Insect. Soc. (2011) 58:581–585
DOI 10.1007/s00040-011-0164-z
Insectes Sociaux
TECHNICAL ARTICLE
Development of new microsatellite loci for the genus Polistes
from publicly available expressed sequence tag sequences
M. T. Henshaw • A. L. Toth • T. J. Young
Received: 21 January 2011 / Revised: 11 April 2011 / Accepted: 13 April 2011 / Published online: 24 April 2011
Ó International Union for the Study of Social Insects (IUSSI) 2011
Abstract Over the last 20 years, microsatellites have
revolutionized the study of cooperation in the social insects.
The Polistes paper wasps have been an important model
system for investigations of cooperative behavior. Recently,
an expressed sequence tag (EST) library has been developed
for P. metricus, allowing researchers to investigate the
genetic basis of cooperative behavior in primitive social
insect societies for the first time. We searched these freely
available EST sequences for microsatellite motifs. This
represents a relatively new approach to the development of
microsatellite loci that allows for the development of a
greater number of loci at less expense. We designed 32 PCR
primer pairs, of which 23 amplified PCR products and 18
were polymorphic. These loci exhibited high levels of polymorphism, comparable to anonymous loci isolated via screens
of partial genomic libraries. Thus, they are appropriate for
population genetic studies as well as the reconstruction of
colony genetic structure. A screen of the entire EST database
found a total of 708 di-, tri-, tetra- and penta-nucleotide repeats
with large repeat units typical of polymorphic loci and at least
30 bp of flanking sequence for primer design. This pool of
potential loci represents a new genetic tool for P. metricus, as
well as Polistes more generally, as there is great promise for
cross amplification in other species.
Electronic supplementary material The online version of this
article (doi:10.1007/s00040-011-0164-z) contains supplementary
material, which is available to authorized users.
M. T. Henshaw (&) T. J. Young
Department of Biology, Grand Valley State University, 1 Campus
Dr., Allendale, MI 49401, USA
e-mail: henshawm@gvsu.edu
A. L. Toth
Department of Ecology, Evolution, and Organismal Biology,
Iowa State University, 253 Bessey Hall, Ames, IA 50014, USA
Keywords Polistes metricus Vespidae Polistinae EST-SSR Microsatellite loci
Introduction
Polistes paper wasps are a prominent model system for
investigations of the evolution of cooperation in primitively
eusocial societies (Reeve, 1991). Polistes wasps work cooperatively to build paper nests in which to rear brood, and
the first females to mature each season typically become
workers, caring for the offspring of the queen and defending
the nest (Reeve, 1991). However, reproductive roles are
more flexible in Polistes than in more advanced eusocial
groups, such as ants or honeybees, and the workers are
capable of reproduction should opportunities arise (Arevalo
et al., 1998; Tibbetts, 2007). Thus, Polistes wasps are an
ideal system in which to investigate the relationships
between relatedness, conflict, and cooperation in societies
where individuals who could reproduce independently
choose to altruistically cooperate instead.
Polistes metricus is a common paper wasp found
throughout the eastern United States. It occurs as far north
as Michigan, east and south to the Atlantic and gulf coasts
respectively, and west to the Great Plains (Carpenter, 1996).
This is an expansive range encompassing a wide variety of
ecological contexts, and its wide distribution, as well as the
diversity of habitats it occupies, makes P. metricus an
interesting target for population genetic studies because of
the potential for genetic differentiation associated with
isolation by distance, or with distinct habitats or barriers.
Studies characterizing patterns of genetic variation have
become even more important because new genomic
resources have recently been developed for P. metricus,
including an EST (expressed sequence tag) library and a
123
582
microarray (Toth et al., 2007; Toth et al., 2010). As a result,
P. metricus has emerged as an important model system for
studies of the genetic basis of social behavior in primitively
eusocial societies. However, these studies have been conducted at widely distributed sites (Hunt et al., 2007; Hunt
et al., 2010; Toth et al., 2010), and it is important that we
characterize genetic differences and similarities between
populations so that the results of these studies can be
compared.
We have developed new polymorphic microsatellite loci
for P. metricus, the first microsatellites developed in this
species. Microsatellites can be used to estimate relatedness
and to determine which individuals are reproductively
active, allowing researchers to characterize queen number,
mating frequency, and to determine the relative fitness
consequences of cooperation and selfishness in these
cooperative societies (Queller et al., 1993). Microsatellites
are also commonly used to characterize genetic differences
within populations. Thus, these loci represent a new genetic
tool which can be used to characterize both colony-level and
population genetic structure in P. metricus.
We have identified new loci by searching publicly
available EST sequence data for P. metricus. This relatively
new approach to the development of microsatellite loci
identifies more loci with fewer costs than previous
approaches which require the construction of partial genomic libraries, enrichment for microsatellite repeats and
sequencing of genomic fragments (reviewed in Ellis and
Burke, 2007). As large-scale sequence databases become
available for a broader array of species, especially species
that are not classic genetic model systems, this approach
will become increasingly important.
Methods
We identified microsatellite repeats within a previously
developed P. metricus EST library (Toth et al., 2010; Toth
et al., 2007), available from the NCBI Trace archive. We
performed BLAST searches of assembled contigs in the
‘‘Old Polistes brain/abdomen contigs’’ database at http://
stan.cropsci.uiuc.edu/454/blast/waspblast.html for the following sequences: (AAC)5, (AAG)5, (AAT)5, (ACC)5,
(CAG)5, (GAC)5, (CAT)5, (CCG)5. We retrieved 32 consensus sequences containing repeats (contigs can be downloaded from: ftp://stan.cropsci.uiuc.edu/download/Polistes/),
and designed primers using the web-based program Web
Primer (http://www.yeastgenome.org/cgi-bin/web-primer).
We genotyped a total of eight P. metricus females collected from widely separated sites in the US states of
Arkansas, Georgia, Ohio, Missouri, Tennessee, Texas and
West Virginia. Genomic DNA was extracted from half a
thorax from each wasp using a salt precipitation protocol
123
M. T. Henshaw et al.
(Miller et al., 1988; Strassmann et al., 1996), and PCR
products were amplified in 10 ll reactions (Final concentrations: 19 Colorless GoTaq reaction buffer with 1.5 mM
MgCl2, 0.25 mM dNTP mix, 0.1 lM forward and reverse
primers, 0.1 lM M13 primer labeled with TET, HEX or
FAM, 0.35 units GoTaq DNA polymerase, unquantified
diluted genomic DNA) with an annealing temperature of
50°C for all amplifications. Fragments were visualized at
the University of Illinois Core Sequencing Facility on an
ABI Prism 3730xl DNA analyzer and the sizes of fragments
were scored using the computer program Peak Scanner
(Applied Biosystems). The numbers of alleles (A), allele
sizes, observed heterozygosities (Ho), expected heterozygosities (He), and tests for disequilibrium were calculated
using the computer program GDA 1.1 (Lewis and Zaykin,
2001).
Because these loci were isolated from an EST library,
they are located within transcribed regions and are inherited
as a unit with functionally important loci. As a result, they
might be expected to exhibit unique characteristics due to
the effects of selection. We compared the EST-derived loci
isolated in this study to 19 anonymous loci which were
previously isolated from the related species Polistes dominulus (Henshaw, 2000). Anonymous loci are isolated via
probes of genomic libraries, and are unlikely to be closely
linked to transcribed, functionally important regions. All
statistical comparisons were performed using PASW 18
(SPSS, Inc.).
To determine the potential for the development of additional loci from P. metricus EST sequences, we downloaded
the entire EST database and searched for microsatellite
repeats using the Tandem Repeats Finder algorithm (v. 4.0.4)
in the Tandem Repeats Database (Yevgeniy et al., 2006).
We used the default parameter settings (match, mismatch,
indels = 2,7,7; minimum alignment score = 50) and eliminated redundant repeats with the Redundancy Elimination
tool (90% overlap, prefer smaller unit sizes). We eliminated
repeats with motif sizes \2 or [5 to retain only the motif
sizes most commonly used when developing microsatellites.
Finally, we only retained repeats with at least 30 bp of
flanking sequence for primer design.
Results
Of the 32 primer pairs designed, 23 pairs successfully
amplified products and 18 were polymorphic. Polymorphic
loci exhibited from 2 to 8 alleles with expected heterozygosities ranging from 0.125 to 0.875 (Table 1). All
polymorphic loci were in Hardy–Weinberg equilibrium
(Table 1). While the range of heterozygosities was similar
to that observed in the anonymous P. dominulus loci, the
mean expected heterozygosity of 0.47 (polymorphic loci
Development of new microsatellite loci
583
Table 1 Summary of the characteristics of 18 polymorphic microsatellite loci developed from EST sequences in Polistes metricus
Locus
Sequenced repeat
A (size range, bp)
Ho
He
HWE p value
Pmet40472
(TTG)9
4 (166–175)
0.429
0.396
1.000
Primer sequences (50 ?30 )
F:TACTTGGCCTCTTCCCCAGTT
R:TTGGAGACTTATTTTCCACCC
Pmet41635
(TTG)7
6 (209–224)
0.500
0.542
0.605
Pmet42388
(GCT)5
2 (144–147)
0.000
0.233
0.067
F:TGTATTTGCCTAGGTTGCGA
R:ATAGGAGGTAACCGTCCTGCA
F:AACGACCCCCTTGAATGATT
R:ACCTCGACGTCAACGTTGC
Pmet42482
(TTG)9
3 (230–230)
0.125
0.342
0.065
F:TTATCCCCCCTCATCACCA
R:AAACACCACCAGGACATTCTT
Pmet43733
(GTC)6
2 (159–162)
0.125
0.125
1.000
Pmet43777
(ACC)5
2 (125–128)
0.125
0.125
1.000
Pmet44190
(TTG)6
2 (206–209)
0.250
0.233
1.000
F:TTTCGGTGTGTGCGACTACG
R:ATGCAAAATGGTACTGCGGA
F:GGCGAGTGTCAACACCTTTTT
R:ATTCGCGAAAGAAATTAGGG
F:TGTCCTGCGATAGAGGTCTTT
R:TCGGGATAATGAAATTCTCGT
Pmet44592
(AAG)10
4 (135–144)
0.750
0.692
0.283
F:TTGATCGATCGAGGAGACCAT
R:CGACTAACATTCGAAGGAACA
Pmet45195
(TTG)10
4 (217–226)
0.750
0.750
0.780
F:TGCTGCTTTATCGTATTTGGA
R:GGACAGATGATGGCTCAAAA
Pmet45548
(CCG)6
5 (131–143)
0.750
0.817
0.296
Pmet45730
(AAT)8
2 (146–149)
0.000
0.233
0.067
F:TCTTTTCGGCTTCCTCTTGT
R:CGAAGGGACTTAGGAAAGTTG
F:CGGATGGAATTCAAGTTCTCG
R:CACACGCACATACCTTTACGA
Pmet46215
(TTG)7
2 (222–228)
0.143
0.143
1.000
F:TTGTTCCAATCTCCATTCTTC
R:TTCGAGGTCGAGATCAAAACA
Pmet46480
(GTC)7
5 (146–174)
0.375
0.450
0.380
Pmet46483
(AAG)7
3 (111–117)
0.375
0.342
1.000
Pmet46588
(GAC)11
8 (186–216)
1.000
0.875
0.923
F:TCTCGTCATCTTCGTTATGCT
R:TTTCACCACCACCACTACCA
F:TCCGAACAACTTGTCCCACA
R:AAGAAGAATTCGGTGATGACG
F:CTATATCGTCATTTGCGTTGG
R:ATTTGATGAACGCACAGGAG
Pmet46597
(CAT)10
5 (156–177)
0.625
0.750
0.318
F:CTCATTGATTCGTTTGTGGCA
R:TTTCGCTATGTTCTCTGATGA
Pmet46789
(CAT)11
4 (235–244)
0.750
0.642
0.383
F:CAGCGATTTTCGCTTATTCTT
R:CGATCAACGAAATATTTGGGG
Pmet46823
(AAT)9
5 (130–143)
0.714
0.725
0.356
F:ATTTTGCTTTGCCCACCCTT
R:TCGGATGTGCAATTGAACGA
The locus name contains the contig number in the EST database
only) was significantly lower than the mean of 0.68
observed in the anonymous loci (unequal variances t test,
t = 2.825, p = 0.009).
We observed a positive relationship between the number
of uninterrupted repeats and the expected heterozygosity at
P. metricus loci (Fig. 1; He = 0.114 9 Repeats - 0.474,
R2 = 0.60, p \ 0.001) and this relationship was not significantly different (t = 1.863, p = 0.07) from that observed
in the anonymous loci isolated from P. dominulus (Fig. 1;
He = 0.082 9 Repeats - 0.230, R2 = 0.45, p = 0.002).
While similar numbers of the EST-derived loci and the
anonymous loci were monomorphic (5/23 vs. 7/19; Fisher’s
exact test, p = 0.3227), a greater proportion of the polymorphic EST-derived loci exhibited low expected heterozygosities between 0.0 and 0.4 (9/18 vs. 0/12; Fisher’s exact
test, p = 0.004).
123
584
M. T. Henshaw et al.
Fig. 2 The distributions of the number of perfect repeats for 708 di-,
tri-, tetra- and penta-nucleotide microsatellite loci identified in the P.
metricus EST sequences
Fig. 1 The relationship between the expected heterozygosity and the
number of uninterrupted repeats in the sequenced allele for each of 23
newly developed P. metricus EST-linked microsatellite loci (closed
circles) as well as previously published P. dominulus anonymous loci
(open circles) (Henshaw, 2000). Regression lines are shown for P.
metricus (solid line) and P. dominulus (dashed line)
We found a total of 5,307 repeats in the EST database and
2,507 of these repeats had motif sizes between 2 and 5 bp.
These microsatellite repeats were located in 2,422 unique
contigs and 708 of them had at least 30 bp of flanking
sequence in which to design primers. Of these, 91, 368, 161
and 88 were di-, tri-, tetra- and penta-nucleotide repeats,
respectively. The 708 repeats we isolated exhibited high
numbers of repeats, characteristic of polymorphic loci
(Fig. 2).
Discussion
Despite being linked to transcribed regions, the loci developed from the P. metricus EST database exhibited high
levels of polymorphism appropriate for studies of population genetic structure, as well as colony-level structure
including the estimation of relatedness, sex determination,
and parentage assignment. While the mean expected heterozygosity was lower than that observed in loci that were
not isolated from EST sequences, the range of expected
heterozygosities did not differ, and one could easily obtain
loci exhibiting similar levels of polymorphism.
Selective constraints might be expected to limit the
number of polymorphic loci near transcribed regions,
however, the EST-linked loci did not exhibit a greater
123
number of monomorphic loci than the anonymous loci
isolated from a partial genomic library. All of the loci
screened for this study were trinucleotide repeats, and
selection may operate differently on other motif sizes due to
frameshifts (Ellis and Burke, 2007). We found four times as
many trinucleotide repeats (368 loci) as dinucleotide repeats
(91 loci), suggesting that selection may constrain expansion
at dinucleotide repeats to a greater extent.
Though the loci isolated from EST sequences are not
generally monomorphic at higher rates than the anonymous
loci, they do more frequently exhibit low levels of polymorphism. Some of the EST-derived loci appear to be
unconstrained, with many alleles, and high levels of polymorphism. However, other EST-derived loci with low
levels of polymorphism might experience more constraints
on expansion. While some variation might be acceptable at
these loci, large expansions might be selected against (Batra
et al., 2010; Ranum and Day, 2002), maintaining them at
low levels of polymorphism. In contrast, the anonymous
loci are either highly polymorphic or monomorphic. It
seems that once the anonymous repeats begin to expand,
there is little to prevent them from expanding further and
quickly becoming highly polymorphic.
With a pool of more than 700 potential loci to be
screened, one could easily develop hundreds of loci for P.
metricus, facilitating detailed population genetic studies
as well as linkage mapping (Borrone et al., 2009). The 708
contigs that possess both microsatellite repeats and sufficient flanking sequences for primer design are available
in FASTA format as an associated electronic resource
(Online Resource 1). The linkage of these loci to the transcribed regions makes them particularly interesting markers
because of the potential to detect the effects of selection via
selective sweeps (Vigouroux et al., 2002). Such effects of
Development of new microsatellite loci
selection would be less apparent using previously available
microsatellites unlinked to ESTs. Studies examining genetic
structure with these loci could not only characterize patterns
of genetic differentiation, they could also elucidate the
nature of that structure at fine spatial scales (because of their
number) and on a gene-by-gene basis (because of their
linkage), especially as P. metricus genomic resources
become better annotated. Thus, these loci add to the growing list of new genetic tools in P. metricus, enhancing its
status as a new genetic model system that is also amenable
to ecological and evolutionary studies in a natural setting.
The P. metricus EST library should also prove to be a
tremendous resource for the development of new microsatellite loci in other species of Polistes. Many previous
studies have demonstrated that microsatellite loci isolated in
one species of Polistes frequently cross amplify in others
(e.g., Henshaw, 2000; Strassmann et al., 1997), retaining
high levels of polymorphism, and EST-linked microsatellites have been shown to often be more transferrable across
species (Ellis and Burke, 2007). Even if the rate of cross
amplification was low for these loci, with such a large
number of potential loci it seems likely that one could
develop microsatellites for nearly any species of Polistes
from the P. metricus EST sequences.
We have employed a new and powerful approach to
rapidly and inexpensively generate microsatellite loci based
on existing EST sequences. Due to recent innovations in
sequencing technology and reductions in the cost of largescale sequencing projects (Hudson, 2008), such EST databases are becoming increasingly common for a wide range
of species. This application may thus be useful for
researchers interested in estimating population structure and
relatedness in natural populations of a wide diversity of
organisms.
Acknowledgments The authors thank The Hudson lab at the University of Illinois, Urbana-Champaign for early access to assembled
contig sequences and the Statistical Consulting Center at Grand Valley
State University for statistical advice. This work was supported by
grant #IOS-0803317 from the National Science Foundation as well as
grants from the Center for Scholarly and Creative Activity at Grand
Valley State University.
References
Arevalo E., Strassmann J.E. and Queller D.C. 1998. Conflicts of
interest in social insects: Male production in two species of
Polistes. Evolution 52: 797-805
Batra R., Charizanis K. and Swanson M.S. 2010. Partners in crime:
bidirectional transcription in unstable microsatellite disease.
Hum. Mol. Gen. 19: R77-R82
Borrone J.W., Brown J.S., Tondo C.L., Mauro-Herrera M., Kuhn D.N.,
Violi H.A., Sautter R.T. and Schnell R.J. 2009. An EST-SSR-
585
based linkage map for Persea americana Mill. (avocado). Tree
Genetics & Genomes 5: 553-560
Carpenter J.M. 1996. Distributional Checklist of Species of the Genus
Polistes (Hymenoptera, Vespidae, Polistinae, Polistini). American Museum of Natural History, New York
Ellis J.R. and Burke J.M. 2007. EST-SSRs as a resource for population
genetic analyses. Heredity 99: 125-132
Henshaw M.T. 2000. Microsatellite loci for the social wasp Polistes
dominulus and their application in other polistine wasps. Mol.
Ecol. 9: 2155-2157
Hudson M.E. 2008. Sequencing breakthroughs for genomic ecology
and evolutionary biology. Mol. Ecol. Res. 8: 3-17
Hunt J.H., Kensinger B.J., Kossuth J.A., Henshaw M.T., Norberg K.,
Wolschin F. and Amdam G.V. 2007. A diapause pathway
underlies the gyne phenotype in Polistes wasps, revealing an
evolutionary route to caste-containing insect societies. Proc. Natl
Acad. Sci. USA 104: 14020-14025
Hunt J.H., Wolschin F., Henshaw M.T., Newman T.C., Toth A.L. and
Amdam G.V. 2010. Differential gene expression and protein
abundance evince ontogenetic bias toward castes in a primitively
eusocial wasp. Plos One 5: e10674
Lewis P.O. and Zaykin D. 2001. Genetic Data Analysis: Version 1.0
(d16c). Free program distributed by the authors over the internet
from http://lewis.eeb.uconn.edu/lewishome/software.html.
Miller S.A., Dykes D.D. and Polesky H.F. 1988. A simple salting out
proceedure for extracting DNA from human nucleated cells. Nucl.
Acids Res. 16: 1215-1215
Queller D.C., Strassmann J.E. and Hughes C.R. 1993. Microsatellites
and kinship. Trends Ecol. Evol. 8: 285-288
Ranum L.P.W. and Day J.W. 2002. Dominantly inherited, non-coding
microsatellite expansion disorders. Curr. Opin. Genetics Dev. 12:
266-271
Reeve H.K. 1991. Polistes. In: The Social Biology of Wasps (Ross K.G.
and Matthews R.W., Eds). Cornell University Press, Ithaca,
pp 99-148
Strassmann J.E., Solı́s C.R., Peters J.M. and Queller D.C. 1996.
Strategies for finding and using highly polymorphic DNA microsatellite loci for studies of genetic relatedness and pedigrees. In:
Molecular Zoology: Advances, Strategies and Protocols (Ferraris
J.D. and Palumbi S.R., Eds). Wiley-Liss, Inc., New York, pp 163180, 528-549
Strassmann J.E., Peters J.M., Barefield K., Solis C.R., Hughes C.R. and
Queller D.C. 1997. Trinucleotide microsatellite loci and
increased heterozygosity in cross-species applications in the
social wasp, Polistes. Biochem. Gen. 35: 273-279
Tibbetts E.A. 2007. Dispersal decisions and predispersal behavior in
Polistes paper wasp ‘workers’. Behav. Ecol. Sociobiol. 61:
1877-1883
Toth A.L., Varala K., Newman T.C., Miguez F.E., Hutchison S.K.,
Willoughby D.A., Simons J.F., Egholm M., Hunt J.H., Hudson
M.E. and Robinson G.E. 2007. Wasp gene expression supports an
evolutionary link between maternal behavior and eusociality.
Science 318: 441-444
Toth A.L., Varala K., Henshaw M.T., Rodriguez-Zas S.L., Hudson
M.E. and Robinson G.E. 2010. Brain transcriptomic analysis in
paper wasps identifies genes associated with behaviour across
social insect lineages. Proc. R. Soc. B - Biol. Sci. 277: 2139-2148
Vigouroux Y., McMullen M., Hittinger C.T., Houchins K., Schulz L.,
Kresovich S., Matsuoka Y. and Doebley J. 2002. Identifying
genes of agronomic importance in maize by screening microsatellites for evidence of selection during domestication. Proc. Natl
Acad. Sci. USA 99: 9650-9655
Yevgeniy G., Rodriguez A. and Benson G. 2006. TRDB - The Tandem
Repeats Database. Nucl. Acids Res. 35 (suppl 1): D80-D87
123