Chapter 2 Review Questions
1. What type of monomer is polymerized to form DNA? What type of monomer
is polymerized to form RNA?
2. What are the three components are necessary to form a nucleotide? What
must be left off to form a nucleoside?
3. Below are the pictures of a nucleotide. Please name the nucleotide and
state which sugar and nitrogenous base is present within the nucleotide.
Please label the carbons of this sugar. Which carbon is the phosphate group
bound to? Which carbon is the nitrogenous base bound to?
4. Please state the nitrogenous bases common to DNA. Which are purines and
which are pyrimidines?
5. Please state the nitrogenous bases common to RNA. Which are purines and
which are pyrimadines?
6. Please state Chargaff’s rules. Please explain in detail why these rules
apply?
7. Is it necessary G:C content stay the same between species? Please explain
your answer.
8. Please explain the difference between deoxyribose and ribose specifically.
Also, please discuss how this effects each structure and chemistry.
9. Please give the appropriate name for the nucleotide/nucleoside based off
each of the descriptions below.
a. Contains deoxyribose and guanine
b. Contains deoxyribose, adenine and two phosphates
c. Contains ribose, uracil and three phosphates
d. Contains ribose, cytosine and one phosphate
e. Contains deoxyribose and thymine
10. For the nucleotide below, please appropriately label the phosphates, and
number the carbons in the pentose sugar.
12. What type of reaction allows for the joining of two nucleotides to allow for
elongation of a DNA strand? Please state the reason for the name of the
reaction that allows for the joining of two nucleotides. What type of bond is
formed in this reaction. Please discuss which groups are involved in the
reaction and which carbons they are bound to on the pentose sugar.
11. Does a single DNA strand have a specific polarity? Please explain your
answer in detail.
12. Please take the sequence of the DNA strand below (not written in proper
conventions), and write the sequence of its complement. When you write the
sequence, you must use the proper conventions.
5’ ACCTCGTTGGTATTCTTATCA 3’
13. Please state the two forces that are necessary to allow for the structural
integrity of a double stranded molecule of DNA. Please describe each force.
14. How many hydrogen bonds are present between an A-T base pair
15. How many hydrogen bonds are present between a G-C base pair?
16. Which base pair is stronger? Please explain why.
17. What is meant by Watson-Crick base pairing? Please name a non-WatsonCrick base pair that may be found in DNA.
18. When looking at the exterior of a DNA molecule, name two different
features you may see. Please describe them for the B-type DNA double helix.
19. Please state three different forms that the DNA double helix can take.
Please describe each, and state which conditions are necessary for each to
form?
20. Which forms of DNA double helices are physiologically relevant. Please
explain your answer.
21. Please state one method by which you could denature double stranded
DNA? How does this method denature the DNA? Please explain how it is
possible to renature the DNA.
22. Are denaturation and renaturation of DNA biologically relevant processes
(i.e. are they important in living systems)? Please explain your answer in
detail including examples if necessary.
23. You are studying the DNA binding protein GLI in humans. GLI normally
binds the DNA sequence 5’ ACGCTACGA 3’ in the IL-1 (interleukin-1) gene. You
come across a skin cancer patient in which you find that GLI no longer binds
the IL-1. Upon further study, you find that the binding sequence has been
changed and is now 5’ ACGCCACTA 3’. Please write the complementary DNA
sequences for the normal and changed binding sites. Also, please explain
where within the geometry of the DNA GLI would bind and explain in DETAIL
why GLI can no longer bind to the changed sequence.
24. For the following DNA molecules, please write out the complementary
sequence and then determine the melting point for the double stranded DNA
molecule.
a. 5’ GCGCCCGGATCG 3’
b. 5’ ATGCTAGCTGAACCTGA 3’
c. 5’ CTGGGACAATATACGTATTACT 3’
25. Can a double stranded DNA molecule be manipulated in a way that such
that the two strands become two separate single strands? If so, can the two
single strands reconstitute a double stranded DNA molecule. Please explain
your answer in detail.
26. Are non-canonical base pairs stronger or weaker than canonical base pairs
in RNA? Why? If non-canonical base pairing is weaker, please state how this
is compensated for?
27. What type of secondary structure does RNA adopt? Please describe this
structure in detail.
28. Explain the structure of the double stranded RNA double helix? How does
the structure of this helix differ from the typical DNA structure? If a protein
were to bind, where on this helix will a protein most likely bind? Why is it
most likely that a protein would bind at that spot?