Mutations
Changes in the DNA code
Mutation
• A mutation is any change to the DNA.
The can be as simple as a single base
change (A to C) or as severe as
deleting a whole section of the DNA.
• The next pages give information on
different types of mutations in genes
and how they effect the proteins that
they code for.
Learning Objectives
• What are the different types of
mutations
• Understand how each type effects the
protein
• Be able to identify different mutations
from examples and predict their effect
on the protein
Table of Contents
• Types of Mutations
– Single Base Mutations
• Point
– Silent mutations
– Missense
– Nonsense
• Frameshift
– Addition
– Deletion
• Chromosomal
Mutations
– Inversion
– Deletion
– Translocation
Point Mutation
• A point mutation is a single change in
the DNA nucleotide sequence. The
change occurs when 1 base is
substituted for a different base.
• Another name for point mutation is
single-base substitution
• The picture above shows the last 5 codons
of a wildtype or normal mRNA. In the
normal protein the last four amino acids are
methionine, lysine, phenolalanine, glycine.
• A point mutation is a single base change.
Find the base that changed & use the
mRNA codon chart to see how it effects the
protein. (Click on the picture below to check your answer)
mRNA codon chart
?
Silent
Mutations
• In this example, the amino acid did not
change. If you look at the mRNA codon
chart you will see that the 3rd base often
has no effect on the amino acid. This is
due to the wobble theory.
• Mutations that have no effect on the amino
acid sequence are called silent mutations
Missense
• In the example below, the mutation is
still a point mutation since only 1 base is
exchanged for another.
• Find the base that changed & use the
mRNA codon chart to see how it effects
the protein. (Click to check your answer)
?
mRNA codon chart
Missense
• When a mutation occurs in the 1st or 2nd letter in a
codon it always changes the amino acid.
• This type of mutation is called missense. Even
though only 1 amino acid changed, many times this
drastically effects the way the protein folds and
works.
• The inherited disease, sickle cell anemia, is an
example of this type of mutation.
Return
Nonsense
• The last type of point mutation is called
nonsense.
• Find the base that changed & use the
mRNA codon chart to see how it effects
the protein. (Click to check your answer)
?
?
?
?
mRNA codon chart
Nonsense
• This last type of point mutation is called
nonsense because it puts a termination (stop
codon) in early, thereby cutting the amino
acid sequence (protein) short.
• This changes the protein structure and will
most likely prevent the protein from doing its
job at all.
Return
Point Mutation Self Quiz
1. Determine the mRNA and amino acid
sequence for the strand of normal DNA.
2. Determine the mRNA and amino acid
sequence for the mutated strands of DNA.
3. Compare the mutated strands to the normal
strands.
4. Identify the type of mutation which has
occurred.
Normal DNA sequence
• ATGTTGGCTTTACGGATTTTGA
• TACAACCGAAATGCCTAAAACT <--codes for protein (template)
• mRNA=
• Protein sequence=
• Notice that the DNA sequence above is double
standed, but only the bottom strand is copied into
mRNA
• Click here to check your answers
Normal DNA sequence
Answers
• ATGTTGGCTTTACGGATTTTGA
• TACAACCGAAATGCCTAAAACT <--codes for protein (template)
• mRNA= AUGUUGGCUUUACGGAUUUUGA
• Protein sequence= met-leu-ala-leu-arg-ile-leu….
• Notice that the DNA sequence above is double
standed, but only the bottom strand is copied into
mRNA
Mutant DNA
•Normal DNA:
•ATGTTGGCTTTACGGATTTTGA
•TACAACCGAAATGCCTAAAACT
• ATGTTGGCCTTACGGATTTTGA
• TACAACCGGAATGCCTAAAACT <--codes for protein (template)
• mRNA =
• Protein sequence=
• Compare this DNA sequence to the normal DNA.
– Show where the change occurs.
– What is this type of mutation called?
– Did this change cause the polypeptide sequence to
change?
– Possible consequence for the organism=
Mutant DNA #1 Answers
• ATGTTGGCCTTACGGATTTTGA
• TACAACCGGAATGCCTAAAACT <--codes for protein (template)
• mRNA = AUGUUGGCCUUACGGAUUUUGA
• Protein sequence= met-leu-ala-leu-arg-ile-leu….
• Compare this DNA sequence to the normal DNA.
– Show where the change occurs. In red above
– What is this type of mutation called? Point mutation:
silent
– Did this change cause the polypeptide sequence to
change? No
– Possible consequence for the organism= None
Frameshift Mutations
• Frameshift mutations cause the reading
frame of the codons to shift. This is caused
by the addition or deletion of one or more
nucleotides.
• When this occurs in a gene, usually the
result is such a drastic change to the protein
structure that the protein cannot work at all.
Frameshift Mutations
• An example of the shifted reading frame that
occurs from a deletion can be seen in the sentence
below:
– Original sentence:
The fat cat ate the wee rat.
– Frame shift mutation: The fat caa tet hew eer at.
• In the example sentence, a single letter was
deleted and this shifted all the letters after that
point.
• This results in a missense protein that will probably
not be able to fold correctly.
Frameshift Self Check
• For the two examples on the following
pages determine the following:
– Addition or deletion
– Use the mRNA chart to see how the amino
acid sequence is effected
– Predict whether the changes will have no
effect, minor effect, or major effect on the
proteins structure and ability to do its job.
Frameshift
Self Check
?
?
?
#1
#2
?
?
?
(Click to check your answer)
?
mRNA codon chart
Frameshift
Self Check
#1
mRNA codon chart
#2
#1: Deletion causing missense. Major effect
#2: Addition causing nonsense. Major effect
Important to note that these are just examples. Both types of
frameshift mutations can cause either missense or nonsense.
Both of these will most likely have a major effect on both the
protein structure and its ability to do its job.
Chromosomal Mutations
• Chromosomal Mutations are due to major
changes in the DNA. Click on the picture
below to see an animation of the 3 types of
chromosomal mutations
Quic kTime™ and a
TIFF (Unc ompres sed) dec ompres sor
are needed to see this pic ture.
Quic kTime™ and a
TIFF (Unc ompres sed) dec ompres sor
are needed to see this pic ture.
http://staff.tuhsd.k12.az.us/gfoster/standard/bmut.htm#one
Quic kTime™ and a
TIFF (Unc ompres sed) dec ompres sor
are needed to see this pic ture.
• The sentence below is an example of a
chromosomal mutation. Identify which
of the 3 types it is.
– Original : The fat cat ate the wee rat. Inversion
– Mutation: The fat tar eew eht eta tac.
(Click for answer)
Effect of Mutations
• In all cases that we looked at, the mutations
effected the protein itself. However, there are
many types of mutations that do not change
the protein itself but change
• where and how much of a protein is made.
– Type of cell that makes the protein
– Too much or too little of the protein is made
• When a protein is made
– made at the wrong time
Read and make notes on mutations and causes of mutations
262- 265
Learning check - #19 - 24