AS EASY AS PCR PRACTICAL ACTIVITY
Introduction
Genes are composed of DNA. The DNA sequence of a particular gene can vary
because mutation generates a large number of different alleles within a species.
However, DNA sequences are inherited. Our parents pass on the DNA sequences to
us that they inherited from their parents. Therefore, by analysing the sequence of
nucleotides in the DNA of different individuals, we can assess their degree of
relationship. While we have considered this at the family level, it is also true at the
level of different races within a species or when making comparisons between
species.
In order to perform such analysis it is important to be able to isolate large amounts of
DNA for the same gene from different individuals. In 1983, Professor Kary Mullis
reported the development of a new technique called the Polymerase Chain Reaction
(PCR). Having carefully considered the normal process of DNA replication that
occurs in cells, Mullis was able to mimic the process under controlled conditions.
Rather than the DNA molecule going through a single round of DNA replication, in
PCR it goes through many cycles of replication, yielding a vast number of identical
copies.
PCR has revolutionised molecular biology. It allows us to address many problems that
could not be solved with other methods. In recognition of his groundbreaking
research, Kary Mullis was awarded the Nobel Prize in 1993.
Purpose



To observe a simulation of the PCR process.
To identify the key events in the process and how they relate to normal DNA
replication.
To consider three applications of PCR.
A Simulation of the PCR reaction


1
Click on http://www.dnalc.org/ddnalc/resources/pcr.html to locate the DNA
Learning Center at the Cold Spring Harbor Laboratory.
Click on the button to the left of the word “Amplification” to commence the
simulation. The successive steps of the PCR process can be followed by clicking
the buttons under the diagrams of the DNA molecules. Follow the simulation
through five cycles of DNA replication.
Describe the events that happen at:
A
94-96o C
B
50-65o C
C
72o C
2
Why is it necessary for the DNA to be denatured at the start of each
cycle?
3
‘The specific DNA sequence that will be amplified in PCR is determined
by the primers used’. Explain the meaning of this statement.
4
What special property does Taq polymerase have that the DNA
polymerase isolated from a mammalian cell would not have? Why is this
important?
5
What would be the sequence of the two primers that you would use to
amplify the following DNA sequence? (Your primers should both be 20
nucleotides in length.)

5’GCATCGATTGACTAGATGCATCAGCACGATGCATCTAGACTAGCA
TCTCGCGCATA-3’
3’CGTAGCTAACTGATCTACGTAGTCGTGCTACGTAGATCTGATCGTA
GAGCGCGTAT-5’

The number of DNA molecules synthesised during PCR



After viewing the five cycle results, click on the button labeled ‘Graph’. The
graph can also be reached from the main menu page by clicking the button labeled
‘Amplification Graph’.
This program allows you to plot a graph of the number of DNA copies
synthesised (vertical axis) in a given number of cycles of replication in PCR
(horizontal axis). Click on the ‘Next Cycle’ button at the bottom right. A chart at
the top left corner of the graph shows that after one cycle there are two DNA
copies.
Click on the ‘Next Cycle’ button. Each time you click this button, the total
number of DNA molecules produced after the given number of cycles of PCR will
be shown on the chart and plotted on the graph.
6
How many DNA copies are produces after 28 cycles of PCR?
7
How many DNA copies would be produced after 32 cycles of PCR?
8
The chart shows a number of ‘target copies’ of DNA produced. This
number is slightly smaller than the total number of DNA copies
produced. What is meant by the term ‘target copies’? You may need to
examine the PCR simulation again to answer this question.
B Identifying family members
DNA analysis was used to identify the recovered skeletons of the Romanov family,
the last Tsar of Russia (Nicholas), his wife (Alexandra) and three of their children.
This exercise will allow you to analyse some additional data. PCR was used to
amplify mitochondrial DNA, which was then sequenced. This was performed for each
of the skeletons recovered and for known relatives of the Romanov family. You can
follow this exercise online and answer the questions that are included.



Click on www.dnalc.org/bioforms/guide.pl?b_id=1&p_id=1 to locate the DNA
learning center at the Cold Spring Harbor Laboratory.
Click on ‘Solving the Mystery of the Romanovs’.
Answer the questions included in this exercise.
C The relationship between races
Individuals of the same race have DNA sequences that are more similar to each other
than they are to the DNA sequences from individuals of other races. Therefore, DNA
sequences can be used to determine how closely different races are related to each
other. Indeed, PCR allows us to examine how closely races that lived in the past
resemble those that populate the earth today.
Consider the story of the Ice Maiden. In 1995, high in the Andes Mountains the
frozen body of a young Incan girl was discovered. The girl had been ritually
sacrificed 500 years ago – buried alive wrapped in fine textiles and surrounded by
gold statues and bags of corn.
DNA analysis was used to compare the DNA sequence of the Ice Maiden with those
of current races living in Central and South America. You can find this described at
http://www.nationalgeographic.com/features/97/andes/
9
Where was the Ice Maiden discovered?
10
Mitochondrial DNA was chosen for analysis. Why?
11
12
From which tissue was DNA extracted?
Which current race is most closely related to the Ice Maiden?
Conclusion
16
Write a paragraph outlining the importance of PCR in solving problems
in biology and medicine.