BACTERIAL TRANSFORMATION
Genetically Engineered Bacteria
 It’s basically how scientists and researchers manipulate genes from
one species into the genome of a bacterium
 Recall, DNA is the genetic material of all living organisms that carry
genetic code that may code for proteins.
 In this case, a genes from one kind of organism can be transcribed
and translated (protein synthesis!) when inserted into a host
bacteria... as bacteria continuously divide, the protein is
continuously produced
 For example, human genes are routinely put into bacteria in order to
synthesize products for medical treatment.
 Human insulin for diabetics, human growth hormone to treat
people of short stature caused by a known medical/genetic
condition, and vaccines
First, What is………………
•
Recombinant DNA  DNA from different sources “sliced then
spliced” together (e.g. human gene inserted into a bacterium plasmid)
• Called a transgenic organism
•
Plasmid Vector  Circular, double-stranded DNA used to transfer
foreign genes into a host bacterium
•
Bacterial Transformation  Occurs when a host bacterium, such as
E. coli, takes up a plasmid that has been engineered to contain a
foreign gene.
•
Restriction Enzymes  proteins that digest DNA at specific regions
for preparation of bacterial transformation
•
DNA Ligase  type of enzymes that reform hydrogen bonds between
nucleotide pair
**Here’s a simple
depiction of how human
insulin is produced
using bacteria
** The bacteria E. coli is
the most common
bacteria used to
produce synthetic
human insulin
**Look at numbers 1-4 in
the illustration. Notice the
terminology!
Bacterial Transformation
*This
process is pretty involved, but
here’s the basic idea. We’ll use the
production of human insulin as an
example.
Let’s Look at Restriction
Enzymes for The First Step
CTTAAG Backwards
** These enzymes recognize a
very specific, single palindrome
nucleotide sequence.
EcoRI
CTTAAG Forwards
** Palindromes are sequences
that are the same forwards as
they are backwards…like the
word racecar
Step 1: A Restriction Enzyme Cleaves
The Plasmid and Target Gene
 Restriction enzyme recognizes nucleotide sequence
specific to that enzyme
 When it recognizes the palindrome, it cuts the DNA
Restriction
Enzyme
ACTCGCGGAATTCATTACGCATCG
TGAGCGCCTTAAGTAATGCGTAGC
EcoRI
**The black
letters represent
the palindrome
recognition site
ACTCGCGG
AATTCATTACGCATCG
TGAGCGCCTTAA
GTAATGCGTAGC
** “Sticky” ends are created (the
black letters) that stick out. This
allows a gene, or other segment of
DNA, to be inserted by base-pairing
Step 2. Inserting the Gene Into
Bacterial Plasmid Vector
 The human insulin gene is inserted at the “Sticky”
ends of the plasmid at the palindrome through
base-pairing
 DNA ligase “glues” (ligates) them together
ACTCGCGG Ligase
AATTCATTACGCATCG
TGAGCGCCTTAA
GTAATGCGTAGC
**The black letters represent the binding
site of the plasmid. The white is plasmid
DNA
GAATTCGGTATCGCCTACCCG AATTC
CTTAAGCCATAGCGGATGGGCTTAAG
**The yellow nucleotides represent the
gene for human insulin (of course it is
much larger than this, but you get the
idea!).
Step 3. Host Cell (E. coli here) Takes Up The
Plasmid Vector
*NOTICE…Plasmid vector
also carries a gene that
makes them resistant to
ampicillin, an antibiotic
that kills bacteria!! This is
important in the next step,
cloning and the production
of insulin!!
Step 4. Bacteria Growth ??
**Bacteria are
spread out on petri
dishes that contain
a medium (food)
and ampicillin.
They grow,
creating clones of
themselves.
**No growth! Bacteria
were killed by ampicillin
thus contained NO
vector and NO insulin
gene
**Growth!! Bacteria were
ampicillin resistant thus
contained the vector that
carried the insulin gene!!
Step 5. Collecting Cloned Product
**Colonies that contain plasmid vector are allowed to grow, cloning
themselves. As they do so, insulin is produced as the human gene is
expressed (remember transcription and translation aka protein synthesis!!)
**Eventually, the crude protein can be extracted, purified and you’ve got
insulin!
**This is done on a much wider scale than we’ve learned here. Pharmaceutical
companies produce enough insulin for millions of Americans who have insulindependent diabetes.
In Summary……
Did You know…………..
 Approximately 3,000 restriction enzymes, recognizing over 230
different DNA sequences, have been discovered (Mostly in bacteria)
over the past 30 years!
 Also called endonucleases, some of these enzymes cleave to create
blunt ends (not sticking out). In this case, commercial cloning kits are
typically used to ligate ends of known nucleotide sequences so
target DNA can recognize a site for cloning
 Restriction enzymes are also used to create DNA fingerprints unique
to you! DNA is cut at areas, not associated with genes, that have
repeats such as AGGTAGGTAGGT, over and over but the number of
repeats differ among people. We can run these on a gel (CSI stuff)
and see their DNA fingerprint! These can be used to determine
paternity…we’ll look at this soon!!