SEMI-CONSERVATIVE DNA REPLICATION Pages 333-335 Essential Questions What is replication and how is it done? What’s the role of the enzymes helicase and DNA polymerase? Replication When a complete copy of the DNA is made during the S-Phase of the cell cycle. mitosis & cell division WHY MUST DNA SYNTHESIZE COPIES OF ITSELF ? TO ENSURE THAT EVERY NEW CELL CONTAINS SAME NUMBER EXACTLY THE ______________ SAME KIND AND EXACTLY THE ____________ OF GENES THE PARENT CELL HAD. The DNA code is in the middle of the helix, so how does it get copied if it’s obscured by the side chains and twist of the helix shape? DNA Synthesis Step One: Hydrogen bonds are broken by the enzyme, Helicase. Hydrogen = Bonds are weak bonds REVIEW: Hydrogen bonds are located betwee nitrogenous bases Step Two: DNA Polymerase adds free nucleotides to both strands. Step 3: New DNA strands are Proofread and mistakes are repaired: Replication occurs in 3 Steps: 1. Helicase enzyme “unzips” the double helix by weakening H-bonds creating a replication fork where the two DNA chains separate. 2. DNA polymerase enzyme assembles new DNA nucleotides using each original strand as a template. 3. The replicated DNA is proofread and any mistakes are edited. Replication Fork Leading and Lagging Strands • The leading strand is the strand of DNA that is made continuously. • The lagging strand is the strand of DNA that is made discontinuously. Boring person explaining • http://highered.mcgrawhill.com/olcweb/cgi/pluginpop.cgi?it=swf::535 ::535::/sites/dl/free/0072437316/120076/mic ro04.swf::DNA%20Replication%20Fork Replication is Discontinuous on the Lagging Strand Short fragments of DNA called Okazaki fragments are created near the replication fork. Gaps are filled in when DNA polymerase adds nucleotides. Bases are added following the base pairing rules (A-T, C-G) * The lengths of Okazaki fragments are between 1,000 to 2,000 nucleotides long in bacteria and are generally between 100 to 200 nucleotides long in eukaryotes. DNA Foldables 1/2 1/4 Copy the following sequence onto your foldable on the left side. Write the new base pairs on the right side. T-- --A A-- --T C-- --G Remember that A-- --T H-bonds hold A-- --T complementary A-- --T bases together C-- --G T-- --A T-- --A A-- --T C-- --G T-- --A Unzip sequence on your foldable. T A C A A A C T T A C T A T G T T T G A A T G A Step 1: Helicase enzyme “unzips” double helix by weakening H-bonds Using the original DNA sequence on the foldable make a copy. T A C A A A C T T A C T A T G T T T G A A T G A Step 2: DNA polymerase enzyme adds DNA bases to the exposed nucleotides on the leading strand A T G T T T G A A T G A Using the original DNA sequence on the foldable make a copy. T A C A A A C T T A C T A T G T T T G A A T G A While Okazaki fragments are added on the lagging strand A C A A C A C T A T G T T T G A A T G A Using the original DNA sequence on the foldable make a copy. T A C A A A C T T A C T A T G T T T G A A T G A Step 3: Polymerase also proofreads and edits any gaps T A C A A A C T T A C T A T G T T T G A A T G A RESULTS • TWO strands of identical DNA • DNA replication is semiconservative because each new DNA molecule contains one original strand and one newly made strand. original double helix original double helix Replication fork replication fork two identical new strands are formed free nucleotides are attracted to their opposites forming two new strands two identical new strands are formed 1.Why must DNA synthesize copies of itself? 2. If the code below is for a parent DNA molecule, write the code for the offspring: AATTCCGGTATACCCGCCAAG 3. List and describe the three steps in the process of DNA replication. 4. During which phase of the cell cycle does DNA replicate? 5. Explain the process of DNA replication Have Your DNA & eat it too! 1. Now replicate the DNA, using 2 more pieces of licorice but use black sticks 3-2-1 3 steps cells undergo in replication 2 words meaning the structure of DNA 1 word for duplicating cell DNA