Gene Primers
advertisement
Supplementary Table 1. Primers used for RT-PCR Primers Gene OsRNS1 OsRNS2 OsRNS3 OsRNS4 OsRNS5 OsRNS6 OsRNS7 OsRNS8 RNase Phy2 RNase LER Forward GAATTCGACTTCTTCTACCTC GCTCATCCTCTTCCACTTGC CGCAGGACTACGACTTCTT GGCTTACTTGCGACTTCAGG GCTCTGCTCTGCCTTCTTG CCGCTCAAATTCTTCACGAT GTCGTGTTCTCCCTTGTG TGCCCAGCAGTGGCCTGAC GAGGCATCATTTCATCCA GAGGCATCATTTCATCCA Reverse CAGCTGTTCCAGGTGTACCA ACCACCACTTGCCAACATTT ATCTGGGACAGCGTGTAG AAGGATTGTCGGAGTTGC ACAGGGAAGAGTTGGTGGTG GAAAGAGCCGCAGTACAAGG CCGAGCGTGTAGGTCTTC ATATTGATCGTGTGGCA GGCAAGCTGACGTACTGA GGCAAGCTGACGTACTGA Supplementary Table 2. List of proteins used for phylogenetic analyses Name Species Common name AcRNS1 AhSL28 CalsepRRP CarRNS1 CrRNS GAR-RNase GmaRNS1 GmaRNS10 GmaRNS11 GmaRNS12 GmaRNS2 GmaRNS3 GmaRNS4 GmaRNS5 GmaRNS6 GmaRNS7 GmaRNS8 GmaRNS9 HvuRNS1 HvuRNS3 HvuRNS4 MpRNS Adiantum capillus-veneris Antirrhinum hispanicum Calystegia sepium Cicer arietinum Chlamydomonas reinhardtii Hordeum vulgare Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Glycine max Hordeum vulgare Hordeum vulgare Hordeum vulgare Marchantia polymorpha maidenhair fern Spanish Snapdragon hedge bindweed chickpea green alga domesticated barley soybean soybean soybean soybean soybean soybean soybean soybean soybean soybean soybean soybean domesticated barley domesticated barley domesticated barley OsRNS1 Oryza sativa rice OsRNS2 Oryza sativa rice OsRNS3 Oryza sativa rice OsRNS4 Oryza sativa rice OsRNS5 Oryza sativa rice OsRNS6 Oryza sativa rice OsRNS7 Oryza sativa rice OsRNS8 OtRNS PglRNS1 Oryza sativa Ostreococcus tauri Picea glauca rice green alga white spruce PglRNS2 PglRNS3 PpRNS1 PpRNS3 PtrRNS1 PtrRNS2 PtrRNS3 PtrRNS4 PtrRNS5 Picea glauca Picea glauca Physcomitrella patens Physcomitrella patens Populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa white spruce white spruce moss moss Black cottonwood Black cottonwood Black cottonwood Black cottonwood Black cottonwood RNase Bm2 RNase FE1 RNase NGR2 RNase NGR3 RNaseDA-I RNaseLC1 RNaseLC2 RNaseLE RNaseLER RNaseLX Bryopsis maxima Fagopyrum esculentum Nicotiana glutinosa Nicotiana glutinosa Drosera adelae Luffa aegyptiaca Luffa aegyptiaca Solanum lycopersicum Solanum lycopersicum Solanum lycopersicum green alga common buckwheat tobacco tobacco lance-leaved sundew smooth loofah smooth loofah tomato tomato tomato Genome locus Accesion number DK956820 CAC50874 AAF45022 CAA10130 XP_001691379 AAB58718 Glyma02g12010 Glyma01g05840 Glyma01g05850 Glyma03g35230 Glyma16g03120 Glyma02g07150 Glyma02g07140 Glyma02g07130 Glyma07g06520 Glyma02g12020 Glyma20g04820 Glyma20g04830 liverwort Os07g0630400 LOC_Os07g43670 Os01g0897200 LOC_Os01g67180 Os08g0434100 LOC_Os08g33710 Os09g0537700 LOC_Os09g36680 Os09g0538000 LOC_Os09g36700 Os01g0897300 LOC_Os01g67190 Os07g0629300 LOC_Os07g43600 Os07g0629900 LOC_Os07g43640 AAB58719 AAM80567 AAF45043 BJ859209 BAF22270 BAF07000 BAF23791 BAF25707 BAF25708 BAF07001 BAC20676 BAC20680 CAL54360 EX440507 EX387106 EX322444 jgi|Phypa1_1|126361|e_gw1.59.205.1 jgi|Phypa1_1|152231|e_gw1.358.41.1 XP_002311303 XP_002321228 XP_002316136 XP_002311302 EEE95823 BAE06157 BAF03591 BAC77612 BAC77611 BAE16663 BAA10891 BAA10892 P80022 CAL64053 P80196 RNaseMC RNaseNE Momordica charantia Nicotiana alata balsam pear Persian tobacco P23540 AAA21135 RNaseNW RNasePD1 RNasePD2 RNS1 RNS2 RNS3 RNS4 RNS5 SbRNS1 SbRNS2 Nicotiana glutinosa Prunus dulcis Prunus dulcis Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Sorghum bicolor Sorghum bicolor tobacco almond almond thale cress thale cress thale cress thale cress thale cress Sorghum Sorghum AT2G02990 AT2G39780 AT1G26820 AT1G14210 AT1G14220 Sb02g031160 Sb03g042630 BAC77613 AAG09465 AAF82615 P42813 SbRNS3 SbRNS4 SbRNS5 SbRNS6 Sorghum bicolor Sorghum bicolor Sorghum bicolor Sorghum bicolor Sorghum Sorghum Sorghum Sorghum Sb02g031170 Sb02g040170 Sb02g040180 Sb07g021330 SmRNS1 SmRNS3 TaeRNS1 TaeRNS3 TaeRNS4 trichomaglin VRN1 ZmaRNS1 ZmaRNS2 ZRNaseI ZRNaseII Selaginella moellendorffii Selaginella moellendorffii Triticum aestivum Triticum aestivum Triticum aestivum Trichosanthes lepiniana Volvox carteri f. nagariensis Zea mays Zea mays Zinnia violacea Zinnia violacea spikemoss spikemoss bread wheat bread wheat bread wheat Maganlin green alga maize maize elegant zinnia elegant zinnia NP_030524 NP_564264 NP_563940 NP_563941 jgi|Selmo1|75785|e_gw1.0.2678.1 jgi|Selmo1|270532|estExt_fgenesh1_kg.C_60029 AAS01727 AAS07016 AAM18521 1SGL_A BAA95359 AAB37265 ACG36234 AAC49325 AAC49326 Supplementary Table 3. Size and isoelectric point of predicted mature proteins belonging to the plant RNase T2 family Group Name green algae CrRNS #aa 208 5.32 VRN1 236 4.8 RNase Bm2 214 5.07 OtRNS 271 5.65 #aa Class II 209 5.56 PglRNS2 259 6.21 RNS2 240 5.82 PtrRNS2 250 5.06 RNaseLER 237 6.8 RNase NGR2 247 6.26 GmaRNS6 244 6.91 GmaRNS2 242 6.28 AhSL28 248 5.67 CalsepRRP 230 4.76 OsRNS2 261 6.47 OsRNS6 247 8.59 SbRNS2 256 5.69 ZmaRNS2 258 5.7 pI GmaRNS12 193 RNaseLC1 191 9.2 RNaseLC2 190 8.64 RNaseMC 191 9.36 8.73 PtrRNS5 234 9.03 GmaRNS3 212 6.34 GmaRNS4 212 6.97 GmaRNS5 212 6.97 #aa Class I, Monocot inactive pI trichomaglin #aa Class III, putative proto-S-RNases pI pI SbRNS1 228 8.27 OsRNS4 231 5.07 OsRNS5 234 7.61 HvuRNS3 222 6.28 HvuRNS4 231 8.61 TaeRNS4 222 6.06 SbRNS3 235 7.58 ZmaRNS1 242 8.83 pI average pI st dev 5.21 0.36 pI average pI st dev 6.13 0.93 pI average pI st dev 8.16 1.19 pI average pI st dev 7.29 1.35 Class I, canonical SmRNS1 #aa pI 186 5.14 AcRNS1 188 4.37 RNasePD2 203 4.59 ZRNaseII 203 4.9 PtrRNS3 203 4.83 PtrRNS4 203 5.08 RNaseNE 203 4.69 RNaseNW 203 4.71 RNS3 203 5.56 RNasePD1 203 4.74 GmaRNS11 203 4.77 GmaRNS7 203 5.05 RNase FE1 203 4.49 PglRNS3 203 4.55 TaeRNS1 204 4.87 HvuRNS1 203 4.87 PtrRNS1 204 4.67 RNS5 204 4.77 SbRNS6 204 4.99 GmaRNS8 204 5.23 GmaRNS1 204 4.32 GmaRNS10 204 4.49 RNaseDA-I 205 4.35 RNaseLE 205 4.57 OsRNS3 205 4.78 CarRNS1 206 4.66 RNS1 208 4.97 TaeRNS3 210 5.63 RNaseLX 212 5.17 RNase NGR3 212 4.84 OsRNS7 213 5.15 GmaRNS9 215 6.1 SmRNS3 217 5.01 ZRNaseI 219 5.23 GAR-RNase 220 5.09 PglRNS1 226 5.33 RNS4 228 5.67 SbRNS4 232 5.84 PpRNS1 233 5.48 OsRNS1 236 5.39 OsRNS8 236 6.18 PpRNS3 247 4.49 SbRNS5 210 8.66 pI average pI st dev 4.99 0.46 pI average pI st dev 4.78 0.28 5.58 0.93 Note: signal peptides were predicted using SignalP software. Amino acid number (aa#) and pI were calculated for the protein without the signal peptide. Average pI was calculated for each Class of RNase, and also for the monocot-specific clade. Two types of canonical Class I S-like RNases were determined based on size and pI, and are indicated with blue and red shading. A Class I RNase with unusually high pI is indicated with yellow. Supplementary Table 4. Data on stress- and tissue-specific expression of Class I S-like RNases obtained from literature and microarray data Phosphate starvation 1 4 RNase LE 5 RNase LX 6 RNase PD2 7 WRN2 7 WRN3 1 RNase NW 1 OsRNS3 1 OsRNS4 1 OsRNS5 RNase NGR1 3 Hormones 1 OsRNS4 1 OsRNS5 8 RNS1 2 RNase NE Pests 1 OsRNS5 1 OsRNS7 1 OsRNS8 RNS1 Wounding 9 10 11 ZRNase II 20 RNase LE OsRNS3 14 GAR-RNase 12 RNase NE RNase NGR3 13, 21 Other abiotic 1 OsRNS1 1 OsRNS3 1 OsRNS4 OsRNS5 9 RNS1 18,19 GmaRNS8 RNS1 15 1 Tissuespecific 1 OsRNS1 1 OsRNS5 1 OsRNS7 16 HvuRNS4 (RSH1) 17 TaeRNS4 (WNR1) 11 ZRNase I 2 RNS3 15 RNS4 15 RNS5 Microarray data, see Table 2, main text. Bariola, P.A., Howard, C.J., Taylor, C.B., Verburg, M.T., Jaglan, V.D. and Green, P.J. (1994) The Arabidopsis ribonuclease gene RNS1 is tightly controlled in response to phosphate limitation. Plant J, 6: 673-685. 3 Dodds, P.N., Clarke, A.E. and Newbigin, E. (1996) Molecular characterisation of an S-like RNase of Nicotiana alata that is induced by phosphate starvation. Plant Mol Biol, 31: 227-238. 4 Jost, W., Bak, H., Glund, K., Terpstra, P. and Beintema, J.J. (1991) Amino acid sequence of an extracellular, phosphate-starvation-induced ribonuclease from cultured tomato (Lycopersicon esculentum) cells. Eur J Biochem, 198: 1-6. 5 Löffler, A., Glund, K. and Irie, M. (1993) Amino acid sequence of an intracellular, phosphate-starvationinduced ribonuclease from cultured tomato (Lycopersicon esculentum) cells. Eur J Biochem, 214, 627-633. 6 Ma, R.C. and Oliveira, M.M. (2000) The RNase PD2 gene of almond (Prunus dulcis) represents an evolutionarily distinct class of S-like RNase genes. Mol Gen Genet, 263: 925-933. 7 Chang,S.-H., Shu H.-Y., Tong Y.-P., Li B. and Li Z.-S. (2005) Expressions of three wheat S-like RNase genes were differentially regulated by phosphate starvation. Acta Agronomica Sinica, 31: 11151119. 8 LeBrasseur, N.D., MacIntosh, G.C., Perez-Amador, M.A., Saitoh, M. and Green, P.J. (2002) Local and systemic wound-induction of RNase and nuclease activities in Arabidopsis: RNS1 as a marker for a JA-independent systemic signaling pathway. Plant J, 29: 393-403. 9 Hayashi, T., Kobayashi, D., Kariu, T., Tahara, M., Hada, K., Kouzuma, Y. and Kimura, M. (2003) Genomic cloning of ribonucleases in Nicotiana glutinosa leaves, as induced in response to wounding or to TMV-infection, and characterization of their promoters. Biosci Biotechnol Biochem, 67: 2574-2583. 10 Kariu, T., Sano, K., Shimokawa, H., Itoh, R., Yamasaki, N. and Kimura, M. (1998) Isolation and characterization of a wound-inducible ribonuclease from Nicotiana glutinosa leaves. Biosci Biotech Bioch, 62: 1144-1151. 11 Ye, Z.H. and Droste, D.L. (1996) Isolation and characterization of cDNAs encoding xylogenesisassociated and wounding-induced ribonucleases in Zinnia elegans. Plant Mol Biol, 30: 697-709. 12 Galiana, E., Bonnet, P., Conrod, S., Keller, H., Panabieres, F., Ponchet, M., Poupet, A. and Ricci, P. (1997) RNase activity prevents the growth of a fungal pathogen in tobacco leaves and increases upon induction of systemic acquired resistance with elicitin. Plant Physiology, 115: 1557-1567. 13 De Vos, M. and Jander, G. (2009) Myzus persicae (green peach aphid) salivary components induce defence responses in Arabidopsis thaliana. Plant, Cell & Environment, 32: 1548-1560. 2 14 Rogers, S.W. and Rogers, J.C. (1999) Cloning and characterization of a gibberellin-induced RNase expressed in barley aleurone cells. Plant Physiology, 119: 1457-1464. 15 MacIntosh, G.C. and Hillwig, M.S., unpublished. 16 Gausing, K. (2000) A barley gene (rsh1) encoding a ribonuclease S-like homologue specifically expressed in young light-grown leaves. Planta, 210: 574-579. 17 Chang, S.H., Ying, H., Zhang, J.J., Su, J.Y., Zeng, Y.J., Tong, Y.P., Li, B. and Li, Z.S. (2003) Expression of a wheat S-like RNase (WRN1) cDNA during natural- and dark-induced senescence. Acta Bot Sin, 45, 1071-1075. 18 Microarray data from: Ithal, N., Recknor, J., Nettleton, D., Maier, T., Baum, T. J., and Mitchum, M. G. (2007) Developmental transcript profiling of cyst nematode feeding cells in soybean roots. Mol Plant Microbe Interact 20: 510-525. 19 Studham, M. and MacIntosh, G.C., unpublished. 20 Gross, N., Wasternack, C. and Kock, M. (2004) Wound-induced RNaseLE expression is jasmonate and systemin independent and occurs only locally in tomato (Lycopersicon esculentum cv. Lukullus). Phytochemistry, 65: 1343-1350. 21 Bodenhausen, N. and Reymond, P. (2007) Signaling pathways controlling induced resistance to insect herbivores in Arabidopsis. Mol Plant Microbe In, 20: 1406-1420.
