 1507 was transformed with Mlul-linearized pLys2214-309C to create SB2125.
Re-replication microarrayassays
Exponentially-growing cells (OD 600 of 0.4) were washed with sterile water and
transferred into YP-raffinose + 15ug/mL nocodazole. Once arrested, 2% galactose was
added to induce cdc6A2-49 expression. After 3hrs, cells were collected and genomic
DNA was isolated by bead beating. Briefly, whole cells were mixed with 200 [LL of
buffer (10 mM Tris pH 7.5, 1% SDS, 100 mM NaC1, 1 mM EDTA, 2% Triton X 100),
300 [tL of glass beads, and 200 [tL of phenol:chloroform:isoamyl-alcohol (25:24:1, GE
Healthcare) and vortexed for 4 min. The DNA in the aqueous phase was precipitated and
resuspended in 200 [tL of TE. RNA was removed with RNAse (3 gpg) treatment for 3 hr
370 C. The DNA was then sheared to approximately 1 kb (Branson Sonicator 250),
phenol:chloroform extracted, and EtOH precipitated.
10 RLg of DNA from re-replicating cells and Gl-arrested wild type cells were
differentially labeled with 2 nmol of either Cy3-dUTP or Cy5-dUTP (Amersham
Biosciences, GE Healthcare) using 4 [tg random nonamer oligo (IDT) and 0.25 X of highconcentration Klenow (NEB). Un-incorporated dye was removed using a microcon
column (MW cutoff 30000, Millipore) by washing the sample three times with TE. The
labeled DNAs were then co-hybridized onto either 11K or custom-made (Pokholok et al.
2005) 44K DNA microarrays from Agilent Technologies using Agilent Technologies'
standard protocol for cDNA hybridization and washing. For each set of triplicate
experiment, one of the replicates was labeled as a dye swap.
HU-arrestedreplicationprofiles
W303 cells were arrested in 200mM HU for 90 min and then collected. Genomic
DNA was then isolated, labeled and hybridized to high-density DNA miroarrays as
described above. DNA from G -arrested cells was used as a reference population.
Density Transfer
Cells (SB1808) were grown for at least 7 generations in N15- and C13-containing
medium to an OD 600 0.25. Alpha-factor was added and cells were grown until the
population was z 95% unbudded. Cells were then washed and resuspended in YP (N 14
C12) + 2% raffinose + alpha-factor. After 1 hr, cells were washed twice with water and
released in to YP (N14 C 12) +2% raffinose + 0.1mg/ml pronase + 15 Rig/ml nocodazole.
When the population was a 95% large-budded, galactose was added to 2% to induce rereplication. After 3hrs, 30 mL samples were collected.
DNA was isolated as described above and digested O/N with EcoRI at 370 C. The
digested DNA was separated on a CsCl gradient (1.255g CsCl/g TE, refractive index =
1.4041). The resulting gradient was fractionated and each fraction was slot-blotted onto a
nylon membrane (GeneScreen Plus). The membrane was then probed using the indicated
radio-labeled origin fragments (see Table 2 for primers used to generate probes).
Genome- Wide Location Analysis
Standard Chromatin Immunpreciptation assay was performed as previously
described (Aparicio et al. 1997) at specific time points using a polyclonal antibody
against Mcm2-7, UM185, (1:250 dilution) or ORC (1:250 dilution). The resulting IP
DNA and 1/10th of the input DNA were differentially labeled as described above and cohybridized to custom-made 44K DNA microarrays from Agilent Technologies.
Data Analysis
Cy3 and Cy5 levels were quantitated using Agilent's Feature Extraction software.
The resulting log ratios of experimental DNA/reference DNA for each spot on the array
were then determined using the sma package [45] for R (v2.1.0, http://www.rproject.org), which is a computer language and environment for statistical computing. We
also performed scale normalization across the slides for each set of triplicate experiments
so each experiment had the same median absolute deviation.
For all replication profiles (HU and re-replication), the average log ratio of
enrichment for each spot on the array was calculated for three independent experiments.
The resulting average was used for all subsequent analysis. The averaged data were
smoothed using the loess function in R to predict the average log ratio of experimental
DNA/reference DNA every 50bp.
Sites of absolute re-replication were defined as any spot having a log ratio
replicated/unreplicated value above the bottom quarter percentile. The bottom quarter
percentile represents the mid-point of the normal distribution of the re-replication data
(Supplemental Figure 9a) and was used as a cut-off across the entire genome rather than
determining the lowest site on each individual chromosome (Supplemental Figure 9b).
The value of the log ratio replicated/unreplicated that defined the threshold of the bottom
quarter percentile was then added to the log ratio replicated/unreplicated ratio for all
spots on the array. All spots with a final value over zero were considered to represent rereplicated regions.
Genome-wide location analysis for mitotic Mcm2-7 was performed in
quadruplicate and for re-replication Mcm2-7 was performed in triplicate. Data from the
individual experiments were treated with the loess function to predict the log ratio IP/IN
every 50bp.
Peaks on the smoothed and/or predicted data sets were determined using the
tumpoints function in the pastecs package (v 1.2-1) in R. True peaks in the genome-wide
location analysis data sets were defined by three independent criteria: a confidence value
>80 given by the tumpoints function, the log ratio IP/IN value at the peak p<0.001, and
that there was another point within 2 kb whose log ratio IP/IN had p<0.05. The last
criterion was to prevent identification of false peaks that arose due to gaps in the array
data. True peaks in the replication data sets were defined as peaks that had the highest
confidence values (infinite) and had a log ratio replicated/unreplicated value at the peak
that was greater than 0. True peaks in the HU data set were defined as peaks that had the
highest confidence value and had a log ratio replicated/unreplicated the peak with
p<0.001.
Comparison of peaks between data sets was done by scanning each of the
data sets at all true peaks on a chromosome and determining if a true peak in another data
set was within 7.5kb. Averaged and raw data sets are available on-line in the NCBI Gene
Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/ accession no. GSE4487).
Supplementary Figures and Tables
Supplementary Figure 1.
200
400
600
800
1000
Chr. IV Position (kb)
1200
1400
Supplemental Figure 1. Multiple mutations are required to induce significant rereplication. Re-replication was induced in the re-replication-sensitive strain (SB 1507,
gray plot), a strain similar to the re-replication-sensitive strain except Orc2 and Orc6 are
wild type (SB 1347, red plot) that does not show re-replication by FACS analysis (Wilmes
et al. 2004) and the wild type strain (blue plot) for three hours. The genomic DNA from
triplicate experiments for each strain was hybridized to low-density Agilent Technologies
DNA microarrays. Chr IV is plotted here as an example. While we do not see significant
re-replication from SB1347 on the majority of chromosomes, we do see re-replication at
the right end of Chr III in accordance with data from the Li lab.
CQ
8o
o•j
c
,,
pedeun/peoiL-eJ
oI
p9je:)!jd~jun/peqeoljdaj-9 6ol
-
i--
pelEo!ldeJun/peeo!lieJ-eJ 60Ol
LI=
peaeo!ldeJun/pe3,•!ldej-eJ Boi
D')
peeo!ldejun/pe9,e!ldej-ej
I
c
pa1eo!JdaJun/pe!O!dej-ej 60Ol
d)
peeo!deJun/peajo!idej-eJ Bo
C,)
B0o
r~B
4
0
peltjuo!dejun/p.eo!idej -ej BOl
pelaoiIdeJun/pce.O!Ide-9jl
bol
C)
1..)
0,
.>,
6Ol
p9e.o!ideJun/peaeo!udeJ-ej
pa•uo!jdejun/p,1eo!ideJ-eJ6ol
C)
E
pa9Eo!IdeJun/peq.u!idej-eJ 6Ol
--
pel3!IdeJun/pjeoa3ldeJ-ei 6oi
C,)
pe1,o!jdejun/pele3o!jdeJ-eJ 6o
pe,4e!Idejun/pteo!idej-eJ 6o01
pe41o!jdeJun/peaeo!idej-ej 6oi
Cc
E
a)
Supplemental Figure 2. Re-replication profile for all 16 Chromosomes.
~ir··
·
·
·
·
·
·
·
·
I··
·
·
·
·
·
·
·
8
8N
· ··
·
.
I····
·
rl·
·
(I
·
·
·
r
.
0.
·
·
·
·
·
·
·
·
·
·
re
·
·
·
ttt·.
·
·
r·r
·
·
·
·
·
·
-81
*B.
I
.C)
0a
·
·
·
·
:
rlLL·
· ·
·
·
·
·
·
·
·
·
·
(· ·
·
·
·
r··
·
·
·
·
·
·
·
·
·
·
·
·
·
·
*
*
*
*
*
*
*
.··
S
.·
·
L.
cn
S
i
.
····· ·· ·
.
8
CY
CL
-CD
.o
U)
~···
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
-0
*
0
••
•
•.
.0
o
•
•
•
•
•
•
•
•
•
•
•
•
(~··
U)
S
.
C)
-0
0.
•
0
L)
·~·
Q)
I
6
r·r
·
·
:
•
r
-.
·
·
·
·
·
.t
·
·
·
SS
0
·
·
·
·
r·i··
·
t
·
tt·;.·
·
·
80
·
·
·
·
·
·
·
·
·
*·'
·
·
·
3:.,
see
:8:..
***
ooe
8e***
Si.
Ooo***
o
o
•
*oo··e
S..·
****o*
0·
3.
.3.
S..
S1
·
*...
!oo
*
*
S**
ooo
o
o
*
*
o
3.
.3.·
8e°6o
ooo
e
$o·
· ·--
'a..
o
e·o·o
0ooeo.
....................
cL
·
·
·
·
·
·
r
·
·
r
·
·
·
·
·
·
·
·
·
·
·
·
1o
I"
·
~·r··
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
I··
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
·
8
·
·
r
·
I'···
.9
a.
·
o
•
·
·
r
I····
(1)
·
·
·
or
·
E
r
·
·
·
·
·
a)
.3....
oooe·
go·
I
Q)
1
,oo·
e
·
8
.
,
··
r
*
·
·
·
·
·
·
·
·
·
)··
·
·
r
·
·
·
·
·
·
·
·
·
r ·
·
·
·
·
a
·
·
·
·
·
·
·
S.
*
(i··
3
·
·
·
·
·
·
·
·
·
·
·
·
·
·
· ·
·
·
·
S!:.
Q)
E
U)
o•
·
·
·
·
·
·
·
·
·
lag
•
•
•• ·
r•
·•
·;
·;
Cu
.
.
·
I··
L.
.2:,·
·
·
·
·
·
·
·
S
2..*
I·
·
·
·
6
I
•
•
·
Supplemental Figure 3. Summary of genome-wide data sets for all chromosomes. The
position of pro-ARSs (Wyrick et al. 2001) and the peaks for each data set as determined
by the peak-finding algorithm are represented as circles along the chromosome for
comparison. pro-Ars - green. poG1 Mcm2-7 binding sites - navy. Re-replication ORC blue. Re-replication Mcm2-7 - cyan. Re-replication profile - magenta. HU profile violet.
C)
in
C
"C
Re-replication Profile
log re-replicated/unreplicated
0.0
0.2
0.4
0.6
0.8
1.0
3
(D
0
(D
mph
mr
1
2
3
4
5
Mcm2-7 ChIP
log IP/Input
Re-replication Profile
log re-replicated/unreplicated
0.0
I
0.2
0.4
0.6
0.8
2
3
4
Mcm2-7 ChIP
log IP/Input
1.0
Supplemental Figure 4. Peak-finding algorithms did not identify all sites of re-initiation.
(A) Shoulders on the profile are not considered true peaks by the peak-finding algorithm.
A 200 kb segment of Chromosome XVI (gray histogram) is magnified to show an
example of a shoulder on the profile (red triangle). In previous reports (Raghuraman et al.
2001), shoulders have been attributed to either changes in the rate of fork movement or
inefficient origins. The slope of the shoulder and the association with an Mcm2-7 binding
site (black histogram) suggests that shoulders on the re-replication profile are re-initiating
origins that are not as active as neighboring origins. The green line denotes a peak as
determined by the peak-finding algorithm. (B) Some re-replicated telomeres are not
identified as peaks by the peak-finding algorithm. The right-most 200 kb of Chromosome
XVI (gray histogram) is magnified to show an example of a telomere that is re-replicated
(red triangle) but is not identified as a peak. Telomeres are often not identified as peaks
because the very end of a chromosome will lack the adjacent data points to create the
two-sided peak required for detection by the algorithm. The green line denotes a peak as
determined by the peak-finding algorithm.
Supplementary Figure 5.
ARS214
integration
800
1000
1200
Chr. IVPosition (Kb)
Supplemental Figure 5. ARS214 also directs re-replication at iYDR309C. ARS214, an
origin that is associated with a peak on the re-replication profile of Chromosome II,
directs re-replication at an ectopic locus. The 200 bp intergenic region containing
ARS214 was moved to iYDR309C. Re-replication was induced and the resulting DNA
was hybridized to a low-density DNA microarray (gray histogram, Chr IV 800 kb- 1400
kb). Superimposed on top is the re-replication profile from the strain without the ectopic
ARS214 (black dashed line).
0
0m,
-
.,
C
-(o
C
So
r-
o
-C) --0
(- OC
.5
0)
_0
L
9
OL
Aouenbeij
I
I
I
OZ
OL
0
Aouenbeij
00
C")
-
o
0
C-)
CD
o
-
0 '.-a0u)
-0
o
-0
01
01
CQ
Ew
0)
0.
0.
:3
o
-LO
I
I
09
0i
I
o
I
I
03
OL
Aouenbae4
-
0
I
0
CO
Ou
I
On
Aouenb .li
I
0
0
Supplemental Figure 6. Distribution of sites of initiation or Mcm2-7 binding sites
during mitotic replication and re-replication. (A) Histogram depicting the distance
between active S-phase origins. (B) Histogram depicting the distance between origins
that re-initiate. (C) Histogram depicting the distance between G1 Mcm2-7 binding sites.
(D) Histogram depicting distance between re-replication Mcm2-7 binding sites.sup fig
101
O
O
O
O
O
O
O
O
O
o
0
O
O
0
0a
0
o
t-
90-
0,0
T0
O'L
pe3o!Idejun/pee,3!IdeJ-ei 6oi
C
0)
E
-c
um
I,0c
C'J
o
d
Lu
(0)
a)
m
0 6
0
.n0
E
CD
0.
00008
00090
00002
0009L
AouenbeJl
OOOL
0009
,,,
Supplemental Figure 7. Determining a significance cut-off for re-replication profiles.
(A) A histogram of the log ratio Cy3/Cy5 values for the entire re-replication data set. The
red line demarcates the bottom quartile cut-off. (B) The array data for each of the
chromosomes is plotted along with the significance cut-off (red-line) to denote how much
data is excluded from each chromosome using this cut-off.
103
I
Primer Name Descriptive Name
Primer Sequence
I
SB2558
ARS418-PstI-5'
GCGCTGCAGGGATTTTTCTTAGCATTTGCA
SB2559
ARS418-XbaI-3'
GGGTCTAGAGGTGCTTCTTTGAAGCCAGA
SB2664
YDR309C-SphI-5'
CCGCATGCGGTCTCGTTTTACTGGAGTTTTACA
SB2665
YDR309C-SphI-3'
CCGCATGCTACACGAGAAAAGAAACATGATTGA
SB2753
418ACSmut-5'
CTGCATTGAAAGCTCGAGTTTTTTCACTGGAGG
SB2754
ARS418mut-3'
TAGAGCCGCAGAAGAAAGGA
SB3125
ARS418-Sacl#2
GGGGAGCTCGCCGCTCTAGAAACTAAGATTAATAT
SB2238
ARS418hl-5'
AGTCTTAGAACGGGTAATCTTCCAC
SB2239
ARS418hl-3'
AGGCTGAGTAGAGAAAAAGACACAA
SB2240
ARS428hl-5'
AACCTACTTAGTCAGCGAAGATCAA
SB2241
ARS428hl-3'
CCATGTCTATCTTGAACTCTTTCGT
SB2460
iYDR309C-HL-5'
ATGATGTCATGAAGAATCAAGTAAA
SB2461
iYDR309C-HL-3'
TCCACGTTATTATGAACAGTATCAG
SB2010
ARS1-HL-5'
CCTACATGGCCATAGATCCG
SB211
ARSlhl-3'
AAGGTGGATAGTGCAACCGC
SB669
IEL1413A-5'
TAGAGTTTTGCGTCCACCTTG
SB670
IEL1413A-3'
GAGAAAAGTCTTCTTGGAGAATACGTAGG
SB3182
pARS 1-PstI
GCCCTGCAGTGTGGAATTGTGAGCGGATA
SB3183
pARS 1-SacI
GGGGAGCTCGTTTTCCCAGTCACGACGTT
Supplemental Table 1. Primers used in this study
104
Genotype
Strain
W303BLa
ade2-1 ura3-1 his3-11,15 trpl-1 leu2-3,112 canl-100 lys2::hisG barl::hisGMATa
SB1507
orc6::HISMX6::LEU2::ORC6-ps,rxlORC2-ps MCM7-NLS URA3::GAL-CDC6A248-HA lys2::hisG barl::hisGMA a
SB1347
orc6::HISMX6::LEU2::ORC6-wtMCM7-NLS URA3::GAL-CDC6A2-48-HA
lys2::hisGbarl::hisGMA a
SB1808
orc6::HISMX6::LEU2::ORC6-ps,rxl ORC2-ps MCM7-NLS URA3::GAL-CDC6A248-HA lys2::hisG barl::hisGMATa ADE2
SB 1809
W303Bla ADE2
SB2023
orc6::HISMX6::LEU2::ORC6-ps,rxlORC2-ps MCM7-NLS URA3::GAL-CDC6A248-HA lys2::hisGbarl::hisGMA a iYDR309C::LYS2: :ARS418
SB2052
orc6::HISMX6::LEU2::ORC6-ps,rxlORC2-ps MCM7-NLS URA3::GAL-CDC6A248-HA lys2::hisGbarl::hisGMA a iYDR309C::LYS2::ARS418mut
SB2125
orc6::HISMX6::LEU2::ORC6-ps,rxlORC2-ps MCM7-NLS URA3::GAL-CDC6A248-HA lys2::hisGbarl::hisGMA a iYDR309C::LYS2:: ARS214
Supplemental Table 2. Strains used in this study
All strains except W303Bla, SB 1507 and SB1347 were made during this study.
ORC6-ps,rxl represents the allele that produces non-phosphorylatable Orc6 that can no
longer interact with Clb5. The allele has the following mutations: S106A, S116A, S123A,
T146A, R178A, L180A
ORC2-ps represents the allele that produces non-phosphorylatable Orc2. The allele has
the following mutations: S16A, T24A, T70A, T174A, S188A, S206A.
105
References
Aparicio, J.G., Viggiani, C.J., Gibson, D.G., and Aparicio, O.M. 2004. The Rpd3-Sin3
histone deacetylase regulates replication timing and enables intra-S origin control
in Drosophilamelanogaster.Mol Cell Biol 24(11): 4769-4780.
Aparicio, O.M., Weinstein, D.M., and Bell, S.P. 1997. Components and dynamics of
DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and
Cdc45p during S phase. Cell 91(1): 59-69.
Archambault, V., Ikui, A.E., Drapkin, B.J., and Cross, F.R. 2005. Disruption of
mechanisms that prevent rereplication triggers a DNA damage response. Mol Cell
Biol 25(15): 6707-6721.
Bell, S.P. and Dutta, A. 2002. DNA replication in eukaryotic cells. Annu Rev Biochem
71: 333-374.
Blow, J.J. and Dutta, A. 2005. Preventing re-replication of chromosomal DNA. Nat Rev
Mol Cell Biol 6(6): 476-486.
Breier, A.M., Chatterji, S., and Cozzarelli, N.R. 2004. Prediction of Drosophila
melanogasterreplication origins. Genome Biol 5(4): R22.
Claycomb, J.M., MacAlpine, D.M., Evans, J.G., Bell, S.P., and Orr-Weaver, T.L. 2002.
Visualization of replication initiation and elongation in Drosophila.J Cell Biol
159(2): 225-236.
Dershowitz, A. and Newlon, C.S. 1993. The effect on chromosome stability of deleting
replication origins. Mol Cell Biol 13(1): 391-398.
Diffley, J.F. 2004. Regulation of early events in chromosome replication. Curr Biol
14(18): R778-786.
Donaldson, A.D. 2005. Shaping time: chromatin structure and the DNA replication
programme. Trends Genet 21(8): 444-449.
Donaldson, A.D., Raghuraman, M.K., Friedman, K.L., Cross, F.R., Brewer, B.J., and
Fangman, W.L. 1998. CLB5-dependent activation of late replication origins in S.
cerevisiae. Mol Cell 2(2): 173-182.
Drury, L.S., Perkins, G., and Diffley, J.F. 2000. The cyclin-dependent kinase Cdc28p
regulates distinct modes of Cdc6p proteolysis during the budding yeast cell cycle.
Curr Biol 10(5): 231-240.
Elsasser, S., Chi, Y., Yang, P., and Campbell, J.L. 1999. Phosphorylation controls timing
of Cdc6p destruction: A biochemical analysis. Mol Biol Cell 10(10): 3263-3277.
106
Friedman, K.L., Diller, J.D., Ferguson, B.M., Nyland, S.V., Brewer, B.J., and Fangman,
W.L. 1996. Multiple determinants controlling activation of yeast replication
origins late in S phase. Genes Dev 10(13): 1595-1607.
Gopalakrishnan, V., Simancek, P., Houchens, C., Snaith, H.A., Frattini, M.G., Sazer, S.,
and Kelly, T.J. 2001. Redundant control of rereplication in fission yeast. Proc
Natl Acad Sci U S A 98(23): 13114-13119.
Green, B.M. and Li, J.J. 2005. Loss of rereplication control in Drosophilamelanogaster
results in extensive DNA damage. Mol Biol Cell 16(1): 421-432.
Green, B.M., Morreale, R.J., Ozaydin, B., Derisi, J.L., and Li, J.J. 2006. Genome-wide
mapping of DNA synthesis in Drosophilamelanogasterreveals that mechanisms
preventing reinitiation of DNA replication are not redundant. Mol Biol Cell 17(5):
2401-2414.
Hu, F. and Aparicio, O.M. 2005. Swel regulation and transcriptional control restrict the
activity of mitotic cyclins toward replication proteins in Drosophila
melanogaster.Proc Natl Acad Sci U S A 102(25): 8910-8915.
Labib, K., Diffley, J.F., and Kearsey, S.E. 1999. Gl-phase and B-type cyclins exclude the
DNA-replication factor Mcm4 from the nucleus. Nat Cell Biol 1(7): 415-422.
MacAlpine, D.M. and Bell, S.P. 2005. A genomic view of eukaryotic DNA replication.
Chromosome Res 13(3): 309-326.
Machida, Y.J., Hamlin, J.L., and Dutta, A. 2005. Right place, right time, and only once:
replication initiation in metazoans. Cell 123(1): 13-24.
Maiorano, D., Moreau, J., and Mechali, M. 2000. XCDT1 is required for the assembly of
pre-replicative complexes in Xenopus laevis. Nature 404(6778): 622-625.
Melixetian, M., Ballabeni, A., Masiero, L., Gasparini, P., Zamponi, R., Bartek, J., Lukas,
J., and Helin, K. 2004. Loss of Geminin induces rereplication in the presence of
functional p53. J Cell Biol 165(4): 473-482.
Mendez, J. and Stillman, B. 2003. Perpetuating the double helix: molecular machines at
eukaryotic DNA replication origins. Bioessays 25(12): 1158-1167.
Mihaylov, I.S., Kondo, T., Jones, L., Ryzhikov, S., Tanaka, J., Zheng, J., Higa, L.A.,
Minamino, N., Cooley, L., and Zhang, H. 2002. Control of DNA replication and
chromosome ploidy by geminin and cyclin A. Mol Cell Biol 22(6): 1868-1880.
Nguyen, V.Q., Co, C., Irie, K., and Li, J.J. 2000. Clb/Cdc28 kinases promote nuclear
export of the replication initiator proteins Mcm2-7. Curr Biol 10(4): 195-205.
Nguyen, V.Q., Co, C., and Li, J.J. 2001. Cyclin-dependent kinases prevent DNA rereplication through multiple mechanisms. Nature 411(6841): 1068-1073.
107
Pokholok, D.K., Harbison, C.T., Levine, S., Cole, M., Hannett, N.M., Lee, T.I., Bell,
G.W., Walker, K., Rolfe, P.A., Herbolsheimer, E., Zeitlinger, J., Lewitter, F.,
Gifford, D.K., and Young, R.A. 2005. Genome-wide map of nucleosome
acetylation and methylation in yeast. Cell 122(4): 517-527.
Raghuraman, M.K., Winzeler, E.A., Collingwood, D., Hunt, S., Wodicka, L., Conway,
A., Lockhart, D.J., Davis, R.W., Brewer, B.J., and Fangman, W.L. 2001.
Replication dynamics of the yeast genome. Science 294(5540): 115-121.
Santocanale, C. and Diffley, J.F. 1998. A Mecl- and Rad53-dependent checkpoint
controls late-firing origins of DNA replication. Nature 395(6702): 615-618.
Shirahige, K., Hori, Y., Shiraishi, K., Yamashita, M., Takahashi, K., Obuse, C.,
Tsurimoto, T., and Yoshikawa, H. 1998. Regulation of DNA-replication origins
during cell-cycle progression. Nature 395(6702): 618-621.
Stotz, A. and Linder, P. 1990. The ADE2 gene from Drosophilamelanogaster:sequence
and new vectors. Gene 95(1): 91-98.
Takahashi, T.S., Wigley, D.B., and Walter, J.C. 2005. Pumps, paradoxes and
ploughshares: mechanism of the MCM2-7 DNA helicase. Trends Biochem Sci
30(8): 437-444.
Vogelauer, M., Rubbi, L., Lucas, I., Brewer, B.J., and Grunstein, M. 2002. Histone
acetylation regulates the time of replication origin firing. Mol Cell 10(5): 12231233.
Wilmes, G.M., Archambault, V., Austin, R.J., Jacobson, M.D., Bell, S.P., and Cross, F.R.
2004. Interaction of the S-phase cyclin Clb5 with an "RXL" docking sequence in
the initiator protein Orc6 provides an origin-localized replication control switch.
Genes Dev 18(9): 981-991.
Wohlschlegel, J.A., Dwyer, B.T., Dhar, S.K., Cvetic, C., Walter, J.C., and Dutta, A.
2000. Inhibition of eukaryotic DNA replication by geminin binding to Cdtl.
Science 290(5500): 2309-2312.
Wuarin, J., Buck, V., Nurse, P., and Millar, J.B. 2002. Stable association of mitotic cyclin
B/Cdc2 to replication origins prevents endoreduplication. Cell 111(3): 419-431.
Wyrick, J.J., Aparicio, J.G., Chen, T., Barnett, J.D., Jennings, E.G., Young, R.A., Bell,
S.P., and Aparicio, O.M. 2001. Genome-wide distribution of ORC and MCM
proteins in S. cerevisiae: high-resolution mapping of replication origins. Science
294(5550): 2357-2360.
Yabuki, N., Terashima, H., and Kitada, K. 2002. Mapping of early firing origins on a
replication profile of budding yeast. Genes Cells 7(8): 781-789.
108
Yanow, S.K., Lygerou, Z., and Nurse, P. 2001. Expression of Cdcl8/Cdc6 and Cdtl
during G2 phase induces initiation of DNA replication. Embo J 20(17): 46484656.
Zhu, W., Chen, Y., and Dutta, A. 2004. Rereplication by depletion of geminin is seen
regardless of p53 status and activates a G2/M checkpoint. Mol Cell Biol 24(16):
7140-7150.
109
Chapter III
Orc2 and Orc6 phosphorylation have distinct roles in preventing re-replication
I would like to thank John Randell for providing the phosphomimetic constructs.
Summary
Genornic DNA replication must be regulated such that it only occurs once every
cell cycle. Re-initiation of replication during a single cell cycle can lead to extensive
DNA damage and ultimately cell death. To prevent re-replication, eukaryotic cells use
multiple mechanisms to inhibit pre-Replicative Complexes (pre-RCs) from forming at
origins of replication. In the yeast Saccharomyces cerevisiae, one of those mechanisms is
to phosphorylate two of the six subunits of the Origin Recognition Complex (ORC), Orc2
and Orc6. Preventing phosphorylation of these subunits sensitizes the cell to rereplication, but the mechanism by which these phosphorylations interfere with pre-RC
formation is unknown. We used a combination of in vivo and in vitro assays with
phosphomimetic and non-phosphorylatable ORC mutants to elucidate how
phosphorylation of Orc2 and Orc6 prevents re-replication. Our data indicate that Orc2
and Orc6 phosphorylation inhibit re-replication by different mechanisms.
Phosphorylating Orc2 directly inhibits the Mcm2-7 complex from associating at origins.
Phosphorylating Orc6 seems to prevent re-replication by stabilizing CDK at origins to
create both a catalytic and/or physical barrier against pre-RC formation.
111
Introduction
The faithful duplication of the eukaryotic genome is one of the most important tasks
completed during each cell cycle. It is essential to the cell that this process is tightly
regulated and only occurs once before cellular division. If a second round of replication
(re-replication) begins to occur before cell division, DNA damage and genomic
instability can result. Thus, eukaryotic cells have many layers of regulation to prevent
replication from starting a second time during a single cell cycle.
Many of the mechanisms that prevent re-replication target members of the preReplicative Complex (pre-RC). The pre-RC is a multi-protein complex that marks sites of
DNA replication initiation, known as origins, across the genome. The components of the
pre-RC associate with origin DNA in an ordered fashion (Bell and Dutta 2002). The
Origin Recognition Complex (ORC) is the first member of the pre-RC to bind to origins
and is responsible for recruiting the remaining factors. Cdc6 and Cdtl both associate with
origins through interactions with ORC. Both Cdc6 and Cdtl are required to recruit and
load the final component of the pre-RC, the Mcm2-7 complex, which is the putative
replicative helicase.
Initiation of replication has two stages: selection and activation. Pre-RCs are formed
during the selection stage. This occurs during the late M and G phases of the cell cycle
when Cyclin Dependent Kinase activity (CDK) directed by B-type cyclins is low. The
activation stage of initiation, when additional replication factors are loaded onto origins,
occurs as cells enter S phase and with the increase in Cdk:B-type cyclin activity. Both
Cdk (Cyclin Dependent Kinase) and another kinase, Cdc7, are required to activate
initiation.
Mechanisms that inhibit re-replication act by preventing new pre-RC formation
after an origin initiates (Blow and Dutta 2005). These mechanisms act on pre-RC
components directly and possibly some downstream replication factors (Tanny et al.
2006). Although evidence of mechanisms to inactivate pre-RC members has been cited in
112
all eukaryotes studied, the exact mechanism of inhibition varies between organisms. One
common attribute is that the majority of inactivation mechanisms are directed by CDK
activity. After initiating DNA replication, Cdk's, whether associated with S-phase cyclins
or M-phase cyclins, are crucial for preventing re-replication. In fact, inhibiting CDK
activity during G2 results in pre-RC formation at all origins (Hayles et al. 1994;
Dahmann et al. 1995; Coverley et al. 1998). Many organisms have also developed several
CDK-independent mechanisms as well (reviewed in Diffley 2004).
ORC, as the first component of the pre-RC to establish sites of replication, is
regulated in all organisms. Despite its central importance, inactivation of ORC is one of
the less understood mechanisms to prevent re-replication. In metazoa, the main target of
ORC regulation is the Orcl subunit. In Drosophila,Orcl is degraded in an APCdependent manner via ubiquitinylation (Araki et al. 2003), although it is currently unclear
if the proteolysis is dependent on CDK activity. In mammalian systems, Orc 1 is a target
of CDK activity, but the outcome of phosphorylation is not clear. In one example, after
phosphorylation, Orcl was ubiquitinylated and subsequently degraded (Mendez et al.
2002). In another set of experiments, Orcl was phosphorylated, ubiquitinylated and
removed from the DNA, but not degraded (Li et al. 2003). Finally, a third set of
experiments suggested that Orc remained on the DNA throughout the cell cycle (Okuno
et al. 2001). In Xenopus, data suggest that ORC is removed from the DNA after pre-RC
formation (Sun et al. 2002), but the mechanism driving this removal is not known.
The regulation of ORC is distinct in yeast as it is not ubiquitinylated or degraded. In
both Saccharomyces cerevisiaeand Schizosaccaromycespombe, ORC remains at origins
throughout the entire cell cycle. The complex is inactivated via CDK-dependent
phosphorylation. Orc2 is phosphorylated in both S. pombe and S. cerevisiae and Orc6 is
phosphorylated in S. cerevisiae.Although experiments from both yeasts have shown that
these phosphorylations are important for preventing re-replication (Nguyen et al. 2001;
Vas et al. 2001), it is not known how the modifications act to inhibit pre-RC formation. It
is currently thought that the phosphorylation event somehow prevents one or more of the
other pre-RC components from being recruited to origins.
113
Data from both S. cerevisiae and S. pombe have shown that ORC also prevents rereplication by recruiting a Cdk:cyclin complex to each origin after it initiates (Wuarin et
al. 2002; Wilmes et al. 2004). In S. pombe, Cdk (Cdc2) is recruited to origins along with
the mitotic cyclin Cdcl3 via an interaction with Orc2. In S. cerevisiae, Cdk (Cdc28) and
the S-phase cyclin Clb5 associate with origin DNA in vitro, but through interactions with
Orc6 rather than Orc2. In vitro and in vivo, Orc6 interaction is dependent on a
hydrophobic patch motif in Clb5 and a three amino acid RXL motif on Orc6. The Clb5
hydrophobic patch motif is important for Cdc28:Clb5 to recognize specific substrates.
This suggests that Orc6 recruits CDK to origins by being a substrate. The function of
ORC-bound CDK is not known. It is possible that pre-RC components are not
phosphorylated efficiently until CDK is recruited to the origin. Alternatively, the
presence of the CDK might sterically hinder other pre-RC components from interacting
with ORC and thus associating with origins.
Previous work in our lab showed that different combinations of Orc2 and Orc6
mutations in a sensitized background resulted in different levels of re-replication (Wilmes
et al. 2004). This result suggested that Orc2 and Orc6 might have different functions in
preventing re-replication. To gain insight into how ORC phosphorylation inhibits pre-RC
formation, we created Orc2 and Orc6 phosphomimetic mutants. We studied the effect of
these mutations on S. cerevisiaereplication both in vivo and in vitro. We discovered that
phosphorylation of Orc2 and Orc6 prevents re-replication by distinct mechanisms. Our
current data suggest that phosphorylation of Orc2 directly prohibits Mcm2-7 from
interacting with origins whereas the phosphorylation of Orc6 might stabilize Cdc28:Clb5
binding to ORC.
114
Results
Different ORC mutations result in different levels of re-replication
Previous data from our lab and others have shown that eliminating the
phosphorylation sites of Orc2 and Orc6 sensitizes S. cerevisiaeto re-replication, but is
not lethal (Nguyen et al. 2001; Wilmes et al. 2004). These data suggest that in the
absence of ORC phosphorylation but in the presence of CDK, pre-RCs can assemble
more easily. If phosphorylation of Orc2 and Orc6 prevent re-replication by distinct
mechanisms, we might expect that the non-phosphorylatable ORC mutants, which have
alanines in place of serines or threonines (Orc2-6A and Orc6-4A) (Fig 1), also would
have distinct effects on re-replication. The effect of non-phosphorylatable ORC is not
robust unless combined with two other mutants that sensitize cells to re-replication in
combination with other sensitizing mutations: nuclear-localized Mcm2-7 and galactoseinducible non-degradable Cdc6 (Nguyen et al. 2001). To test this possibility we
monitored the extent of re-replication induced by different combinations of ORC
mutations in a re-replication-sensitized background by FACS analysis. We also tested the
non-phosphorylatable mutants in combination with a mutant copy of Orc6 missing its
RXL motif (orc6-rxl) (Fig 1), which is important for recruiting CDK to origins to prevent
re-replication (Wilmes et al. 2004). We found that the different combinations of
mutations did show different re-replication phenotypes (Fig 2A). Only the orc2-6A orc64A,rxl and the orc6-4A,rxl strains showed significant re-replication. These results support
the idea that phosphorylation of Orc2 and Orc6 works through different mechanisms to
prevent re-replication.
Recent data have shown that strains that do not seem to re-replicate by FACS
analysis show low levels of re-replication by genome-wide copy number analysis using
DNA microarrays (Green et al. 2006). Because not all of our strains seem to re-replicate
by FACS, we hybridized the re-replicated DNA from some of the re-replication-sensitive
strains to low-density DNA microarrays. The results showed that the orc2-6A orc6-4A
strain re-replicated to a greater extent than the FACS data suggested (data not shown).
115
S<1
o~C
+
+
+
+
+
Ee
oO
0
C
0
co
Go
CD
0
a
a
r
u
.IJ
<a
acD
cc
rCD
C
0
0
C12
CD
0
0
0
N
0
C,
a,
c,)
Co
(OC
CD
Q
CY)
C\
<c,
<C
(0
I
-0
I0
0
0
2
0
0c
Q
I
8
(0
0
0O
Iz
4aý
0)
Figure 1. Description of mutants used in this paper. Each mutant used in the research of
this paper is depicted as a cartoon. Red bars denote mutations that should prevent rereplication while green bars represent mutations that should promote re-replication. The
ability of each mutant to complement a null is demarcated by a "+" or "-" sign to the
right. Note: only the phosphomimetic mutations were characterized during this study.
The other mutations were characterized during previous studies by both our lab and
others (Nguyen et al. 2001; Wilmes et al. 2004).
117
The orc2-6A orc6-rxl strain did not show significant re-replication except at the
telomeres, consistent with previous reported data demonstrating increased sensitivity to
re-replication at telomeres compared to the rest of the genome (Tanny et al. 2006).
We compared the re-replication profiles for each of the strains. Only the orc2-6A
orc6-4A,rxl strain has high enough signal:noise ratio such that sites of re-replication are
easily delineated (Tanny et al. 2006). Despite lower signal:noise ratios, the orc2-6A orc64A and orc6-4A,rxl strains show modest re-replication at certain sites. Comparison of
these sites to the sites of re-replication in the orc2-6A orc6-4A,rxl strain showed that
some sites re-replicate in all three strains. Other re-replication sites, however, only
overlap between the fully deregulated strain and one of the other strains (Fig 2B).
Because the low signal:noise ratio in both the orc2-6A orc6-4A and orc6-4A,rxl strain
prevented analysis of every potential re-replication site, we did not compare these strains
to each other.
Creationand in vivo characterizationof phosphomimetic mutants
If mutations that prevent phosphorylation of Orc2 and Orc6 function differently
from each other in vivo, we wanted to know if mutations in Orc2 and Orc6 that mimic
constitutive Orc2 and Orc6 phosphorylation also act differently. We can envision two
models for how constitutive phosphorylation of ORC can prevent re-replication by
inhibiting pre-RC formation. First, ORC phosphorylation could directly prevent pre-RC
components from associating with origins. Alternatively, ORC phosphorylation could
facilitate Clb5-Cdc28 binding to ORC after initiation has occurred, which is also thought
to inhibit pre-RC formation. These two methods of inhibition predict different results for
constitutive ORC phosphorylation. If phosphorylation directly inhibits pre-RC assembly
as predicted by the first model then constitutive phosphorylation would be lethal. If the
second model is correct and phosphorylation facilitates Clb5-Cdc28 binding then ORC
that is constitutively phosphorylated would not inhibit normal pre-RC assembly because
Clb5 is not present during G1 when pre-RCs are formed. Thus, mutants of this type
would be viable.
118
0CZ
0 -
0
0>-
Il
ItiJ
cO
LO
cO
L1
CVJ CV
c>
*o0
a cc
%r
aC0O
LO
(-.
0O
LO
nF
F
0 0
z
o
cl6c .j
U,
00
c
00o
C'j
F FI-u
ci>
00O
LL
-0d
%z
C)
me
c'J
ci)
OZ (,-
o
CL
*t
7
O
~hm
X
0
a
Figure 2. Different re-replication-sensitizing mutations have different effects on the
extent of re-replication. (A) FACS analysis of strains containing different combinations
of ORC mutations up to four hours after induction of re-replication. (B) Overlap of sites
of re-replication between three different re-replicating strains: orc2-6A orc6-4A,rxl; orc26A orc6-4A and orc6-4A,rxl.
120
To determine the effect of constitutively phosphorylated ORC, we created a series
of phosphomimetic mutants (Fig 1) that could be studied both in vivo and in vitro. We
created a single Orc6 mutant with all four canonical CDK-phosphorylation sites mutated
to have an aspartate residue in place of serine or threonine (Orc6-4D). The CDK
phosphorylation sites on Orc2 are separated into two clusters, each with three
phosphorylation sites. Three different Orc2 mutants were created, one with the three Nterminal sites mutated to aspartates (Orc2-N3D), another with the three C-terminal sites
mutated (Orc2-C3D) and one with all six sites mutated (Orc2-6D).
We first tested the mutants for their ability to function in vivo. We integrated the
mutant genes under their respective promoters into strains deleted for the appropriate
ORC subunit with the deletion covered by a wild-type copy of the gene on a plasmid. In
the absence of the covering plasmid, the orc2-C3Dand orc2-6D mutants failed to
complement the Orc2 deletion. The orc2-N3D and orc6-4D mutants complemented the
deletion of Orc2 and Orc6, respectively (Fig 1). These results suggested that the
phosphorylation of Orc2 and Orc6 do not prevent re-replication by the same mechanism.
Phosphorylation of Orc6 and the three N-terminal phosphorylation sites on Orc2 might
function according to the second model we predicted: phosphorylation helps to recruit
Cdc28:Clb5. In contrast, phosphorylation of the three C-terminal sites on Orc2 might
function as predicted by the first model: phosphorylation directly inhibits pre-RC
assembly. These data also suggest that the N-terminal and C-terminal phosphorylation
sites of Orc2 have different functions. It is also possible that the N-terminal
phosphorylation sites are not relevant to ORC function.
The inability of Orc2-C3D and Orc2-6D to complement an orc2A strain suggests
that these mutant Orc2 subunits are not capable of supporting pre-RC formation. If this
was the case, we might expect that these mutations would be lethal in the presence of
wild-type Orc2. To test this, we overexpressed all six ORC subunits with Orc2-N3D
(ORC2-N3D), Orc2-C3D (ORC2-C3D), Orc2-6D (ORC2-6D), or wild-type Orc2 as the
Orc2 subunit. We found that none of the Orc2 mutants show a growth defect (data not
shown).
121
Phosphomimetic mutants can incorporateinto ORC and specifically bind origin DNA
The failure of Orc2 phosphomimetic mutants to inhibit growth when
overexpressed could be due to an inability to form complexes or bind DNA. To test these
possibilities, we expressed wt ORC and each of the phosphomimetic mutants ORCs in
baculovirus cells. Purification of the complexes showed that all of the phosphomimetic
Orc2 and Orc6 subunits co-purified with the other five ORC subunits at stoichiometric
levels (Fig 3A). When the purified, mutant ORC was incubated with wt or mutant
ARSlorigin DNA, all six subunits of ORC associated with the DNA similarly to wt ORC
(Fig 3B).
In vitro pre-RC assembly in the presence of phosphomimetic mutants
Our lab has refined an in vitro pre-RC assembly assay that allows for the
monitoring of pre-RC formation on origin DNA in S. cerevisiae extracts (Bowers et al.
2004; Randell et al. 2006). Importantly, the pre-RC components ORC, Cdc6 and Cdtl
can be specifically depleted from the extracts resulting in a loss of pre-RC assembly.
Addition of recombinant ORC, Cdc6 or Cdtl restores pre-RC formation. Here, we use the
assay to monitor if Cdc6 and Mcm2-7 are capable of associating with origin DNA in the
presence of recombinant phosphomimetic ORC.
Using ORC-depleted extracts, we tested the ability of wt or mutant ORC to direct
pre-RC formation (Fig 4A). We found that Cdc6 associated with DNA in the presence of
wt ORC and each mutant ORC. In contrast, Mcm2-7 did not associate with ARS1 DNA
equally for each ORC mutant. Wild-type ORC and ORC6-4D loaded equal amounts of
Mcm2-7, but ORC2-6D loaded five-fold fewer Mcm2-7 complexes. ORC2-N3D and
ORC2-C3D both loaded fewer Mcm2-7 complexes than wt ORC, but more than ORC26D. ORC2-N3D, however, consistently loaded more complexes than ORC2-C3D. The
results from this assay support our complementation data and suggest that
122
0
0
000
0
(O
0<
CO
o
fI
CO
z
týIi5
I
UU
Ul r)
.
0
CO
C,)
c,)
(D
LL
00
'1--
L0
OOO
0
(.U
Figure 3. Phosphomimetic ORC subunits can integrate into ORC and do not affect
ORC's specificity for origin DNA. (A) Coomassie stain of the protein in the highestconcentrated fractions from the final Q column for each of the wt and phosphomimetic
ORC purifications. 4 ug of total protein was added to each lane. (B) Wild-type or
phosphomimetic rORC (2 pmol) was incubated with wt or mutant (A-) origin DNA (1
pmol) coupled to magnetic beads in the presence of yeast whole cell extract (WCE).
124
+
rll_
-LI
E
C0 a .o
0
2
I
00
06
Gc)
0)
HL
C
1j
0
Figure 4. Phosphorylation of rORC inhibits Mcm2-7 loading. (A) rORC, Cdc6 and
Mcm2-7 association with wt origin DNA was monitored in the presence of wt or
phosphohomimetic ORC. (B) In vitro phosphorylation of wt rORC results in a loss of
Mcm2-7 loading. Standard pre-RC assembly assays were performed plus and minus
rCDK or rSicl.
126
phosphorylation of Orc2 directly prevents pre-RC formation by blocking the association
of Mcm2-7 complexes with pre-RCs.
In vitro phosphorylationof ORC results in reduced Mcm2-7 loading
Despite the different ability of the phosphomimetic mutants to interact with other
ORC subunits and specifically recognize ARS1 DNA, it is not clear that the aspartate
residues are exactly mimicking the effect of a phosphorylated serine/threonine. To
directly test whether phosphorylation of ORC inhibits pre-RC assembly, we performed
pre-RC assembly assays using wt ORC that was phosphorylated by recombinant CDK
(Fig 4B). Cdc28:Clb5 was added to wt ORC, ARS1 DNA beads and ORC-depleted yeast
extract. The result showed that Orc2 was phosphorylated, Clb5 associated with origins
and the Mcm2-7 complex did not load onto origin DNA. Addition of the CDK inhibitor
Sic I blocked Orc2 phosphorylation and restored Mcm2-7 association with origin DNA.
These data suggest that ORC phosphorylation can block Mcm2-7 loading, although we
can not distinguish which (or if both) phosphorylated subunits prevented pre-RC loading.
Additionally, CDK might be phosphorylating another component in the yeast extract that
results in blocking Mcm2-7 association.
127
Discussion
We set out to determine the effects of ORC phosphorylation on pre-RC formation
by using a combination of Orc2 and Orc6 mutants in both in vivo and in vitro assays. The
current hypothesis is that phosphorylation of these subunits might block a downstream
component of the pre-RC from associating with origin DNA. Previous studies on the role
of ORC phosphorylation in S. cerevisiae have not suggested that phosphorylation of Orc2
and Orc6 play separate roles in preventing pre-RC formation. Using several
complementary assays, our data suggest that Orc2 and Orc6 phosphorylation have
different functions in inhibiting pre-RC formation. Based on our data, we propose a
model that explains how the phosphorylation of these two subunits acts to prevent rereplication.
Orc2 and Orc6 have distinct mechanisms to prevent re-replicationin vivo
We discovered that different combinations of Orc2 and Orc6 nonphosphorylatable mutations resulted in different amounts of re-replication by both FACS
and genome-wide copy number analysis. Three strains showed significant re-replication
by FACS and/or genome-wide copy number analysis: orc2-6A orc6-4A,rxl, orc2-6A
orc6-4A and orc6-4A,rxl. These data suggest that compromising the regulation of Orc6
might have a greater effect than compromising Orc2 regulation. The orc2-6A orc6-4A,rxl
strain showed the most re-replication by both FACS and copy number analysis. The orc26A orc6-4A and orc6-4A,rxl strains seemed to have similar amounts of re-replication by
copy number analysis. Comparing the sites of re-replication suggested that orc2-6A orc64A and orc6-4A,rxl replicated at fewer sites than orc2-6A orc6-4A,rxl and showed less rereplication at those sites. Interestingly, sites of re-replication in both orc2-6A orc6-4A and
orc6-4A,rxl do not entirely overlap between the two strains. This result suggests that the
different combination of mutations have a different impact on origin re-initiation across
the genome.
The role of Orc2 in preventing re-replication
128
Using three different Orc2 phosphomimetic mutants, we demonstrated, using an
in vivo complementation assay, that the N-terminal and C-terminal phosphorylation sites
might have different roles in preventing pre-RC assembly. According to the two models
presented, phosphorylation of the N-terminal sites might be important for stabilizing
CDK at origins whereas phosphorylation of the C-terminal sites would directly prevent
pre-RC formation. Based on the complementation data, we expected that ORC2-N3D
would be able to load Mcm2-7 complexes as well as wt ORC, but found that this was not
the case. Importantly, however, ORC2-N3D consistently loaded more Mcm2-7
complexes than ORC2-C3D. This result suggests that phosphorylation of both clusters of
CDK sites contribute to preventing re-replication by directly inhibiting pre-RC assembly,
but that phosphorylation of the three C-terminal sites has a greater effect on inhibiting rereplication. Supporting this, mutating all six sites has an additive effect on Mcm2-7
loading in the in vitro assembly assay as the ORC2-6D mutant loads less Mcm2-7 than
ORC2-N3D or ORC2-C3D.
It is known that S. cerevisiae does not need to initiate replication from each of its
assembled pre-RCs. In fact, only two-thirds of assembled pre-RCs are activated during a
given cell cycle. It is also known that origins up to 100 kb apart are capable of replicating
the intervening DNA (Dershowitz and Newlon 1993). Therefore S. cerevisiae can survive
with only a minimum of origins initiating, although fewer origins initiating will retard S
phase, resulting in slower growth. The inability of Orc2-N3D to load wild-type-levels of
Mcm2-7 in vitro and the ability to complement an orc2A strain in vivo suggests that
phosphorylation of the three N-terminal CDK sites inhibits some Mcm2-7 complexes
from loading but allows enough Mcm2-7 complexes to load at origins such that the cells
can replicate each chromosome every cell cycle. If this hypothesis is correct then we
might expect that cells containing orc2-N3D as the only copy of ORC2 might have a slow
growth phenotype due to an extended S phase. The effect of orc2-N3D might be
analogous to the effect of deleting CLB5 where only early origins initiate, resulting in a
greater distance between origins on average and a prolonged S phase (Donaldson et al.
1998).
129
How phosphorylation of Orc2 directly inhibits Mcm2-7 from loading is still not
known, but our data suggest two possible mechanisms. One way Orc2 phosphorylation
might prevent Mcm2-7 association with DNA would be to prevent Mcm2-7 itself or
either Cdc6 or Cdtl from loading onto the DNA. Results from the pre-RC assay show
that Cdc6 loads similarly for both wt and mutant ORC. For each mutant, levels of Cdtl
association seem to correlate with the levels of Mcm2-7 association (data not shown), so
it is unclear if Orc2 phosphorylation prevents Mcm2-7 via Cdtl or directly. Another
possible mechanism is that phosphorylation of ORC results in a less-stable complex;
although ORC remains on the DNA throughout the cell cycle, it is possible that Orc2
phosphorylation reduces the affinity of ORC for origin DNA such that it is continuously
associating and dissociating from S phase through late M when B-type cyclin-directed
CDK activity is abolished. This mechanism would explain why Orc2-C3D and Orc2-6D
are not dominant negative in the presence of wt Orc2. Our current data (Fig 3B) does not
suggest that phosphomimetic ORC has a DNA binding defect, however this experiment is
not a true kinetic analysis. Further experiments would need to be conducted to determine
the true affinity of phosphomimetic ORC for ARS1 DNA as compared to wt ORC.
The role of Orc6 in preventing re-replication
Assays using the phosphomimetic Orc6 mutant, Orc6-4D, suggested that Orc6
phosphorylation functions by recruiting CDK to or stabilizing CDK at origins. Previous
studies from our lab have shown that an RXL motif in Orc6 is important for recruiting
Clb5 to an origin after that origin has initiated (Wilmes et al. 2004). Clb5 then remains at
origins, presumably until Clb5 is degraded in early anaphase by APCCdc2o (Shirayama et
al. 1999). Chromatin Immunoprecipitation assays (ChIP) showed that loss of the RXL
motif resulted in a loss of Clb5 at origins (Nguyen et al. 2001; Wilmes et al. 2004). Loss
of Orc6 phosphorylation does decrease but does not abolish Clb5 at origins. These ChIP
data suggest that phosphorylation of Orc6 may play a role in maintaining Clb5 at origins.
The RXL motif would be responsible for recruiting Clb5 to origins, but the stability of
Clb5 would be dependent on the phosphorylation of Orc6.
130
Our demonstration that orc6-4D is capable of complementing an orc6A strain and
loading Mcm2-7 in vitro supports this theory. Because Clb5 is only active in S, G2 and M
phases, Orc6 phosphorylation can only help prevent re-replication during these stages of
the cell cycle. If the only role of Orc6 phosphorylation is to recruit or stabilize
Clb5:Cdc28, then this modification would have no effect on replication during late M and
early G 1 when Clb5 is absent and pre-RCs form. It is important to note that Clb5 is
transcribed during G 1, but might not be recruited to origins once pre-RCs have formed
(Wuarin et al. 2002; Wilmes et al. 2004). The presence of the CDK inhibitor, Sicl, also
might prevent Clb5 from interacting with Orc6 (Weinreich et al. 2001). Our in vitro preRC assembly assays are performed using G 1-arrested extracts that do not have active
Clb5:Cdc28 and this might explain why Orc6-4D does not prohibit Mcm2-7 loading in
vitro. In vivo, ORC6-4D would be competent to assemble pre-RCs during G 1 and thus
would not be lethal to cells.
The role of Orcl in preventing re-replication
The Orc subunit in S. cerevisiae is also phosphorylated in vivo (SP Bell, personal
communication) by CDK, but it is not known if this modification plays a role in
preventing re-replication. In other eukaryotes, Orcl is often the ORC subunit that is
regulated to prevent re-replication (see introduction and below), so it is plausible that
Orc I in S. cerevisiae might also be regulated. Addition of CDK directly to in vitro preRC assembly assays prevents loading of Mcm2-7, and results in the phosphorylation of
Orc 1, Orc2 and Orc6 (LI Francis, personal communication). At this time, we do not know
which phosphorylated subunits are directly responsible for blocking pre-RC loading or if
all three subunits play a role. Performing pre-RC assembly assays in combination with
non-phosphorylatable ORC subunits and CDK might reveal which ORC subunits are
responsible for blocking pre-RC formation. For example, rORC containing Orc2-6A and
Orc6-4A will have only Orc phosphorylated in the in vitro assay. If Mcm2-7 does not
associate with origin DNA under these conditions (or has reduced association), this
131
would suggest that Orc phosphorylation plays a role in preventing re-replication in S.
cerevisiae.
How do Orc2 and Orc6phosphorylationwork togetherto prevent re-replication?
The phosphorylation of Orc2 and Orc6 prevents re-replication by two different
mechanisms. Our model (Fig 5) proposes that after initiation Orc2 phosphorylation
directly blocks Mcm2-7 association and Orc6 phosphorylation helps recruit or stabilize
Clb5:Cdc28, whose presence, in turn, inhibits Mcm2-7 recruitment. Clb5:Cdc28 remains
at origins during the rest of S phase. Only after B-type cyclins have been degraded in
mitosis can pre-RCs re-form.
This simple model, however, is insufficient to explain the re-replication data for
the different combinations of ORC mutants. For example, if Orc2 phosphorylation
directly blocks Mcm2-7 from loading onto DNA, why does the orc6-4A,rxl strain, which
should phosphorylate Orc2 during re-replication, show the second most significant rereplication by FACS? Additionally, if the Orc6-RXL motif is sufficient to recruit Clb5,
why doesn't the orc2-6A orc6-rxl strain re-replicate more than it does?
Many of these phenotypes can be explained by the role of Clb5:Cdc28 at origins.
Previous reports have suggested that CDK at the origin may act either catalytically or
physically to prevent re-replication (Wuarin et al. 2002; Wilmes et al. 2004). Our data
suggest that CDK does both. Our model suggests that Clb5:Cdc28 is recruited to origins
and then phosphorylates Orc2 and Orc6 (Fig 5). The phosphorylation results in direct
inhibition of Mcm2-7 loading (Orc2) while simultaneously stabilizing CDK at origins
(Orc6). Additionally, CDK may phosphorylate other pre-RC components to prevent their
association with ORC.
132
EI
-ira
(Ji
O
0
______'-rn-r
cz
y H0
Ignm
C~
U
T
1
LO
.0
pO
*5) N
S,
V a)'
10
LO
LL
07)
-0P-0
"0
,• ..
E
c
U
0
Figure 5. Model of how ORC phosphorylation regulates pre-RC formation. During late
M and early CG, Clb5 is not present and B-type cyclin-directed CDK activity is low, thus
pre-RCs form.. The formation of a pre-RC inhibits CDK from localizing to origins
(uninitiated origin). After activation, pre-RC components other than ORC disperse from
the origin, allowing Clb5:Cdc28 to be recruited through Orc6's RXL motif (initiated
origin). The association of CDK with ORC allows CDK to phosphorylate Orc2 and Orc6
to prevent Mcm2-7 re-loading as well as stabilize CDK at the origin. The presence of
CDK origins prevents re-replication by both physically blocking pre-RC components as
well as phosphorylating them.
134
A model in which CDK acts both catalytically and sterically could explain several
of the re-replication mutant phenotypes. If CDK acts catalytically, this would explain
why the orc6-4A,rxl strain re-replicates as much as it does; if CDK is completely
prevented from interacting with Orc6 by the loss of both the Orc6-RXL motif and
phosphorylation sites, then CDK can not be recruited to origins to efficiently
phosphorylate Orc2. The re-replication phenotype of the orc6-4A,rxl strain is not as
strong as the fully deregulated strain, however, because soluble CDK probably can still
phosphorylate Orc2 at a low level. The re-replication phenotype of the orc2-6A orc6-4A
strain suggests that CDK also could prevent re-replication by physically blocking pre-RC
components from associating with origins. If CDK only acted catalytically, we would
expect orc2-6A orc6-4A to re-replicate as the fully deregulated strain, but it does not.
Because the RXL motif is still intact on Orc6, Clb5:Cdc28 can still be recruited. Previous
data indicate that this interaction is sufficient to block pre-RCs from forming at some
sites, resulting in moderate re-replication (Wilmes et al. 2004). Although it is known that
the RXL motif is sufficient for Clb5 recruitment, it is not clear if this interaction is
required after Orc6 is phosphorylated. If this is the case, then the orc2-6A orc6-rxl and
orc6-rxl strains might still be able to recruit CDK via phosphorylation of Orc6 by soluble
CDK and prevent re-replication to a significant degree.
The role of ORC phosphorylation in preventing re-replication might be conserved
in other eukaryotes. S. pombe Orc2 interacts with and is phosphorylated by the S. pombe
Cdk, Cdc2 (Leatherwood et al. 1996; Vas et al. 2001). This interaction has been shown to
be important to prevent re-replication (Leatherwood et al. 1996; Vas et al. 2001; Wuarin
et al. 2002). The model in S. pombe does not currently suggest a role for Orc6
phosphorylation, only Orc2. It would be interesting to determine if phosphorylation of
Orc2 in S. pombe acts to directly prevent pre-RC assembly, stabilize Cdcl3:Cdc2, or
both. CDK has also been shown to interact with Xenopus ORC, specifically through Orc
and Orc2. It has not been shown that the interaction between Cdc2:CyclinAl and ORC
plays a role in preventing re-replication, but it is important for phosphorylating Orc2
(Romanowski et al. 2000). Data from other studies in Xenopus have suggested that the
135
entire ORC complex is removed from chromatin after initiation (Sun et al. 2002). It is not
clear if the interaction between CDK and ORC in Xenopus plays a role in this release
from chromatin or if the interaction only occurs after release. Recent work from
Drosophilahas shown that DmORC is phosphorylated in a CDK-dependent manner and
that this phosphorylation is dependent on an RXL motif in DmOrc 1 (Remus et al. 2005).
Phosphorylation of DmOrc 1 and DmOrc2 inhibited the ability of DmORC to hydrolyze
ATP, which might prevent multiple rounds of Mcm2-7 loading (Bowers et al. 2004;
Remus et al. 2005). Phosphorylation also disrupted the DNA-binding activity of
DmORC, which is one of the mechanisms we proposed to explain how ScOrc2
phosphorylation prevents re-replication. These data from metazoa suggest that
phosphorylation of ORC as well as an interaction between ORC and CDK are consereved
mechanisms that prevent re-replication.
We have presented a model that describes how phosphorylation of Orc2 and Orc6
constitutes two distinct mechanisms for preventing re-replication. Using a combination of
in vivo and in vitro assays, we have shown that Orc2 directly inhibits the assembly of preRCs by preventing the loading of Mcm2-7, but not Cdc6. We also suggest that
phosphorylated Orc6 is not lethal to the cell because its role in preventing pre-RC
assembly is mediated via Clb5, which is not active when pre-RCs are formed. We have
also shown data that suggest that CDK at origins plays both a catalytic and steric role in
preventing re-replication. Finally, we have shown that phosphorylation of different sites
on Orc2 might inhibit pre-RC assembly to different extents. Future experiments will be
necessary to definitively show that CDK does act catalytically once recruited and to
understand how phosphorylation of Orc2 blocks Mcm2-7 loading.
136
Experimental Procedures
Yeast Strains andplasmids
All strains in this study are in the W303 background (see Supplemental Table 1
for genotype).
Phosphomimetic mutations were generated by using Stratagene's Quikchange
Mutagenesis kit using the primers listed in Supplemental Table 2. To test the ability of
the phosphomimetic mutations to complement an Orc2 or Orc6 delete, LEU-marked
integrating plasmids containing the appropriate mutation (see Supplemental Table 3)
were transformed into either SB664, which contains an extra-chromosomal URA-marked
plasmid that expresses wt Orc6, or SB672, which contains an extra-chromosomal URAmarked plasmid that expressed wt Orc2. Transformants were streaked first on nonselective media and then on FOA-containing media to test for the ability to lose the wtexpressing plasmid.
To purify ORC from baculovirus cells, the appropriate mutations were cloned
from the plasmids used for complementation. Orc2 mutants were cloned into the BglII
and BstXI sites of plasmid pSB132, which contains a bi-directional promoter to express
both Orc2 and Orc5. Orc6 mutants were cloned into the NdeI and Bsu36I sites of plasmid
pSB226, which contains a bi-directional promoter to express Orcl and Orc6.
ProteinPurification
Wt and mutant ORC were purified as previously described (Klemm et al. 1997) with the
exception that the purification did not include the gel filtration column. Cdc6 was
purified as previously described (Randell et al. 2006). CDK was purified as previously
described (Wilmes et al. 2004).
137
Yeast Extract Preparation
Extract from strain SB708 (ySC7) (see table 3) was purified as previously described
(Bowers et al. 2004).
Pre-RCAssembly Assay
ARS1 magnetic beads were prepared by amplifying ARS1 from either pARS 1/WT or
pARS 1/858-865 (ACS-) using primers SB3184 and SB3340. Primer SB3340 has a
photocleaveable biotin linker on the 5' end. DNA was coupled to strepavidin-coated
beads (Dynal) by incubation for 3 hr at 50 Vg of beads per 1 pmol of DNA in B&W
Buffer (10 mM Tris-HCI pH 7.5, 1mM EDTA, 2M NaCl). Unbound DNA was removed
by washing 3X with B&W Buffer.
Pre-RC assays were performed as previously described (Bowers et al. 2004) except that 4
pmol of rCdc6 was used per reaction. Pre-RC assembly assays performed in the
presence of Clb5/Cdc28 were performed with 2 pmol ORC and ORC-depleted
WCE as before, but with the addition of 2 pmol purified Clb5-HA/GST-Cdc28HA complex and/or 12 ug (200 pmol) GST-Sicl.
Re-replicationAssays
Re-replication assays were performed as previously described (Tanny et al. 2006). See
Table 3 for a description of strains used.
MicroarrayData Analysis
Data analysis was performed as previously described (Tanny et al. 2006).
138
Supplemental Tables
139
W303BLa
SB664
SB672
SB708
SB1344
SB 1346
SB 1347
SB 1455
SB 1507
SB1690
Genotype
Geoyp
ade2-1 ura3-1 his3-11,15 trpl-1 leu2-3,112 canl100 lys2::hisGbarl::hisGMATa
orc6::HisMX6 MATa pSPB66 (ORC6 , URA3)
orc2::hisGpMFl80 (ORC2, URA3)
pep4::kanMX
orc6::HISMX6::LEU2::ORC6-ps,rxl
MCM7-NLS URA3::GAL-CDC6A2-48-HA
lys2::hisGbarl::hisGMAT a
orc6::HISMX6::LEU2::ORC6-rxl
MCM7-NLS URA3::GAL-CDC6A2-48-HA
lys2::hisGbarl::hisGMAT a
orc6::HISMX6::LEU2::ORC6-wt
MCM7-NLS URA3::GAL-CDC6A2-48-HA
lys2::hisGbarl::hisGMAT a
orc6::HISMX6::LEU2::ORC6-ps,ORC2-ps
MCM7-NLS URA3::GAL-CDC6A2-48-HA
lys2::hisGbarl::hisGMAT a
orc6::HISMX6::LEU2::ORC6-ps,rxlORC2-ps
MCM7-NLS URA3::GAL-CDC6A2-48-HA
lys2::hisG barl::hisGMAT a
orc6::HISMX6::LEU2::ORC6-rxl,ORC2-ps
MCM7-NLS URA3::GAL-CDC6A2-48-HA
lys2::hisG barl::hisGMAT a
Source
ouc
Lab stock
lab stock
lab stock
lab stock
Wilmes et al. (2004)
G. Wilmes
Wilmes et al. (2004)
Wilmes et al. (2004)
Wilmes et al. (2004)
This study
Supplemental Table 1. List of strains used during this study
140
Primer
Name
Descriptive
Name
PrimerSequence
SB2558
ARS418-PstI-5'
Orc6-4D-For
SB 1411
Orc6-4D-Rev
Orc2-6D-For 1
SB 1413
Orc2-6D-Rev
Orc2-6D-For2
GCGCTGCAGGGATTTTTCTTAGCATTTGCA
GTTTATCTAATTCTGATCCTATGAAACAATTTGCTTGGACA
CCGGATCCCAAAAAGAACAAACGCGATCCAGTAAAGAAC
CCTAACTTTAGTTGGATCACCAAACAGTTGATTCCTC
GCATAATGATATCCTATCGGATCCGGCAAAAAGCAGGAAT
GTAGATCCAAAAAGGGTTGACCCAC
CGGGGAGCTTTACTTGGATCTTTAGGTTTGAGTGCCGG
GAGCCACCAGAACCTGCAGATCCATCTAAGAAGTCTTTAA
SB 1414
CCACTAATCATGATTTTACTGATCCCCTAAAGC
GGTTAATTTACCTGGATCGGTTGAGTCTTTATATTC
TGTGGAATTGTGAGCGGATA
CTGTTTTGTCCTTGGAAAAAAAGCACTACC
SB 1415 Orc2-6D-Rev2
SB3184 RET101
SB3340 ARS1-3PCbio
Supplemental Table 2. List of primers used during this study.
141
Plasmid DescriptiveName
Name
SB1551 pRS405-Orc6
SB1946
pRS405-Orc6-4D
SB1947
pRS405-Orc2-N3D
SB1949
pRS405-Orc2-C3D
SB 1950
pRS405-Orc2-6D
SB1967
pRS405-Orc2
SB226
SB2089
SB132
SB2091
SB2092
SB2093
pMDW13
pRT24
pSPB25D
pRT26
pRT27
pRT28
Description
Leu-marked integrating plasmid that contains ORC6 under the Orc6
promoter
Leu-marked integrating plasmid that contains orc6-4D under the Orc6
promoter
Leu-marked integrating plasmid that contains orc2-N3D under the
Orc2 promoter
Leu-marked integrating plasmid that contains orc2-C3D under the
Orc2 promoter
Leu-marked integrating plasmid that contains orc2-6D under the Orc2
promoter
Leu-marked integrating plasmid that contains ORC2 under the Orc2
promoter
Baculovirus transfer vector containing ORC6 and ORC1
Baculovirus transfer vector containing orc6-4D and ORC1
Baculovirus transfer vector containing ORC2 and ORC5
Baculovirus transfer vector containing orc2-N3D and ORC5
Baculovirus transfer vector containing orc2-C3D and ORC5
Baculovirus transfer vector containing orc2-6D and ORC5
Supplemental Table 3. List of plasmids used during this study.
142
References
Araki, M., Wharton, R.P., Tang, Z., Yu, H., and Asano, M. 2003. Degradation of origin
recognition complex large subunit by the anaphase-promoting complex in
Drosophila. Embo J 22(22): 6115-6126.
Bell, S.P. and Dutta, A. 2002. DNA replication in eukaryotic cells. Annu Rev Biochem
71: 333-374.
Blow, J.J. and Dutta, A. 2005. Preventing re-replication of chromosomal DNA. Nat Rev
Mol Cell Biol 6(6): 476-486.
Bowers, J.L., Randell, J.C., Chen, S., and Bell, S.P. 2004. ATP hydrolysis by ORC
catalyzes reiterative Mcm2-7 assembly at a defined origin of replication. Mol Cell
16(6): 967-978.
Coverley, D., Wilkinson, H.R., Madine, M.A., Mills, A.D., and Laskey, R.A. 1998.
Protein kinase inhibition in G2 causes mammalian Mcm proteins to reassociate
with chromatin and restores ability to replicate. Exp Cell Res 238(1): 63-69.
Dahmann, C., Diffley, J.F., and Nasmyth, K.A. 1995. S-phase-promoting cyclindependent kinases prevent re-replication by inhibiting the transition of replication
origins to a pre-replicative state. Curr Biol 5(11): 1257-1269.
Dershowitz, A. and Newlon, C.S. 1993. The effect on chromosome stability of deleting
replication origins. Mol Cell Biol 13(1): 391-398.
Diffley, J.F. 2004. Regulation of early events in chromosome replication. CurrBiol
14(18): R778-786.
Donaldson, A.D., Raghuraman, M.K., Friedman, K.L., Cross, F.R., Brewer, B.J., and
Fangman, W.L. 1998. CLB5-dependent activation of late replication origins in S.
cerevisiae. Mol Cell 2(2): 173-182.
Green, B.M., Morreale, R.J., Ozaydin, B., Derisi, J.L., and Li, J.J. 2006. Genome-wide
mapping of DNA synthesis in Saccharomyces cerevisiae reveals that mechanisms
preventing reinitiation of DNA replication are not redundant. Mol Biol Cell 17(5):
2401-2414.
Hayles, J., Fisher, D., Woollard, A., and Nurse, P. 1994. Temporal order of S phase and
mitosis in fission yeast is determined by the state of the p34cdc2-mitotic B cyclin
complex. Cell 78(5): 813-822.
Klemm, R.D., Austin, R.J., and Bell, S.P. 1997. Coordinate binding of ATP and origin
DNA regulates the ATPase activity of the origin recognition complex. Cell 88(4):
493-502.
143
Leatherwood, J., Lopez-Girona, A., and Russell, P. 1996. Interaction of Cdc2 and Cdcl8
with a fission yeast ORC2-like protein. Nature 379(6563): 360-363.
Li, X., Zhao, Q., Liao, R., Sun, P., and Wu, X. 2003. The SCF(Skp2) ubiquitin ligase
complex interacts with the human replication licensing factor Cdtl and regulates
Cdtl degradation. J Biol Chem 278(33): 30854-30858.
Mendez, J., Zou-Yang, X.H., Kim, S.Y., Hidaka, M., Tansey, W.P., and Stillman, B.
2002. Human origin recognition complex large subunit is degraded by ubiquitinmediated proteolysis after initiation of DNA replication. Mol Cell 9(3): 481-491.
Nguyen, V.Q., Co, C., and Li, J.J. 2001. Cyclin-dependent kinases prevent DNA rereplication through multiple mechanisms. Nature 411(6841): 1068-1073.
Okuno, Y., McNairn, A.J., den Elzen, N., Pines, J., and Gilbert, D.M. 2001. Stability,
chromatin association and functional activity of mammalian pre-replication
complex proteins during the cell cycle. Embo J 20(15): 4263-4277.
Randell, J.C., Bowers, J.L., Rodriguez, H.K., and Bell, S.P. 2006. Sequential ATP
hydrolysis by Cdc6 and ORC directs loading of the Mcm2-7 helicase. Mol Cell
21(1): 29-39.
Remus, D., Blanchette, M., Rio, D.C., and Botchan, M.R. 2005. CDK phosphorylation
inhibits the DNA-binding and ATP-hydrolysis activities of the Drosophila origin
recognition complex. J Biol Chem 280(48): 39740-39751.
Romanowski, P., Marr, J., Madine, M.A., Rowles, A., Blow, J.J., Gautier, J., and Laskey,
R.A. 2000. Interaction of Xenopus Cdc2 x cyclin Al with the origin recognition
complex. J Biol Chem 275(6): 4239-4243.
Shlirayama, M., Toth, A., Galova, M., and Nasmyth, K. 1999. APC(Cdc20) promotes exit
from mitosis by destroying the anaphase inhibitor Pds I and cyclin Clb5. Nature
402(6758): 203-207.
Sun, W.H., Coleman, T.R., and DePamphilis, M.L. 2002. Cell cycle-dependent regulation
of the association between origin recognition proteins and somatic cell chromatin.
EmboJ 21(6): 1437-1446.
Tanny, R.E., MacAlpine, D.M., Blitzblau, H.G., and Bell, S.P. 2006. Genome-wide
analysis of re-replication reveals inhibitory controls that target multiple stages of
replication initiation. Mol Biol Cell 17(5): 2415-2423.
Vas, A., Mok, W., and Leatherwood, J. 2001. Control of DNA rereplication via Cdc2
phosphorylation sites in the origin recognition complex. Mol Cell Biol 21(17):
5767-5777.
Weinreich, M., Liang, C., Chen, H.H., and Stillman, B. 2001. Binding of cyclindependent kinases to ORC and Cdc6p regulates the chromosome replication
cycle. ProcNatl Acad Sci U S A 98(20): 11211-11217.
Wilmes, G.M., Archambault, V., Austin, R.J., Jacobson, M.D., Bell, S.P., and Cross, F.R.
2004. Interaction of the S-phase cyclin Clb5 with an "RXL" docking sequence in
the initiator protein Orc6 preplication control switch. Genes Dev 18(9): 981-991.
Wuarin, J., Buck, V., Nurse, P., and Millar, J.B. 2002. Stable association of mitotic cyclin
B/Cdc2 to replication origins prevents endoreduplication. Cell 111(3): 419-431.
145
Chapter IV
Discussion
Summary of Results
During each cell cycle, cells must prevent a second round of replication to avoid
extensive DNA damage and possible death. Underscoring the importance to prevent rereplication, all eukaryotic cells use multiple mechanisms to inhibit origins from initiating
more than once before cellular division. My work has focused on understanding the
mechanisms that prevent re-replication in the yeast S. cerevisiae.
In chapter two, I discussed experiments that ascertained what happens to the S.
cerevisiae genome when re-replication is induced. Specifically, we were interested in
determining the sites that are re-replicated in a re-replication-sensitized strain. The results
suggest that re-replication only initiates from sequences previously identified as potential
replication origins (i.e. sequences that are associated with a pre-RC during Gi). Only a
subset of re-replicating origins show high levels of re-replication, with some of those
origins undergoing multiple rounds of re-replication. Our data show that all potential
origins can be grouped into three categories with respect to re-replication: those that do
not form pre-RCs, those that form pre-RCs but do not re-initiate and those that form preRCs and re-initiate. The class of origins that form pre-RCs but do not re-initiate is
particularly interesting because it suggests that events after pre-RC formation are
regulated to prevent re-replication.
In chapter three, I described experiments that begin to elucidate the role of ORC
phosphorylation in preventing re-replication. Our initial results suggest that Orc2 and
Orc6 use distinct mechanisms to prevent re-replication. Orc2 phosphorylation directly
inhibits Mcm2-7 loading whereas Orc6 phosphorylation could be important for
stabilizing Cdc28:Clb5 at origins after initiation. Based on these and other results, I
proposed a model for how Orc2 and Orc6 regulation is coordinated to prevent rereplication.
Why are some origins more sensitive to re-replication than others?
147
Our data and those of others (Nguyen et al. 2001) show that not all origins reinitiate when cells are induced to re-replicate. Out of 377 possible initiation sites (as
determined by pre-RC association during GI), only one-third re-replicate significantly.
We initially asked if those origins that re-replicate correlate with any previously
determined subclass of origins. A correlation between the origins that re-replicate and
another subclass of origins might help delineate why some origins are more likely to rereplicate.
We first asked if the ability of a particular origin to re-replicate is correlated with
the timing of initiation of that origin. Comparing each site of re-replication to when it
initiates during S phase, we found no correlation between when an origin initiates and
whether it re-replicates. In addition, we found that integrating as little as 200 bp of DNA
surrounding a re-replicating origin at a non-re-replicating site in the genome is sufficient
to induce re-replication at the exogenous site. In S. cerevisiae, the timing of initiation for
a particular origin is determined by large regions surrounding the origin (Friedman et al.
1996). These data suggest that the sequence determinants of timing are not the same as
those that determine the sensitivity to re-replication. In support of this hypothesis, we
found no correlation between when an origin initiates and whether it re-replicates.
We also asked whether the orientation of both neighboring genes influence the
ability of an origin to re-replicate. Analysis of all intergenic S. cerevisiae origins showed
that origins are more likely to be found between two convergent genes than would be
expected based on a random distribution in the genome (MacAlpine and Bell 2005).
Perhaps origins are more likely to be found at the 3'-ends of genes so that the pre-RCs
and transcription machinery will not interfere with each other. Fifty-seven percent of all
origins are between parallel transcripts, 10% are between divergent transcripts and 33%
are between convergent transcripts. For re-replicating origins that overlapped with a G 1
origin within 7.5 kb, 45% are between parallel transcripts, 22% are between divergent
transcripts and 35% are between convergent transcripts. Because re-replicating origins
sort with respect to transcript orientation similarly to all origins, it suggests that there is
not a bias for re-replicating origins that is different from the entire population of origins.
148
Recent data from our lab have shown that when S. cerevisiae enter stationary
phase due to starvation, a subset of pre-RCs remain assembled at origins. Intriguingly,
this subset of sites is similar to pre-RC formation during re-replication. Current data from
several different eukaryotic organisms suggest when cells enter a quiescent state (or GO)
pre-RCs are disassembled (Diffley et al. 1994; Su and O'Farrell 1997; Abdurashidova et
al. 1998; Stoeber et al. 2001). By performing genome-wide location analysis of Mcm2-7
from S. cerevisiae in stationary phase, we found that the Mcm2-7 is removed from many
but not all origins (M. deVries and S.P. Bell personal communication). Approximately
172 out of 377 possible Mcm2-7 binding sites remain during GO. Interestingly, of those
172 sites, 101 (59%) overlap with an origin that re-replicates and 142 (83%) overlap with
a site that forms a pre-RC during induced re-replication. The striking overlap between
these two data sets suggest that there is a common mechanism that drives pre-RC
formation during re-replication in the G2 phase of the cell cycle and the GO phase of the
cycle. Importantly, these data also suggest that the pre-RCs that form/initiate during rereplication are not an artifact of the re-replication experimental system.
Chromatin structure surrounding origins might influence whether or not an origin
re--initiates. For example, ARS418 is very sensitive to re-replication and can re-initiate
multiple times. When ARS418 is moved to a region that does not normally re-replicate,
ARS418 induces re-replication but not to the same extent as at the endogenous locus. This
reduction in re-replication could be a result of the exogenous locus having a different
chromatin structure than the endogenous locus, which affects the ability of the origin to
re--initiate.
One model to explain how chromatin affects the sensitivity of an origin to rereplication is that a more open chromatin structure might allow pre-RC components
better access to the DNA. It is possible that after pre-RCs are disassembled, during late
S/G2, the chromatin surrounding many origins might adopt a structure that is restrictive
to pre-RC formation, thus preventing those origins from re-initiating. This repressive
state would then be relieved in G1 allowing pre-RCs to assemble at origins. This model
would explain the three different classes of origins with respect to re-replication. Those
149
origins that are within the most opened chromatin structures would be able to form preRCs and assemble the replication machinery. Those origins within a less open chromatin
structure might be able to assemble pre-RCs, but not the subsequent replication factors.
Finally, origins within more closed chromatin structures might not be able to assemble
pre-RCs at all..
More experiments need to be done to test the influence of chromatin on pre-RC
assembly under re-replicating conditions. The absence of the histone deacetylase Rpd3 is
known to have an effect on the timing of initiation (Vogelauer et al. 2002; Aparicio et al.
2004). It is presumed that the change in timing is a result of a change in chromatin
structure due to the loss of Rpd3, although there is no correlation with timing and the
extent of acetylation (M. deVries and S.P. Bell personal communication). One way to test
the effect of chromatin on pre-RC formation would be to monitor genome-wide pre-RC
formation during re-replication in an rpd3A strain. It would also be interesting to perform
more directed experiments by specifically affecting the chromatin structure at a single
locus. For example, tethering Gcn5, a histone acetylase, near a late-initiating origin in S.
cerevisiae induced that origin to initiate earlier (Vogelauer et al. 2002). Similarly,
tethering a member of the silencing complex, Sir4, near an early-initiating origin induced
that origin to initiate later (Zappulla et al. 2002). The results of these previous
experiments suggest several interesting approaches to help elucidate the impact of
chromatin on pre-RC formation during re-replication. Tethering Gcn5 near an origin that
does not form a pre-RC during re-replication could induce a more opened chromatin
structure. We can then monitor pre-RC formation at this altered site. Similarly, tethering
Sir4, which could result in a more closed chromatin structure, near an origin that does reinitiate (such as ARS418) might block re-replication at a specific locus.
Other replication proteins might be regulated to prevent re-replication
Our work has shown that origins that assemble pre-RCs under induced rereplication conditions do not necessarily initiate. As discussed above, it is possible that
the inability to initiate might be a result of closed chromatin structures excluding
150
replication factors. Additionally, it is possible that other replication factors besides preRC components are regulated to prevent pre-RC activation. Thus, not only would the
selection stage of initiation be regulated but the activation stage as well.
There are numerous candidate proteins that might be regulated to prevent rereplication. As mentioned in the introduction, there are many other proteins that assemble
at origins of replication after the pre-RC has formed and most of these travel with the
replication fork. A study to determine all the targets of Cdc28:Clb5 in S. cerevisiae
showed that many of these factors are phosphorylated by Cdc28:Clb5 (Ubersax et al.
2003), including Dbf4, Poll, Dbp2 and Sld2. Some of these, like Sld2 (Masumoto et al.
2002), might be phosphorylated to promote replication rather than prevent it. It is also
possible that some replication fork components are regulated by non-CDK dependent
mechanisms, similar to Cdtl in metazoa.
The presence of multiple Mcm2-7 complexes loaded onto DNA during S phase
presents at least one reason why the cell might regulate post-RC replication factors to
prevent re-replication. One of the speculated roles of these excess complexes is that they
help finish replicating long stretches of unreplicated DNA during the end of S phase.
Alternatively, the complexes could be important for the intra-S phase checkpoint (Blow
and Dutta 2005). To initiate replication from these additional Mcm2-7 complexes, it is
not clear de novo loading of replication machinery is required or if the complexes would
use polymerases already associated with the DNA. Regardless of which mechanism is
correct, any soluble post-RC factors must be regulated such that they do not prematurely
or accidentally associate with the excess Mcm2-7 complexes. A failure to inhibit these
replication factors throughout the remainder of S phase might lead to additional,
inappropriate active replication forks.
Re-replication and Silencing
During our studies on the effects of re-replication on the S. cerevisiae genome, we
noticed that a strain with all the mechanisms preventing re-replication deregulated (orc2-
151
6A orc6-4A,rxl, mcm7-NLS, gal-cdc6AN) had a reduced sensitivity to the mating-type
pheromone a-factor. Each haploid S. cerevisiaecell contains genetic information to be
one of two mating types but only expresses one set of mating type genes at a time, either
a or a. Genes for mating type a are located at the HMR locus, and genes for mating type
a are located at the HML locus. Both HMR and HML are transcriptionally silent. To
express one set of mating-type genes, yeast use a process similar to gene conversion to
copy either the a genes or a genes to the MAT locus, which is transcriptionally active. If
the genes at HMR and HML are desilenced such that the cell expresses genes of both
mating types, the cells are non-responsive to mating factor and are sterile. Thus, we
hypothesized that the completely de-regulated re-replicating strain might have a partial
silencing defect such that both a and a genes are expressed.
It is likely that the silencing defect is mediated through ORC. Not only does ORC
mark the sites of origins, but it also plays a role in establishing silencing at both the
mating type loci and the telomeres in S. cerevisiae (Grunstein 1998; Geissenhoner et al.
2004). Orcl, along with Rapl and Abfl, is important for recruiting members of the SIR
complex, which establishes heterochromatin (Rusche et al. 2003). Orc 1 can also play a
role in establishing silencing by recruiting Suml, which then recruits the Sir2-homolog
Hstl (Sutton et al. 2001). Our strain does not contain a mutation in Orcl, but it is possible
that the mutations in Orc2 or Orc6 are indirectly affecting the ability of ORC to establish
silencing. To test which mutation(s) in the deregulated strain is responsible for the
possible silencing phenotype, we monitored the response of strains containing different
combinations of the re-replication-inducing mutations to a-factor. Strains with a reduced
sensitivity to a-factor had all three ORC mutations (orc2-6A, orc6-4A and orc6-rxl) in
common. These data suggest that the defect in a-factor response is mediated through
ORC.
Additionally, we found that the deregulated strain showed an increased propensity
to re-replicate at the telomeres. Sub-telomeric regions contain multiple ORC binding
sites, but the majority of these binding sites do not act as origins or are very weak origins
(Wyrick et al. 2001). Instead, the presence of excess ORC might be important for
152
establishing silencing at telomeres. Although silencing in S. cerevisiaeis not necessarily
mediated by making promoter regions inaccessible to transcription factors (Rusche et al.
2003), it somehow prevents the activation of transcription. Similarly the telomeric
heterochromatin does not preclude pre-RC formation but somehow prevents the
activation of pre-RCs. If the mutations in Orc2 and Orc6 indirectly disrupt silencing at
typically silenced loci, this would result in a loss of heterochromatic structure. When the
heterochromatic state is perturbed pre-RCs might be more susceptible to being activated,
thus resulting in the increased re-replication at telomeres. We also found that telomeres,
which are normally late-replicating, replicate earlier during S phase in the deregulated
strain. This change in timing might be a result of increased accessibility of replication
machinery to pre-RCs at the telomeres due to the loss of silencing.
There are many experiments that can be performed at both the HM and telomeric
loci to test for the loss of silencing. Our deregulated strain is mating type a and loss of
transcriptional repression at the HM loci would result in the expression of a genes,
making the strain sterile or unable to respond to a-factor. Therefore eliminating HML,
which contains the a genes, from a strain containing the ORC mutations should suppress
the insensitivity to a-factor. Additionally, one could monitor the transcript production
from HML locus to determine if the a genes are expressed. Many studies have shown that
integrating genes within telomeric regions results in transcriptional repression of those
genes. Therefore, it would be interesting to insert a gene for an auxotrophic marker
within the telomeric region of a strain with all of the ORC mutations to monitor the
transcriptional silencing at the telomeres. If the auxotrophic marker is expressed due to a
loss of silencing, this strain will be able to survive in medium that does not contain the
specific nutritional requirement produced by the auxotrophic marker gene product.
Finally, one could use gene-expression profiling to compare the expression at the
telomeric and HM loci (as well as any other loci) in the fully de-regulated strain during
the cell cycle to the expression in a wt strain.
The mechanism by which mutations in Orc2 and Orc6 might perturb silencing is
unclear. The role of ORC in silencing is mediated through Orcl, which recruits either
153
Sirl or Suml. These two proteins then recruit histone deacetylases to remove acetyl
groups from the N-terminal tails of histone H4 (Rusche et al. 2003). The domains of Orcl
that are important for silencing and initiation are independent of each other, but it is not
clear if Orcl can recruit Sirl or Suml and pre-RC components at the same time. It is
possible that mutations in Orc2 and Orc6 that make pre-RC formation easier make the
recruitment of Sirl or Suml more difficult.
How ORC phosphorylation prevents re-replication
Our results using non-phosphorylatable and phosphomimetic Orc2 and Orc6
mutants indicate that the phosphorylation of these two proteins have separate functions in
preventing re-replication. Our current model proposes that Orc2 phosphorylation directly
inhibits pre-RC formation and that Orc6 phosphorylation is important for stabilizing
CDK at origins, which is important for preventing re-replication. The use of
phosphomimetic mutants in an in vitro pre-RC assembly assay showed that ORC-6D
(ORC with Orc2-6D) has a reduced ability to load Mcm2-7, while ORC-4D (ORC with
Orc6-4D) does not. Our assembly assays use yeast extracts arrested in G1, when Clb5 is
not active. According to our model, if Clb5 is not able to interact with Orc6, then Orc6
phosphorylation has no effect on preventing re-replication. The absence of Clb5 explains
why the ORC-4D mutant loads Mcm2-7 as well as wt ORC in the in vitro assay. The
absence of Clb5 during G1 also explains why an orc6-4D allele can complement an
orc6A strain.
It is not clear that a negatively charged amino acid in place of a phosphorylated
serine or threonine can fulfill the role of endogenous ORC phosphorylation. In support of
the phosphomimetics functioning as phosphorylated mutants, we find that he
phosphomimetic mutant subunits interact with the other ORC subunits, and do not reduce
the specificity of ORC for origin DNA. To test whether in vitro phosphorylation of ORC
has the same effect as the phosphomimetic ORC mutants, we performed a standard preRC assembly assay, but prior to adding G 1-arrested yeast extract we incubated wt ORC
with recombinant CDK to phosphorylate rORC. The result from this assay showed that
154
Mcm2-7 loading was inhibited in the presence of phosphorylated ORC. Addition of the
CDK inhibitor Sicl showed that the lack of Mcm2-7 association with origin DNA was
dependent on CDK activity. It is important to note that this assay does not distinguish
which phosphorylated ORC subunit played a role in preventing pre-RC formation. With
the addition of CDK, Orc6 phosphorylation can now inhibit re-replication because Clb5
can interact with Orc6.
We have seen association of Cdc28 with origin DNA in our initial assays
(Chapter III, Fig4B), although it has not been tested whether this recruitment is ORCdependent. We found that Cdc28 was associated with origin DNA even in the presence of
Sic 1. It is possible that, as with other recombinant proteins, rCDK interacts with the
magnetic beads. It is possible that only a small portion of Cdc28 actually interacts with
Orc6 and this is masked by CDK non-specifically associating with beads. Further
experiments using mutant origin DNA, for which ORC has a severely reduced binding
affinity, will help determine the nature of the association of CDK with origin DNA.
Although the addition of CDK to wt ORC resulted in an effect similar to using
phosphomimetic Orc2, we still do not know if the effect of CDK is directly mediated
through ORC phosphorylation. There are several in vitro experiments that can be done to
test the role of ORC phosphorylation. Rather than using phosphomimetic mutants, nonphosphorylatable mutants could be used instead. Using rORC that included both Orc2-6A
and Orc6-4A should result in restoring Mcm2-7 loading even in the presence of CDK,
which would be consistent with re-replication data. To test if phosphorylation of Orc2 or
Orc6 alone can prevent Mcm2-7 loading, we could use rORC with only Orc2-6A or
Orc6-4A. Using ORC with Orc6-4A would allow Orc2 phosphorylation, which our data
suggest directly blocks loading. If we also used Orc2-N3A or Orc2-C3A in combination
with Orc6-4A, we could test if these two different phosphorylation site clusters have
different effects on preventing re-replication as the complementation data suggest.
Additionally, the Orc6-4A mutant can be used to test whether or not CDK is stabilized at
origins if Orc6 is not phosphorylated. Using ORC with Orc2-6A would allow for Orc6
phosphorylation, which should stabilize CDK at origins to prevent re-replication.
155
Currently, it is unknown how recruitment of CDK to origins plays a role in
inhibiting re-replication. CDK catalytic activity is known to be necessary to prevent rereplication in G2, and it is also known that many pre-RC components are regulated after
initiation by CDK activity (Hayles et al. 1994; Dahmann et al. 1995; Coverley et al.
1998). Therefore, it is possible that CDK is recruited to origins to efficiently
phosphorylate pre-RC components. Alternatively, it is possible that the interaction
between Orc6 and CDK places CDK in a position to physically block pre-RC
components from interacting with ORC. Our preliminary results suggest that CDK could
prevent re-replication through both catalytic activity and steric hindrance. We found that
a mutant that can not recruit CDK to origins (via the loss of the RXL motif and
phosphorylation sites on Orc6) re-replicated almost as much as the fully deregulated rereplicating strain. This re-replication phenotype suggested that Orc2 is less efficiently
phosphorylated when CDK is not present at origins, but this has not been tested directly.
Our in vitro pre-RC assembly assay provides a way to test the role of CDK at
origins. As discussed above, addition of wt CDK results in a loss of Mcm2-7 loading, but
we still do not know if this is due to the catalytic activity of soluble CDK, the catalytic
activity of CDK when it is associated with origins or the physical presence of CDK at
origins. To test the role of catalytic activity, we could use an analog-sensitive (AS) allele
of Cdc28 that is inhibited specifically in the presence of the ATP-analog, 4-Amino-1-tertbutyl-3-(1 '-naphthylmethyl)pyrazolo[3,4-d]pyrimidine (1-NM-PP1) (Bishop et al. 2000).
Cdc28-AS can use ATP but has a higher affinity for 1-NM-PP1, such that in the presence
of this inhibitor Cdc28-AS does not function. Using Cdc28-AS in the presence of the
inhibitor would allow CDK to still interact with ORC but not phosphorylate any CDK
substrates. To test if CDK blocks re-replication by steric hindrance, we could use rORC
that has Orc6-4A,RXL. This mutant would not be able to recruit CDK to origins, but
CDK would still be able to phosphorylate its targets.
Because CDK can prevent pre-RC assembly in vitro, different combinations of all
the mutants discussed above might also allow us to understand how these mutations
156
affect pre-RC assembly in vivo during re-replication. We found that combinations of
mutations resulted in different re-replication phenotypes, suggesting that Orc2 and Orc6
have distinct roles in preventing re-replication. Based on the extent of re-replication
(determined both by FACS and genome-wide copy-number analysis), we were able to
develop a model for how ORC phosphorylation and CDK acts to prevent pre-RC
assembly. We could test this model by using those same combinations of mutants in the
in vitro pre-RC assembly assay to monitor pre-RC formation. The strains used to test in
vivo re-replication had two mutations that helped sensitize the cells to re-replication:
mcm7-nls and gal-cdc6AN. The mcm7-nls allele is not necessary in vitro because there is
no separation between nuclear and cytoplasmic material in the yeast extract, so there is
no need to ensure Mcm2-7 localization. A gal-cdc6AN allele could be provided in the
extracts rather than wt Cdc6 to make sure the in vitro assay is consistent with the in vivo
re-replication assays. It is important to note that the in vitro system does not perfectly
substitute for the in vivo system because we monitor Mcm2-7 loading at a single origin
that is not on a chromatinized template. However, we might expect to see that levels of
Mcm2-7 loading in vitro correlate to levels of re-replication in vivo as a result of each
mutation individually contributing to pre-RC formation in the presence of CDK activity.
Our data provide insights into how the yeast S. cerevisiaeuses CDK-dependent
phosphorylation of ORC to prevent re-replication during a single cell cycle.
Phosphorylation of the Orc2 and Orc6 subunits both prevent re-replication, but through
different mechanisms. Other eukaryotes regulate ORC function through modification of
Orcl or Orc2 (Romanowski et al. 2000; Okuno et al. 2001; Vas et al. 2001; Mendez et al.
2002; Sun et al. 2002; Araki et al. 2003; Li et al. 2003). Despite regulating different ORC
subunits, the model proposed in this thesis could be conserved among all eukaryotes.
Data from S. pombe, Drosophilaand Xenopus have shown that ORC subunits interact
with CDK (Romanowski et al. 2000; Wuarin et al. 2002; Remus et al. 2005) and, in the
case of S. pombe, this interaction is important for preventing re-replication. Data from
mammalians indicate that Orcl is regulated such that it is removed from DNA. These
results, however, do not preclude our model of CDK interacting with ORC to prevent rereplication. Although Orc is removed from the DNA, the other ORC subunits remain
157
associated. Therefore, mammalian Orc2-6 might interact with CDK to block pre-RC
formation. Further experiments in S. cerevisiae using the pre-RC assembly assay should
lead to a more refined model that could then be tested in metazoa to determine how well
conserved this model is throughout the eukaryotic kingdom.
158
References
Abdurashidova, G., Riva, S., Biamonti, G., Giacca, M., and Falaschi, A. 1998. Cell cycle
modulation of protein-DNA interactions at a human replication origin. Embo J
17(10): 2961-2969.
Aparicio, J.G., Viggiani, C.J., Gibson, D.G., and Aparicio, O.M. 2004. The Rpd3-Sin3
histone deacetylase regulates replication timing and enables intra-S origin control
in Saccharomyces cerevisiae.Mol Cell Biol 24(11): 4769-4780.
Araki, M., Wharton, R.P., Tang, Z., Yu, H., and Asano, M. 2003. Degradation of origin
recognition complex large subunit by the anaphase-promoting complex in
Drosophila.Embo J 22(22): 6115-6126.
Bishop, A.C., Ubersax, J.A., Petsch, D.T., Matheos, D.P., Gray, N.S., Blethrow, J.,
Shimizu, E., Tsien, J.Z., Schultz, P.G., Rose, M.D., Wood, J.L., Morgan, D.O.,
and Shokat, K.M. 2000. A chemical switch for inhibitor-sensitive alleles of any
protein kinase. Nature 407(6802): 395-401.
Blow, J.J. and Dutta, A. 2005. Preventing re-replication of chromosomal DNA. Nat Rev
Mol Cell Biol 6(6): 476-486.
Coverley, D., Wilkinson, H.R., Madine, M.A., Mills, A.D., and Laskey, R.A. 1998.
Protein kinase inhibition in G2 causes mammalian Mcm proteins to reassociate
with chromatin and restores ability to replicate. Exp Cell Res 238(1): 63-69.
Dahmann, C., Diffley, J.F., and Nasmyth, K.A. 1995. S-phase-promoting cyclindependent kinases prevent re-replication by inhibiting the transition of replication
origins to a pre-replicative state. Curr Biol 5(11): 1257-1269.
Diffley, J.F., Cocker, J.H., Dowell, S.J., and Rowley, A. 1994. Two steps in the assembly
of complexes at yeast replication origins in vivo. Cell 78(2): 303-316.
Friedman, K.L., Diller, J.D., Ferguson, B.M., Nyland, S.V., Brewer, B.J., and Fangman,
W.L. 1996. Multiple determinants controlling activation of yeast replication
origins late in S phase. Genes Dev 10(13): 1595-1607.
Geissenhoner, A., Weise, C., and Ehrenhofer-Murray, A.E. 2004. Dependence of ORC
silencing function on NatA-mediated Nalpha acetylation in Saccharomyces
cerevisiae.Mol Cell Biol 24(23): 10300-10312.
Grunstein, M. 1998. Yeast heterochromatin: regulation of its assembly and inheritance by
histones. Cell 93(3): 325-328.
Hayles, J., Fisher, D., Woollard, A., and Nurse, P. 1994. Temporal order of S phase and
mitosis in fission yeast is determined by the state of the p34cdc2-mitotic B cyclin
complex. Cell 78(5): 813-822.
159
Li, X., Zhao, Q., Liao, R., Sun, P., and Wu, X. 2003. The SCF(Skp2) ubiquitin ligase
complex interacts with the human replication licensing factor Cdtl and regulates
Cdtl degradation. J Biol Chem 278(33): 30854-30858.
MacAlpine, D.M. and Bell, S.P. 2005. A genomic view of eukaryotic DNA replication.
Chromosome Res 13(3): 309-326.
Masumoto, HI., Muramatsu, S., Kamimura, Y., and Araki, H. 2002. S-Cdk-dependent
phosphorylation of Sld2 essential for chromosomal DNA replication in budding
yeast. Nature 415(6872): 651-655.
Mendez, J., Zou-Yang, X.H., Kim, S.Y., Hidaka, M., Tansey, W.P., and Stillman, B.
2002. Human origin recognition complex large subunit is degraded by ubiquitinmediated proteolysis after initiation of DNA replication. Mol Cell 9(3): 481-491.
Nguyen, V.Q., Co, C., and Li, J.J. 2001. Cyclin-dependent kinases prevent DNA rereplication through multiple mechanisms. Nature 411(6841): 1068-1073.
Okuno, Y., McNairn, A.J., den Elzen, N., Pines, J., and Gilbert, D.M. 2001. Stability,
chromatin association and functional activity of mammalian pre-replication
complex proteins during the cell cycle. Embo J 20(15): 4263-4277.
Remus, D., Blanchette, M., Rio, D.C., and Botchan, M.R. 2005. CDK phosphorylation
inhibits the DNA-binding and ATP-hydrolysis activities of the Drosophilaorigin
recognition complex. J Biol Chem 280(48): 39740-39751.
Romanowski, P., Marr, J., Madine, M.A., Rowles, A., Blow, J.J., Gautier, J., and Laskey,
R.A. 2000. Interaction of Xenopus Cdc2 x cyclin Al with the origin recognition
complex. J Biol Chem 275(6): 4239-4243.
Rusche, L.N., Kirchmaier, A.L., and Rine, J. 2003. The establishment, inheritance, and
function of silenced chromatin in Saccharomyces cerevisiae. Annu Rev Biochem
72: 481-516.
Stoeber, K., Tlsty, T.D., Happerfield, L., Thomas, G.A., Romanov, S., Bobrow, L.,
Williams, E.D., and Williams, G.H. 2001. DNA replication licensing and human
cell proliferation. J Cell Sci 114(Pt 11): 2027-2041.
Su, T.T. and CO'Farrell, P.H. 1997. Chromosome association of minichromosome
maintenance proteins in Drosophilamitotic cycles. J Cell Biol 139(1): 13-21.
Sun, W.H., Coleman, T.R., and DePamphilis, M.L. 2002. Cell cycle-dependent regulation
of the association between origin recognition proteins and somatic cell chromatin.
Embo J 21(6): 1437-1446.
Sutton, A., Heller, R.C., Landry, J., Choy, J.S., Sirko, A., and Sternglanz, R. 2001. A
novel form of transcriptional silencing by Suml-1 requires Hstl and the origin
recognition complex. Mol Cell Biol 21(10): 3514-3522.
160
Ubersax, J.A., Woodbury, E.L., Quang, P.N., Paraz, M., Blethrow, J.D., Shah, K.,
Shokat, K.M., and Morgan, D.O. 2003. Targets of the cyclin-dependent kinase
Cdkl. Nature 425(6960): 859-864.
Vas, A., Mok, W., and Leatherwood, J. 2001. Control of DNA rereplication via Cdc2
phosphorylation sites in the origin recognition complex. Mol Cell Biol 21(17):
5767-5777.
Vogelauer, M., Rubbi, L., Lucas, I., Brewer, B.J., and Grunstein, M. 2002. Histone
acetylation regulates the time of replication origin firing. Mol Cell 10(5): 12231233.
Wuarin, J., Buck, V., Nurse, P., and Millar, J.B. 2002. Stable association of mitotic cyclin
B/Cdc2 to replication origins prevents endoreduplication. Cell 111(3): 419-431.
Wyrick, J.J., Aparicio, J.G., Chen, T., Barnett, J.D., Jennings, E.G., Young, R.A., Bell,
S.P., and Aparicio, O.M. 2001. Genome-wide distribution of ORC and MCM
proteins in S. cerevisiae: high-resolution mapping of replication origins. Science
294(5550): 2357-2360.
Zappulla, D.C., Sternglanz, R., and Leatherwood, J. 2002. Control of replication timing
by a transcriptional silencer. Curr Biol 12(11): 869-875.
161