Foreign Language Math Science Social Science Business Engineering & Technology Arts & Humanities History Miscellaneous Standardized tests
  1. Science
  2. Biology
  3. Biochemistry
  4. Molecular Biology
Taq DNA Polymerase - G
Taq DNA Polymerase - G
Taq DNA Polymerase
Taq DNA Polymerase
Taq DNA Polymerase
Taq DNA Polymerase
Taq
Taq
Tangential Flow Filtration of Phage Concentration Experiments
Tangential Flow Filtration of Phage Concentration Experiments
Tang - Biology Department | UNC Chapel Hill
Tang - Biology Department | UNC Chapel Hill
Talk_7_QMMM
Talk_7_QMMM
Talks to IPAM group UCLA September 26 Why biologists need mathematicians
Talks to IPAM group UCLA September 26 Why biologists need mathematicians
Talk 2 - European Bioinformatics Institute
Talk 2 - European Bioinformatics Institute
talk - TerpConnect - University of Maryland
talk - TerpConnect - University of Maryland
tactgtaaaggctatatgccgaat
tactgtaaaggctatatgccgaat
TACCCAAAATCC
TACCCAAAATCC
Tables
Tables
Table supplement 1 Summary of identified WRKY33 binding
Table supplement 1 Summary of identified WRKY33 binding
Table S5: protein variation in mES cells
Table S5: protein variation in mES cells
Table S4: Bacterial strains and plasmids used in this study.
Table S4: Bacterial strains and plasmids used in this study.
Table S4. Enriched GO terms under corrected p
Table S4. Enriched GO terms under corrected p
Table S3. - Figshare
Table S3. - Figshare
Table S3. - Figshare
Table S3. - Figshare
TABLE S2: Suppression of PEV and TPE by proteins involved in
TABLE S2: Suppression of PEV and TPE by proteins involved in
Table S2: Morphologic sub-type and chromosome abnormalities in
Table S2: Morphologic sub-type and chromosome abnormalities in
Table S2: Jasper et al. Table S2. Microsatellites used to test for
Table S2: Jasper et al. Table S2. Microsatellites used to test for
Table S2. Tools for functional annotation of non
Table S2. Tools for functional annotation of non
Table S2. Overview of the analyzed redox proteins. Gene
Table S2. Overview of the analyzed redox proteins. Gene