Supplementary Methods
QTL mapping with near-isogenic lines. We grew the plant material (our original
recombinant near-isogenic lines) and determined dry weight as described1. In general, we
performed 13 replicates á 5 plants per line. For each replicate, we obtained mean dry weight
per plant by dividing the total dry weight for all plants in a given replicate by the number of
plants in the replicate. Afterwards, we used ANOVA to obtain least square means (LSM) for
each line according to the following model: MEAN DRY WEIGHT = CONSTANT + LINE
+ REPLICATE. Finally, we tested for the association between markers within the 210-kb
interval and LSMDRY WEIGHT using single marker analysis and F-ratio statistics. The data set
includes near-isogenic lines that harbor recombination breakpoints in the 210-kb interval
investigated in this study. For several of these lines, we obtained F2 progeny from the original
Col-0 x CL5 cross heterozygous for the GS-AOP2 glucosinolate biosynthesis locus on
chromosome 4. In subsequent generations, we generated progeny homozygous Col-0 or Ler0 at this GS-AOP locus. We included both progeny (designated ‘a’ or ‘b’) in the initial
analysis for growth rate QTL shown in Figure 1. Likewise, we included two lines, J19 and
J25, in our analysis that we initially scored recombinant3 but, with the use of more markers,
later turned out to be non-recombinant. Columns indicate lines, LSMDRY WEIGHT, followed by
genotypes (C: Col-0; L: Ler-0) at GS-AOP, and within the investigated 210-kb interval;
numbers refer to marker positions.
Genotyping. We extracted DNA from freeze-dried tissue according to3. PCR primer pairs
used for genotyping are listed in Supplementary Table 1. We sequenced PCR products
either directly (grLC1, 3, 5, and grCL6), or separated them on 4% MetaPhor (BMA,
Rockland, ME, USA) agarose (glLC, glCL, grLC2, grCL6, grCL7), or, in case of grLC4 and
grCL9, on 1.5% SeaKem LE (Cambrex Bio Science Rockland, Inc., Rockland, ME, USA)
agarose gels. For all but one experiment, observed genotype frequencies did not deviate
significantly from the expected 1:2:1 ratio for homozygous Col-0, heterozygous, and
homozygous Ler-0 genotypes at the segregating intervals. Only for the experiment involving
a mixture of grCL7 and grLC2 progeny, we observed too few plants with a Ler-0 background
5’ and a Col-0 background 3’ of the ‘downstream’ growth rate QTL when the genotype at this
growth rate QTL was Col-0.
Sequence survey. We amplified a ~ 6.4 kb DNA portion containing At5g23160 and
At5g23170 from 31 Arabidopsis accessions randomly selected from the species’ natural
range: Aa-0 (Aua/Rhön, Germany), Ag-0 (Argentat, France), Bl-0 (Bologna, Italy), Bla-10
(Blanes/Gerona, Spain), Cal-0 (Calver, U.K.), Can-0 (Canary Islands, Spain), Col-0
(Columbia), Cnt-1 (Canterbury, UK), Cvi-0 (Cape Verdi Islands), Di-0 (Dijon, France), Di-1
(Dijon, France), Di-g (Dijon, France), Ema-1 (East Malling, U.K.), Ka-0 (Kaernten, Austria),
Kas-1 (Kashmir, India), Ler-0 (Landsberg erecta), Lip-0 (Lipowiec/Chrzanow, Poland), Ma-0
(Marburg, Germany), Mt-0 (Martuba/Cyrenaika, Libya), No-0 (Nossen, Germany), Oy-0
(Oystese, Norway), Pa-1 (Palermo, Italy), Per-1 (Perm, Russia), Petergof (Petergof, Russia),
Pi-0 (Pitztal/Tirol, Austria), Sei-0 (Seis am Schlern, Italy), Sorbo (Tadjikistan), Su-0
(Southport, UK), Tac (Tacoma, Washington, US), Tsu-0 (Tsu, Japan), Yo-0 (Yosemite
National Park, US). We obtained the At5g23170 region in four overlapping fragments using
primer pairs L62 (5’-GCGTCTCAAATTAAACTCTTCTG-3’)/L63 (5’GTCCGAGAGAGAATTAACTCTTC-3’), GR218300 (5’CCGTGAAAACCAACGAGTTC-3’)/GR220300 (5’- GGTCTAGTGGGTTTTGATTTTC3’), 13-3af (5’-CTAAACCCTAAACCCAAAGTTC-3’)/L68 (5’GCTGCATCTCTAAGTCTTTGAG-3’), and L67 (5’-CGATCTATGGCAGTGACAAG3’)/13-4r (5’-CACACTTGTCTCCATTAATCAG-3’). We gel purified PCR products with
QiaQuick columns (Qiagen, Germany) and cloned them into pCR 2.1TOPO vectors
(Invitrogen, The Netherlands). We sequenced four clones each on an automated Applied
Biosystems 3730xl DNA Analyzer using BigDye terminators version 3.1. We used the
DNAstar software package (DNASTAR Inc., Madison, WI, USA) for sequence assembly and
alignment. Sequence data are deposited at EMBL (accession nos. AJ864968 to AJ864998).
1. Kroymann, J., Donnerhacke, S., Schnabelrauch, D. & Mitchell-Olds, T. Evolutionary
dynamics of an Arabidopsis insect resistance QTL. Proc. Natl. Acad. Sci. USA 100, 1458714592 (2003).
2. Kliebenstein, D. J., Lambrix, V. M., Reichelt, M., Gershenzon, J. & Mitchell-Olds, T.
Gene duplication in the diversification of secondary metabolism: tandem 2-oxoglutaratedependent dioxygenases control glucosinolate biosynthesis in Arabidopsis. Plant Cell 12,
681-693 (2001).
3. Kroymann, J., Textor, S., Tokuhisa, J. G., Falk, K. L., Bartram, S., Gershenzon, J. &
Mitchell-Olds, T. A gene controlling variation in Arabidopsis thaliana glucosinolate
composition is part of the methionine chain elongation pathway. Plant Phys. 127, 1077-1088
(2001).