Computational Genomics Spring 2009 www.cs.tau.ac.il/~bchor/CG09/comp-genom.html Lecturer: Benny Chor (benny AT cs.tau.ac.il) TA: Igor Ulitsky (ulitskyi AT gmail.com) Lectures: Wednesday 9:00-12:00, Schreiber 008 Tutorials: Thursday 12:00-13:00, Schreiber 006 . Course Information Requirements & Grades: 20-30% homework, in three-to-five assignments, containing both “dry” and “wet” problems. Submission two weeks from posting. Homework submission is obligatory. You are strongly encouraged to solve the assignments independently (or at least give it a very serious try). 70-80% exam. Grade of 60 or more required for passing course. 2 Bibliography Biological Sequence Analysis, R.Durbin et al. , Cambridge University Press, 1998 Introduction to Molecular Biologydna labuteS .J , J. Meidanis, PWS publishing Company 1997 , Algorithms on Strings, Trees, and Sequences: Computer Science and Computational Biology, D. Gusfield, Cambridge University Press, 1997. Post-genome Informatics, M. Kanehisa , Oxford University Press, 2000. More refs on course page. 3 Course Prerequisites Computer Science and Probability Background Computational Models Algorithms (“efficiency of computation”) Probability (any course) Some Biology Background Formally: None, to allow CS students to take this course. Recommended: Some molecular biology course, and/or a serious desire to complement your knowledge in Biology by reading the appropriate material. Studying the algorithms in this course while acquiring some biology background is far more rewarding than ignoring the biological context. 4 What is Computational Biology? Computational biology is the application of computational tools and techniques to molecular biology (primarily). It enables new ways of study in life sciences, allowing analytic and predictive methodologies that support and enhance laboratory work. It is a multidisciplinary area of study that combines Biology, Computer Science, and Statistics. Computational biology is also termed (sometimes) Bioinformatics, even though many practitioners define Bioinformatics somewhat narrower by restricting to the application of specialized software for deducing meaningful biological information. 5 Why Bio-informatics ? An explosive growth in the amount of biological information necessitates the use of computers for cataloging, retrieval and analyzing mega-data (> 3 billion bps, > 30,000 genes). • The human genome project. • Improved technologies, e.g. automated sequencing. • GenBank is now approximately doubling every year !!! 6 New Biotechnologies & Data • Micro arrays - gene expression. • 2D gels – protein expression. • Multi-level maps - genetic, physical: sequence, annotation. • Networks of protein-protein interactions. • Cross-species relationships • Homologous genes. • Chromosome organization. http://www.the-scientist.com/yr2002/apr/research020415.html 7 BioInformatics Tools are Crucial ! • New biotechnology tools generate explosive growth in the amount of biological data. • Impossible to analyze the data manually. • Novel mathematical, statistical, algorithmic and computational tools are necessary ! 8 Areas of Interest (very partial list) • • • • • • Building evolutionary trees from molecular (and other) data Efficiently reconstructing the genome sequence from subparts (mapping, assembly, etc.) Understanding the structure of genomes (Genes, SNP, SSR) Understanding function of genes in the cell cycle and disease Deciphering structure and function of proteins Diagnosing cancer based on DNA microarrays (“chips”) _____________________ SNP: Single Nucleotide Polymorphism SSR: Simple Sequence Repeat Much of this class has been edited from Nir Friedman’s lecture which is available at www.cs.huji.ac.il/~nir. Changes made by Dan Geiger, then Shlomo Moran, and finally Benny Chor. Additional slides from Zohar Yakhini and Metsada Pasmanik. 9 Growth of DNA Sequence Data: GenBank http://www.ncbi.nlm.nih.gov/Genbank/genbankstats.html 10 Fully Sequenced Gemomes (bacteria, eukaryotes, archea) From the GOLD database: http://www.genomesonline.org/gold_statistics.htm#aname 11 Fully Sequenced Gemomes (bacteria, eukaryotes, archea) From the GOLD database: http://www.genomesonline.org/gold_statistics.htm#aname 12 56,066 total structures todate The Protein Data Bank: Yearly growth (number of experimentally determined structures). total/yearly QuickTime™ and a decompressor are needed to see this picture. http://www.rcsb.org/pdb/statistics/contentGrowthChart.do?content=total&seqid=100 13 Comp. Biology: Four Aspects Biological What is the task? Algorithmic How to perform the task at hand efficiently? Learning How to adapt/estimate/learn parameters and models describing the task from examples Statistics How to differentiate true phenomena from artifacts 15 Example: Sequence Comparison Biological Evolution preserves sequences, thus similar genes might have similar function Algorithmic Consider all ways to “align” one sequence against another Learning How do we define “similar” sequences? Use examples to define similarity Statistical When we compare to ~106 sequences, what is a random match and what is true one 16 Topics I Dealing with DNA/Protein sequences: Finding similar sequences Models of sequences: Hidden Markov Models Genome projects and how sequences are found Transcription regulation Protein Families Gene finding 18 Topics III High throughput biotechnologies – potentials and computational challenges DNA microarrays applications to diagnostics applications to understanding gene networks 20 Topics IV (Structural BioInfo Course) Protein World: How proteins fold - secondary & tertiary structure How to predict protein folds from sequences data How to predict protein function from its structure How to analyze proteins changes from raw experimental measurements (MassSpec) 21 Algorithmics Will introduce algorithmic techniques that are useful in computational genomics (and elsewhere): Dynamic programing, dynamic programing, dynamic.. Suffix trees and arrays Probabilistic models: PSSM (Position Specific Scoring Matrices), HMM (Hidden Markov Models) Learning and classification, SVM (Support Vector Machines) Heuristics for solving hard optimization problems (Many problems in comp. genomics are NP-hard) 22 Human Genome Most human cells contain 46 chromosomes: 2 sex chromosomes (X,Y): XY – in males. XX – in females. 22 pairs of chromosomes named autosomes. 23 Watson and Crick … On Feb. 28, 1953, Francis Crick walked into the Eagle pub in Cambridge, England, and, as James Watson later recalled, announced that "we had found the secret of life." "The structure was too pretty not to be true." -- JAMES D. WATSON, "The Double Helix" 24 DNA the Code for Life (1953) 1920-1958 Died from ovarian cancer http://www.nobel.se/medicine/laureates/1962/index.html 25 Source: Alberts et al The Double Helix 27 The Central Dogma of Molecular Biology Replication protein mRNA DNA Transcription A C UA A G CA G G U U CA C Translation A Phenotype 28 Watson-Crick Complementarity Conclusion: DNA strands are complementary )Chargaff first parity rule, 1952, preceeding .W-C!) Base ratios % of each base DNA source Human Sheep Turtle Sea urchin Wheat E. coli Purines/ Pyrimidines Pyrimidines Purines 30 Genome Sizes E.Coli (bacteria) Yeast (simple fungi) Smallest human chromosome Entire human genome 4.6 x 106 bases 15 x 106 bases 50 x 106 bases 3 x 109 bases 31 Genetic Information Genome – the collection of genetic information. Chromosomes – storage units of genes. Gene – basic unit of genetic information. They determine the inherited characters. 32 What is a Gene ? Transcribed region Un-coded region promotor exon exon intron Start codon Un-coded region exon intron Terminal codon DNA contains various recognition sites: • Promoter signals. • Transcription start signals. • Start codon. • Exon, intron boundaries. • Transcription termination signal. 33 Control of the Human b-Globin Gene 34 Alternative Splicing 35 35 Genes: How Many? The DNA strings include: Coding regions (“genes”) E. coli has ~4,000 genes Yeast has ~6,000 genes C. Elegans has ~13,000 genes Humans have ~32,000 genes Control regions These typically are adjacent to the genes They determine when a gene should be “expressed” So called “Junk” DNA (unknown function - ~90% of the DNA in human’s chromosomes). Recall recent findings. 36 Gene Finding • Only 3% of the human genome encodes for functional genes (exons). • Genes are found along large non-coding DNA regions. • Repeats, pseudo-genes, introns, contamination of vectors, are confusing. 37 38 Gene Finding Existing programs for locating genes within genomic sequences utilize a number of statistical signals and employ statistical models such as hidden Markov models (HMMs). The problem is not solved yet, esp. for the newly discovered “RNA genes” and for non mammalian species. 39 41 Diversity of Tissues in Stomach How is this variety encoded and expressed ? 42 Central Dogma שעתוק Transcription Gene תרגום Translation mRNA Protein cells express different subset of the genes In different tissues and under different conditions 43 Transcription sequences can be transcribed to RNA Source: Mathews & van Holde Coding RNA nucleotides: Similar to DNA, slightly different backbone Uracil (U) instead of Thymine (T) 44 Transcription: RNA Editing 1. Transcribe to RNA 2. Eliminate introns 3. Splice (connect) exons * Alternative splicing exists Exons hold information, they are more stable during evolution. This process takes place in the nucleus. The mRNA molecules diffuse through the nucleus membrane to the outer cell plasma. 45 RNA roles Messenger RNA (mRNA) Encodes protein sequences. Each three nucleotide acids translate to an amino acid (the protein building block). Transfer RNA (tRNA) Decodes the mRNA molecules to amino-acids. It connects to the mRNA with one side and holds the appropriate amino acid on its other side. Ribosomal RNA (rRNA) Part of the ribosome, a machine for translating mRNA to proteins. It catalyzes (like enzymes) the reaction that attaches the hanging amino acid from the tRNA to the amino acid chain being created. microRNA (MIR): Repressing other genes, ... 46 New Roles of RNA Cellular Regulation COVER: Researchers are discovering that small RNA molecules play a surprising variety of key roles in cells. They can inhibit translation of messenger RNA into protein, cause degradation of other messenger RNAs, and even initiate complete silencing of gene expression from the genome. http://www.sciencemag.org/content/vol298/issue5602/cover.shtml http://www.nature.com/nature/journal/v408/n6808/fig_tab/408037a0_F1.html 47 Translation in Eukaryotes http://www1.imim.es/courses/Lisboa01/slide1.6_translation.html Animation: http://cbms.st-and.ac.uk/academics/ryan/Teaching/medsci/Medsci6.htm 48 Translation Translation is mediated by the ribosome Ribosome is a complex of protein & rRNA molecules The ribosome attaches to the mRNA at a translation initiation site Then ribosome moves along the mRNA sequence and in the process constructs a sequence of amino acids (polypeptide) which is released and folds into a protein. 49 Genetic Code (universal!) There are 20 amino acids from which all proteins are built. 50 Protein Structure Proteins are polypeptides of 70-3000 amino-acids This structure is (mostly) determined by the sequence of amino-acids that make up the protein 51 Protein Structure 52 53 The Central Paradigm of Bio-informatics Genetic information Molecular structure Biochemical function Symptoms 54 Similarity Search in Databanks Find similar sequences to a working draft. As databanks grow, homologies get harder, and quality is reduced. Alignment Tools: BLAST & FASTA (time saving heuristicsapproximations). >gb|BE588357.1|BE588357 194087 BARC 5BOV Bos taurus cDNA 5'. Length = 369 Score = 272 bits (137), Expect = 4e-71 Identities = 258/297 (86%), Gaps = 1/297 (0%) Strand = Plus / Plus Query: 17 Sbjct: 1 Query: 77 Sbjct: 60 Pairwise alignment: aggatccaacgtcgctccagctgctcttgacgactccacagataccccgaagccatggca 76 |||||||||||||||| | ||| | ||| || ||| | |||| ||||| ||||||||| aggatccaacgtcgctgcggctacccttaaccact-cgcagaccccccgcagccatggcc 59 agcaagggcttgcaggacctgaagcaacaggtggaggggaccgcccaggaagccgtgtca 136 |||||||||||||||||||||||| | || ||||||||| | ||||||||||| ||| || agcaagggcttgcaggacctgaagaagcaagtggagggggcggcccaggaagcggtgaca 119 Query: 137 gcggccggagcggcagctcagcaagtggtggaccaggccacagaggcggggcagaaagcc 196 |||||||| | || | ||||||||||||||| ||||||||||| || |||||||||||| Sbjct: 120 tcggccggaacagcggttcagcaagtggtggatcaggccacagaagcagggcagaaagcc 179 Query: 197 atggaccagctggccaagaccacccaggaaaccatcgacaagactgctaaccaggcctct 256 ||||||||| | |||||||| |||||||||||||||||| |||||||||||||||||||| Sbjct: 180 atggaccaggttgccaagactacccaggaaaccatcgaccagactgctaaccaggcctct 239 Query: 257 gacaccttctctgggattgggaaaaaattcggcctcctgaaatgacagcagggagac 313 || || ||||| || ||||||||||| | |||||||||||||||||| |||||||| Sbjct: 240 gagactttctcgggttttgggaaaaaacttggcctcctgaaatgacagaagggagac 296 55 Multiple Sequence Alignment Multiple alignment: Basis for phylogenetic tree construction. Useful to find protein families and functional domains. 56 Evolution Evolution - a process in which small changes occur within species over time. These changes are mainly monitored today using molecular sequences (DNA/proteins). The Tree of Life: A classical, basic science problem, since Darwin’s 1859 “Origin of Species”. 57 Evolution Related organisms have similar DNA Similarity in sequences of proteins Similarity in organization of genes along the chromosomes Evolution plays a major role in biology Many mechanisms are shared across a wide range of organisms During the course of evolution existing components are adapted for new functions 58 Source: Alberts et al The Tree of Life 60 Phylogeny Reconstruction Goal: Given a set of species, reconstruct the tree which best explains their evolutionary history. 61 Trees are Based on What ? Darwin (Origin of Species, 1859) and his contemporaries based their work on morphological and physiological properties (e.g. cold/warm blood, existance of scales, number of teeth, existance of wings, etc., etc.). Paleontological data is still in use when constructing trees for certain extinct species (e.g. dinosaures, mammoths, moas, unicorns, etc…) Today most phylogenetic trees are based on molecular sequence data (DNA or proteins). 63 Evolution www.tomchalk.com/evolution.gif 64 Toy Example for Phylogenetic Analysis Input: four nucleotide sequences: AAG, AAA, GGA, AGA taken from four species. Question: Which evolutionary tree best explains these sequences ? One Answer (the parsimony principle): Pick a tree that has a minimum total number of substitutions of symbols between species and their originator in the evolutionary tree (Also called phylogenetic tree). AAA AAA 1 AAG 2 GGA AAA AAA 1 AGA Total #substitutions = 4 65 DNA Microarrays (Chips) 66 A Modern Use of WC Complimentarity A C binds to binds to T G AATGCTTAGTC TTACGAATCAG AATGCGTAGTC TTACGAATCAG Perfect match One base mismatch 67 Array Based Hybridization Assays (DNA Chips) Unknown sequence (target) Many copies. Array of probes 68 Array Based Hyb Assays • Target hybs to WC complimentary probes only • Therefore – the fluorescence pattern is indicative of the target sequence. 69 Microarrays (“DNA Chips”) Leading edge, future technologies (since 1988): In a single experiment, measure expression level of thousands of genes. • Find informative genes that may have predictive power for medical diagnosis. • Potential for personalized medicine, e.g. kits for identifying cancer types and prescribe “personal” treatment. 70 DNA Chips - Structure • Each chip has n“ pixels ”on it. Every pixel contains copies of a probe from a single gene . • Do m:stnemirepxe Cells in each experiment are taken from different conditions: ( different phase of cell cycle, different patient, different type of tissue etc .). • Purpose: Measure mRNA expression levels (Color coded )of all n genes in one experiment. 71 Gene Expression Matrix • Rows correspond to genes. (Typically n between 500 and 15,000). • Columns correspond to experiments. (Typically m between 10 and 200). • Entryi, j = expression level of gene i, in experiment j. 72 Algorithmic Challange Analyse the vast amount of data in gene expression matrices. Discover meaningful biological structures and functions. And now, time for a break 73