DNA Fingerprinting
Ray McGovern
Nabil Hafez
John Leonard
November 29, 2004
Overview
• DNA Fingerprinting developed by Sir Alec J.
Jeffreys, at the University of Leicester, UK.
• Leicestershire, saw the first exoneration and
conviction bases of DNA evidence, in the late
1980s.
• We will cover:
What is DNA Fingerprinting?
Courts & Cases
Probabilities associated with DNA fingerprinting
Genetics Basics
• 100 trillion cells
• 23 pairs of chromosomes
• 99.9% identical between
humans
• 0.1 % or 3 million bases
accounts for variation
• Est. 20,000 – 25,000 genes
• Up to hundreds of alleles per
gene (blue or brown eyes)
Courtesy: DOE
Allelic Differences
• Repeats vary from individual to
individual but are also inherited
• Homozygous vs Heterozygous
Courtesy: http://www.howstuffworks.com
Polymorphism = Variation
VNTR (minisatellites)
• Variable number of tandem repeats
• Repeat unit up to 25 bp (unit 20 kb)
ACAGGGTGTGGGGACAGGGTGTGGGG
vs
AGTAGTAGTAGTAGTAGT
STR (microsatellites)
• Short tandem repeats
• repeat unit less than 13 bp (unit <150 bp)
Where do we get the DNA?
• Blood - extracted dry or wet (WBC)
• Buccal (cheek cells) – easy to obtain
• Semen – dried can be analyzed
years later
• Hair roots
• Saliva
• Skin cells
RFLP – VNTR based
• Restriction Fragment Length Polymorphism
Courtesy:
http://www.howstu
ffworks.com
Autoradiograph
DNA evidence
Suspect 1
Courtesy: http://www.howstuffworks.com
STR (PCR) Typing
• Use PCR (polymerase chain reaction)
to amplify DNA
• Primer sequence
from locus region
(locus – chromosomal
location of genetic
marker or repeat)
• Obtain Product
• Run Gel
Courtesy: Fan Sozzi
STR multiplexing
• Analyzed by computer and analyst
• This one is 8 STR loci on one gel
• 1 in 100,000,000 discrimination
Courtesy: Genelex
RFLP vs STR typing
RFLP
STR (PCR)
• Older method (80’s)
• Less sensitive – suitable
for blood, requires large
amount of high quality
DNA
• Slow: 7-10 days, labor
intensive, one gene
analyzed at a time
• Fewer indvidual tests
needed, genes examined
have >100 alleles high
power of discrimation
• Newer method (90’s)
• More sensitive – can use
degraded DNA from
minute sources
• Fast: 2-6 days, high
throughput, simultaneous
analysis of many genes
• More individual tests
needed, genes examined
have between 10-15
alles, low power of
discrimination
CODIS
(just like on CSI)
• Combined DNA Index System
• 1997 - National FBI Database
composed of 13 STR Loci’s
• Probability that DNA from unrelated
individuals would generate the same 13
STR profile would be less than 1 in a trillion
Are they guilty?
• Bands match, then that suspect is included
in the group of individuals from whom the
DNA evidence can come from
• Bands don’t match, then suspect is
excluded from individuals who could have
contributed to the DNA evidence
• Inconclusive – DNA possibly old or
contaminated
• Can make no statement of guilt or
influence, that is for a jury to decide
The Court Room
When determining the admissibility of DNA evidence,
courts consider the following questions:
• The way the DNA sample(s) were obtained,
gathered and preserved.
• The qualifications of the experts.
• The status of the laboratory.
• The reliability of the testing procedure.
The majority of the time, “the possibility of laboratory
error is substantially larger than the possibility of a
coincidental match. This is not because DNA
laboratory work is particularly sloppy or unreliable.
Instead, it is because the chance of a coincidental
match is usually small.”
Fake DNA Evidence
Dr. Schneeberger, a Canadian doctor who
hading been acquitted of sexually
assaulting in 1994, had giving blood on
three occasions. He had surgically inserted
a Penrose drain, filled with foreign blood
and anticoagulants in his arm.
This only came to light when the police
obtain a sample of his hair and Dr.
Schneeberger was convicted in 1995.
Laboratories in Crisis
Houston Police Department’s Crime Lab
• 280 boxes contained evidence from 8,000
cases, items such as a human fetus,
assorted body parts and a host of evidence
had been stuffed into the boxes.
• This November, it was reviled that DNA
evidence from 29 cases was either missing
or had been destroyed.
• Retesting has put into question the
conviction of 15 cases; including 4 death
sentences.
Laboratories in Crisis cont.
Cellmark
Cellmark was awarded a $2.7 million three-year contract to provide
DNA testing service to the LA Police Department, in January.
In November, Sarah Blair a DNA analyst was fired for substituting
data in control samples causing Cellmark to reanalyzed the
evidence of several high-profile cases; O.J. Simpson, JonBenet
Ramsey, the Unabomber, etc.
Other Labs
•
•
West Virginia – Fred Zain, the former director was facing fraud
charges stemming from testimony provided, when he died in
2003.
Marysville, Washington - In November 2001, Michael Hoover
a forensic scientist at the State Patrol crime lab was sentenced to
11 months, after admitting to taking heroin from case evidence;
to ease him back pain.
Case Law
The admissibility of scientific evidence in the
federal court was established Frye v.
United States, 1923. The Frye court put
forward the "general acceptance" test.
State v. Stills – the Supreme Court of New
Mexico approved the admissibility of PCR
analysis stating that PCR analysis "has
received overwhelming acceptance in the
scientific community and the courts".
Areas of Statistical Calculations to
Considered in DNA Testing
Population Genetics
• In calculating a probability labs employ databases,
which are divided into broad racial categories;
comprising of the DNA profile of a few hundred
individuals.
• These databases are built on the science of
Population Genetics.
• Murder case in Vermont the defense argued that
any DNA evidence should be inadmissible as there
was no suitable reference database. The judge
agreed, stating “it is unclear which if any of the FBI
database is appropriate for calculate probability of a
coincidental match.”
Areas of Statistical Calculations to
Considered in DNA Testing
The Product Rule
• The product rule is employed in determining a
match.
• Guidelines for the application of the product rule are
detailed in the Recommendations 4.1 in the Second
National Research Council Report (NRC II).
“The product rule requires an assumption of within
(Hardy-Weinberg or HW) and between (linkage
equilibrium or LE) locus independence, which
cannot be exactly true.”
The Ceiling Principle and the Modified
Ceiling Principle
The National Academy of Sciences first recommended the use of the
Ceiling Principle back in the late 1980s. The idea was to provide
the most conservative estimate of probability but in the mid
1990 it fell out of favor
Advances in DNA fingerprinting
• In the eighties the number of VNTRs used was small, four or less
compared to today when the norm is to employ at least six loci.
A Shift in the scientific landscape,
• Randjit Chakraborty and Kenneth Kidd defended DNA statistical analysis in
their paper entitled The Utility of DNA Typing in Forensic Work. They
asserted that even a small amount of migration (gene) across populations
is quickly homogenized and contested Lewontin and Hartle’s ideas.
• In 1994, Bruce Budowle and Eric Lander published a paper in they
concluded that any controversy had been resolved by the Technical
Working Group on DNA Analysis Methods (TWGDAM); sponsored by the
FBI and the Department of Justice.
Who was Hardy-Weinberg?
Cells, Chromosomes, Genes
23 pairs of chromosomes
Each set passed from parents, one from each
Inherited characteristics controlled by genes
Inheritance
Genes can come in alternative forms, alleles
Each controls specific trait, example: eye color
brown, green, blue
One allele from each parent
Dominant vs. Recessive
Recessive: Sickle Cell Anemia
Allele causes shape of red blood cells to be altered
2 copies - disease is manifested
1 copy - carrier
Dominant: Huntington’s Disease
Progressive, usually mid 30’s
Involuntary muscular action and dementia
Only 1 copy of allele needed
Two different Genes
What happens when at a given locus
Both Dominant & Recessive alleles present
The Hardy-Weinberg Equilibrium
1908
Godfrey Harold Hardy - mathematician
Wilhelm Weinberg - physician
Mathematical equivalent of Mendel’s observations
on heredity
Phenotypes:
For a gene with 2 alleles, A and a
p the population frequency of A
q the population frequency of a
p  q 1
Cross Product
A
a
A
AA
Aa
a
Aa
aa
AA = 25%
Aa = 50%
aa = 25%
Genotypes
AA
=
p2
Aa
=
2 pq
=
q2

Aa

p  2 pq  q  1
2

2
Restrictions
Population size infinite
Random mating
No selection for or against genotypes
No mutations
No net migration into or out of population
Applications of Hardy-Weinberg
DNA Forensics
Population Genetics
Forensics
DNA exclusion
no match
DNA inclusion
match but need to relate to
population frequencies
Frequency
Each allele has an observed frequency
Use the product rule
Blond hair:
Blue eyes:
Fair skin:
1/10
1/10
1/10
(.10) (.10) (.10) = 1/1000
What about in Scandinavia? Issue of population
Confidence Levels
95% confidence limit, true value has only
5% chance exceeding upper bound
If pattern 1/100
Frequency
.01
Upper confidence limit
4.7%
Population differences
Group I - 90%
Group II - 10%
A
.5
.9
with random mating
AA
Group I
.25
Group II
.81
Aa
.50
.18
a
.5
.1
aa
.25
.01
The Results, not that different
Observed genotype
AA=(.9)(.25)+(.1)(.81)
Aa=(.9)(.5) +(.1)(.18)
aa=(.9)(.25) +(.1)(.01)
=.306
=.468
=.226
Without regard to population substructure
A=(.9)(.5)+(.1)(.9)
=.54
a=(.9)(.5)+(.1)(.1)
=.46
Hardy-Weinberg proportions
AA=(.54)(.54)
Aa=2(.54)(.46)
aa=(.46)(.46)
=.2916
=.4968
=.2116
http://www.dartmouth.edu/~chance/teaching_aids/books_articles/DNAtyping/node1.html
Population Genetics
Sickle Cell Anemia
observed frequency : 0.09
p +q=1
q = % population with SCA
= .09
p = % population with out SCA = .91
Expected Frequencies
Genotype frequencies
p 2  2 pq  q 2  1
p 2  (.91)(.91)  .8281



2 pq  2(.91)(.09)  .1638
q  (.09)(.09)  .0081
2
Conclusion
Hardy-Weinberg Equilibrium is a powerful tool
Pay attention to its constraints
References
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
•
i
http://www.bbc.co.uk/crime/caseclosed/colinpitchfork.shtml
ii
http://en.wikipedia.org
iii
On Conveying the Probative Value of DNA Evidence: Frequencies, Likelihood Ratios, and Error
Rates, by Jonathan J. Koehler, The University of Texas at Austin, 20th March 1996
iv
http://www.medterms.com/
v
http://www.cnn.com/2004/TECH/science/11/18/dnalab.ap/index.html
vi
http://www.law-forensic.com/cfr_gen_art_24.htm
vii http://www.cellmark-labs.com/
viii Labs Placed Under a Microscope, by Robert Tanner, The Washington Post, July 27, 2003
ix
http://www.illinoisbar.org/Member/mar00lj/p134.htm#2
x
http://www.kscourts.org/ca10/cases/2001/03/00-2475.htm
xi
http://www.forensic-evidence.com/site/EVID/EL_dna_instr_bad.html
xii http://www.fathom.com/course/21701758/session4.html
xiii Interpreting DNA Mixtures Based on the NRC-II Recommendation 4.1, by Wing K. Fung and YueQing Hu, Forensic Science Communication, Volume 2 - Number 4, October 2000
xiv Commonwealth v. Lanigan, 419 Mass. 15 (1994)
xv Utility of DNA Typing in Forensic Work, by Randjit Chakraborty and Kenneth Kidd, Science 20th
December 1991, Vol, 254, Issue 5039
xvi http://www.nas.edu/
xvii Use of DNA Profiles in Criminal Proceeding, Alaska Judicial Council, December 1996
xviii Dr. Shockley and Mr. Hyde, by Joseph Galloway et al, News & World Report, 28th Aug 1989
xvii http://www.law.berkeley.edu/journals/btlj/articles/vol8/Denemark/html/reader.html
xv Milton R. Wessel, Adversary Science and the Adversary Scientist: Threats to Responsible Dispute
Resolution, 28 JURIMETRICS J. 379, 380 (1988).