Tuesday, August 16
Biology – the study of life
Warm-Up: For each of the groups of words below,
determine the meaning of the prefix/suffix
 Ex: tripod, triangle, trimester, tri = 3
 Biology, Biosphere, Biome
 Biology, Geology, Sociology, Criminology
 Cardiology, Cardiac, Cardiovascular
 Objective: Today we will use a worksheet to relate
previous knowledge to Latin roots.


Wednesday, August 17



Biosphere – living things and everywhere on
earth where they live
Warm-Up: Determine what the following
words are in English
Language
Word 1
Word 2
Word 3
Japanese
Inu
Neko
Saiensu
German Today
Hund
Katze
Wissenschaft
Objective:
we will use
our knowledge
of
word meanings to determine the Latin root
Latin
Canis
Feles
Scientiae
meaning.
Thursday, August 18
Antigen – a marker on a foreign body that
causes an immune response
 Warm-Up: For each Latin root, draw a
picture to represent the meaning
 BiGlychyper Audi- -emia
ex-/exo Objective: Today we will use a worksheet
to apply the meanings of Latin roots.

Friday, August 19



Trophic – feeding level of an organism
Warm-Up: Determine a meaning for each word below
based on the Latin root meanings
 Neuropathology
 Hydrolysis
 Glycolysis
 Phototropism
Objective: Today we will become familiar with the
resources in our book using a book tour WS.
Monday, August 22



Homeostasis – maintenance of
constant internal conditions
Warm-Up:
 How does the word today relate to the Latin
root meaning?
 For each meaning, give the Latin root
 To eat
double
 Cell
come together
 Single
around
Objective: Today we will play
Pictionary to review Latin root
meanings.
Wednesday, August 24
Scientific method: a method of investigation
involving observation and theory to test scientific
hypotheses
 Warm-Up: What does it mean to be independent?
Dependent?
 Objective: Today we will use examples and a
worksheet to distinguish between independent and
dependent variables in a lab.

Thursday, August 25
•Hypothesis: proposed answer to a scientific question
•Warm-Up: Come up with 2 to 3 sources of error in this
experiment
1) Obtain sample of unknown
liquid. Note physical
properties such as odor,
viscosity and/or color.
2) Record the mass of clean,
dry 10.00mL volumetric flask
and stopper.
3) Carefully transfer unknown
liquid to volumetric flask. Fill
to mark exactly in stopper
flask.
4) Measure mass of filled flask.
5) Empty and dry flask.
6) Repeat step 2-5 for
additional liquid sample.
Objective: Today we will
distinguish between
different graphs using an
M&M graphing activity
and PPT.
Friday, August 26




Independent Variable: the condition that is manipulated or
changed by the researcher
Read the example and determine the independent
variable, dependent variable, and control (if any).
A researcher wanted to know whether the number of
people present (10, 25, or 50) would influence subjects'
judgments on a simple perceptual task. In each case the
other members of the group gave an incorrect
answer. The researcher then noted whether the subject
conformed to the group decision.
Objective: Today we will use the information we have
learned about labs and our books to design a lab.
Monday, August 29
Theory: a proposed explanation for a wide
range of observation and experimental
results that is supported by evidence
 Warm-Up: On a separate sheet of paper,
write an introduction for the soap bubbles
lab. The introduction should include:

 What are we showing in the lab/the purpose?
 How are we going to do the lab?
 What do you already know about dish soap/bubbles that
might help you in the lab?

Objective: Today we will apply the
scientific method through our lab report
Tuesday, August 30



Dependent Variable: the condition that is
measured or observed in an experiment
Warm-Up: Bart is testing to see what type of
noise scares Lisa the most. He chooses noises
and then at times she is least suspecting blares
one really loud and looks at how high she jumps.
What would be the independent variable?
Dependent? What would be something that
could be a constant/control?
Objective: Today we will distinguish between
independent and dependent variables using our
quiz.
Wednesday, August 31
Biotechnology: the use and application
of living things and biological processes
 Warm-Up:
 How might Biology today be different
than in 1811? 1911? 1991?
 Objective: Today we will discuss themes
in Biology and living organisms using
discussion and PPT notes.

Thursday, September 1



Element: any material made up of only one
type of atom
Warm-Up:
 Give an example of how structure is related
to the function of things.
 What characteristics are shared by all
living things?
Objective: Through your notes, differentiate
between theories and hypothesis and explain
how technology has changed biology.
Tuesday, September 6



Compound: atoms of different elements bonded together
Warm-Up:
 If plants can make their own food using the sun, why might this
plant eat a frog?
Objective: Today we will discuss properties of molecules, focusing
on water, using our notes.
Wednesday, September 7



Polar: compounds with slightly charged regions
Warm-Up:
 Explain the difference between acids and
bases
 List and describe the 3 properties of water
created by hydrogen bonding
Objective: Today we will do a lab to investigate
the properties of water and difference between
acids and bases.
Thursday, September 8



Organic: characteristic of, pertaining to, or
derived from living organisms
Warm-Up:
 Cells have a higher H+ concentration than
blood. Which has a higher pH? Why?
 Why are hydrogen bonds so important for
water?
Objective: Today we will create a poem based
on the properties of water and pH.
Friday, September 9
Catalyst: substance that speeds up
chemical reactions
 Objective: Today we will create a poem
based on the properties of water and pH

Monday, September 12



Substrate: specific reactants an enzyme acts on
Warm-Up:
 What do you think is the pH of your blood? Why?
 Why is water so important for living things?
Objective: Today we will compare and contrast the 4
carbon based molecules using a Venn Diagram and
notes.
Tuesday, September 13
Enzyme – protein that speeds up reactions in living
organisms
 Warm-Up:
 What is one similarity between the 4 carbon based
molecules?
 What is unique about each of the four?
 Objective: Today we will simulate enzymes working
using our toothpick lab.

Wednesday, September 14



Endothermic: chemical reaction that absorbs more energy
than it releases
Warm-Up:
 Why is temperature important for proteins?
 What happened to your rate of reaction during the 3
minutes of breaking toothpicks? Why do you think that
happened?
Objective: Today we will explain how enzymes function
using a lab report and notes.
Thursday, September 15
Exothermic – reaction that releases more
energy than it absorbs
 Warm-Up:

 Explain how monomers and polymers are related
 Give 2 examples of monomers and polymers

Objective: Today we will use a WS and
study guide to review information on
biochemistry and the basics of biology.
Monday, September 19
Prokaryotic: cells without a nucleus or
membrane bound organelles
 Warm-Up:

 How does the size of a cell in a tadpole compare to
the size of a cell in a blue whale?
 What makes a whale so much larger than a
tadpole?

Objective: Today we will compare and
contrast prokaryotic and eukaryotic cells
using our notes and Venn Diagram
Tuesday, September 20
Eukaryotic: cells with a nucleus and
membrane bound organelles
 Warm-Up:

 Give an example of a prokaryotic and eukaryotic
cell.
 What do all cells have in common?

Objective: Today we will explain the
function of organelles using our notes and
an analogy.
Wednesday, September 21


Organelle: structures specialized to perform
distinct processes within a cell
Warm-Up: Give the function for each
organelle below






Mitochondria
Lysosome
Chloroplast
Ribosome
Nucleus
Objective: Today we will create analogies
that represent the organelles in a cell using
our knowledge from the notes and books.
Thursday, September 22


Golgi apparatus: processes and packages
proteins
Warm-Up: My cell is like a country, which
organelles would each of the following be…







Government/Constitution
Sanitation Department
Highways
Power Plants
Solar Power Plants
Customs Officials/Border Patrol
Objective: Today we will study how
organelles work and what they looks like
using a Cell WebQuest.
Monday, September 26


Mitochondria: supply energy to the cell
Warm-Up: Starting in the nucleus, place the
structures in order to get a finished protein.







Golgi Apparatus
Endoplasmic Reticulum
Nuclear Pores
Vesicle
Ribosome
Cell Membrane
Objective: Today we will use a lab mystery to
distinguish between plant and animal cells
under the microscope.
Tuesday, September 27
Selective permeability: only certain things
are allowed to pass through
 Warm-Up:

 What property do water molecules have?
 What are some things you can use to distinguish
between plant and animal cells?

Objective: Today we will describe the
structure of a cell membrane and how
things move across it using our notes.
Wednesday, September 28
Diffusion: movement of molecules in a
fluid or gas from a region of higher
concentration to a region of lower
concentration
 Warm-Up:

 Draw the structure of the cell membrane.
 Why does the fluid mosaic model apply to the cell
membrane?

Objective: Today we will explain the
difference between active and passive
transport using our notes and review
questions.
Thursday, September 29
ATP: molecule that transfers energy from
the breakdown of food molecules to cell
processes
 Warm-Up:

 What are 3 differences between active and passive
transport?
 Give an example of each.

Objective: Today we will observe and
analyze the functioning of organelles
through our lab.
Monday, October 3
Concentration gradient – difference in
concentration of a substance from one
location to another
 Warm-Up:Explain how the following terms
are related

 Eukaryotic and prokaryotic
 Diffusion, facilitated diffusion
 Phospholipid, cell membrane

Objective: Today we will review key
concepts about Cells using our Review
WS.

Objective: Today
we will explain
how we get
energy from
foods using our
notes and white
boards.

Warm-Up:
 What cellular
activities require
energy?
 Do energy drinks
and power bars do
something different
from any other food
that you eat?
Chemosynthesis: use of
chemical energy instead
of light energy to make
energy-storing
molecules
 Warm-Up:

 What does a producer do
in film, radio, tv, etc?
 How does that relate to
plants being considered
producers?

Objective: Today we
will explain
photosynthesis using
a diagram and lecture
notes.
Friday, October 12

Place the numbered items in the
order they would occur during
photosynthesis:
1. Water molecules are broken
down
2. Energy from NADPH and ATP
is transferred to the Calvin
cycle
3. Sunlight is absorbed by
chlorophyll
4. Carbon dioxide is converted
into glucose
5. Oxygen is given off as a
waste product


ATP synthase:
enzyme that
adds a phosphate
group to ADP
Objective: Today
we will analyze
photosynthesis
using our
pictorial and
summary
questions.
Friday, October 14
Producer: organism that creates its own
chemical energy
 Warm-Up:

 Why did only the chloroplasts in light change color
in yesterday’s lab?
 If there are other pigments of different colors, why
are plants typically green?

Objective: Today we will explain how
cellular respiration works using notes and
a diagram.
Fermentation: process that allows glycolysis to
continue without oxygen
 Warm-Up:
 What goes into and comes out of the light
dependent reactions? Where do they take
place?
 What goes into and comes out of the light
independent reactions? Where do they take
place?
 Objective: Today we will explain cellular
respiration using our notes and drawings.



Aerobic: requiring oxygen
Fill in the table:
Process
Goes In
Comes Out
Glycolysis
Krebs Cycle
Electron Transport
Chain

Objective: Today we will contrast what happens
with and without oxygen using our notes..
Thursday, October 18
Cellular respiration: process that releases
chemical energy from sugars to make ATP
 Warm-Up:

 What type of cells use cellular respiration?
 What is the oxygen used for in cellular respiration?

Objective: Today we will evaluate
photosynthesis and respiration using our
writing prompts.


Warm-Up:
 Cancer cells are considered immortal, what do
you think that means?
 What can you infer about how cell division in a
normal cells, then, compares to cell division in a
cancer cell?
Objective: Today we will demonstrate what stem
cells are and how they can be used using our Stem
Cell Activity online.
Tuesday, October 23
Cell Cycle: regular pattern of growth, DNA
duplication, and cell division that occurs in
eukaryotic cells
 Warm-Up: What do you think is the life span
for the following cells?

 Skin cells, red blood cells, liver cells, intestine lining,
intestine muscle

Objective: Today we will describe the stages
of the cell cycle using notes and questions.
Wednesday, October 24
Mitosis: division of the cell nucleus
Warm-Up:
 Briefly explain what happens in each
step of interphase.
 Objective: Today we will trace the steps of
the cell cycle using notes and a foldable
cell.


Thursday, October 25
 Cytokinesis:
 Warm-Up:
division of the cytoplasm
 What makes you who you are?
 Why are your kidney cells and heart
cells different?
 Objective: Today we will create skits
to demonstrate the process of mitosis.
Monday, October 29
Chromosome: long continuous thread of
DNA that has numerous genes and
regulatory information
 Warm-Up:

 What is a stem cell?
 Why might they be important for scientific
research?

Objective: Today we will explain what
stem cells are and how they are used by
summarizing our activities.
Tuesday, October 30
Tissue – groups of cells that work together
to perform a specific function
 Warm-Up: Grab your device for the
Mitosis Quiz
 Objective: Today we will discuss asexual
reproduction using our notes and
discussion.

Friday, October 28
Organ – group of tissues that work
together to perform related functions
 Warm-Up:

 Describe 3 types of asexual reproduction.
 When is it beneficial to use asexual reproduction?

Objective: Today we will review key
concepts about cells using a practice test.
Monday, October 31
 Somatic
Cells – body cells
 Warm-Up: Halloween Trivia
 Best selling candy?
 How much $ is spent on candy each year in the US?
 What percent of kids go trick or treating or do some
Halloween activity?
 Objective: Today we will review cells using a study guide
and word connections.
Friday, November 2
Gamete – sex cells; sperm and egg
 Warm-Up:

 How are sex cells (sperm and egg) different than
other cells?
 What role do sex cells play in humans?

Objective: Today we will compare mitosis
and meiosis and explain the steps of
meiosis through our notes and video.
Tuesday, November 6



Diploid: a cell that contains two copies of each
chromosome
Warm-Up: Fill in the Venn Diagram comparing
gametes and somatic cells
Objective: Today we will compare mitosis and
meiosis and simulate meiosis using our activity.
Gametes
Somatic
Cells
Wednesday, November 7
Haploid: cell containing only one
copy of each chromosome
 Warm-Up:
 Going into meiosis I, how many
chromosomes are there in a
human sex cell? How many are at
the end of meiosis I? Meiosis II?
 Why is crossing over important?
 Objective: Today we will explain
meiosis by creating skits.

Thursday, November 8
Genotype: the actual alleles present for a particular trait
Objective: Today we will use the lecture to analyze Mendel’s
contribution to genetics and review the process of meiosis.
Warm-Up: Determine if the following statements are true or false.
Meiosis has the same
number of divisions as
mitosis
 Meiosis occurs in all types
of cells
 Mitosis and Meiosis both
start with sister chromatids




Sister chromatids have
identical DNA
Homologous pairs have
identical DNA
Both mitosis and meiosis
allow for genetic variation
Friday, November 9



Phenotype: the physical appearance of an
organism
Warm-Up: Make two columns on your paper,
one labeled gene the other allele. The place the
following terms in the column you think they go
in.
 Hair color, low cholesterol, plant height, brown
hair, long tail, tail length, purple flowers,
cholesterol level, flower color, tall plant
Objective: Today we will distinguish
dominant and recessive using notes and an
activity.
Tuesday, November 13



Carrier: does not show disease symptoms
but can pass the disease causing allele on
to offspring
Warm-Up:
 What did Gregor Mendel discover about
genetics?
 Blood type can be AB, A, B, or o. What
would be the gene and what would be the
alleles for this trait?
Objective: Today we will use our
inheritance activity to predict patterns and
determine genotype.`
Wednesday, November 14



Crossing over: homologous chromosomes
pair up during prophase I and exchange
pieces of genetic information
Warm-Up: Black Fur is dominant to gray fur
 Write the genotype for gray fur
 Write the genotype for black fur
 Try to set up a Punnett Square to show a
cross between a homozygous black mouse
and a gray mouse.
Objective: Today we will use a Punnett Square
group activity and notes to explain how traits
are inherited.
Thursday, November 15
Sex-linked genes: genes located on the sex chromosomes
Warm-Up:
 Cystic Fibrosis (CF) is a disorder caused by a recessive
allele. If 2 parents are carriers for the disorder, what are
the odds they will have a child with CF?
 In pea plants, yellow peas (G) are dominant over green
peas(g) and smooth (H) over wrinkled (h). A pea plant
heterozygous for both traits is crossed with a pea plant
homozygous dominant yellow and wrinkled. What are
the possible combinations for the gametes for each? (We
haven’t covered this yet, just take a guess!)
 Objective: Today we will show how we can use Punnett
Squares to selectively breed using our activity.


Tuesday, November 15
Incomplete dominance: neither allele is
completely dominant or recessive and
heterozygous phenotype is in the middle
 Warm-Up

 Duchenne Muscular Dystrophy is a sex-linked recessive
disorder. If a mother unknowingly carries the gene and
marries a man who does not have the disorder, what is
the probability they will have a child with MD?
 Why are the odds above higher in boys than girls?

Objective: Today we will apply inheritance
patterns for incomplete, codominance, and
multiple alleles using Punnett Squares.
Wednesday, November 16
Independent assortment – different traits are
inherited separately
 Warm-Up:

 A woman is heterozygous for Type A blood and her
husband is homozygous for Type B blood. Set up the
Punnett Square.
 What are the possible blood types for the children?
 What percent of the children would have the same
phenotype as the mother?
 What percent would have the same genotype as the
father?

Objective: Today we will review Mendel and
Punnett Squares using collaboration and by
designing a species with various traits.
Monday, November 26


Incomplete dominance – the heterozygous
phenotype is somewhere between the
homozygous phenotypes
Warm-Up:
 What does it mean that Mendel looked at either-or
traits?
 What are some traits that do not work in the either-or
idea?
 Having a widow’s peak is a recessive trait. If a man
heterozygous for a widow’s peak marries a woman
homozygous recessive with a widow’s peak, what are
the genotypic and phenotypic ratios?

Objective: Today we will predict outcomes of
crosses for sex-linked and polygenic traits using
our notes and practice problems.
Wednesday, November 28

Codominance – both traits in
an organism are fully and
separately expressed

In the pedigree to the right,
which female is least likely
to be a carrier for the
disorder (individuals with
the disorder are shaded in).
III-1, III-3, or III-5. Why?

Objective: We will use notes
and a listen and sketch to
create pedigrees and study
inheritance.
Thursday, November 29
Polygenic: trait controlled by two or more
genes
 A test was done to determine the biological
father of a child. The child’s blood is Type A
and the mother’s is B. Dude #1 has blood
type O and due #2 has blood type AB.

 Which is the biological father?
 How do you know?

Objective: Today we will create pedigrees
using a listen and sketch and review the
main ideas of genetics using our study
guide.
Wednesday, January 5
Pedigree – chart that shows family genotype
and phenotype
 Warm-Up:

 Review – what is the phenotypic ratio of a heterozygousheterozygous dihybrid cross? (From Ch. 6)
 There are 3 genes on a chromosome, A, B, and C.
 A and B cross over 6.0% of the time,
 B and C, 12.5% of the time
 A and C, 18.5% of the time
 From this information, see if you can determine what order
the genes are located on the chromosome.

Objective: Today we will create a pedigree
using information from a family story.
Thursday, January 6
Genes 1,2,3,&4 are linked, what
does that mean?
 Place the genes in order using the
following:







Genes 1 & 2 cross over 20% of the time
Genes 1 & 3 cross over 13%
2 & 3 7%
2 & 4 25%
1 & 4 45%
Objective: Today we will research a
genetic disorder using credible
internet sites.
Tuesday, January 11



Nucleotide: monomer; smaller unit that
makes up DNA and RNA
Hemophilia is a sex-linked recessive disorder.
If a woman is a carrier and a man has
hemophilia, show the cross between the two.
What percent would have hemophilia? What
percent would be carriers?
Objective: Today we will use Punnett Squares
to predict how traits are inherited through
incomplete and codominance.
Wednesday, January 12
Bacteriophage – virus that injects its DNA into
bacteria and take over the cell
 Warm-Up: Two Clown fish, one Yellow and
one Red, have baby clown fish that are an
intermediate phenotype.
 What are the genotypes of the parents?
 Show the Punnett Square
 What would be the outcome if this were
incomplete dominance? Codominance?
 Objective: Explain how different alleles can
predict inheritance using Punnett Squares and
worksheets.

Monday, December 3
Word of the Day:
 Transcription: process of copying a strand of DNA to
produce a complementary strand of RNA
 Warm-Up:
+-*@@*--+@**++- (Template 1)
-+@**@++-*@@--+ (Template 2)
 Template 1 and 2 pair up, based on that information,
what would template 2 look like for the following
strand?
+++-@*@@*+@--** (Template 1)
 Objective: Today we will analyze the discovery and
structure of DNA using lecture notes.

Tuesday, November 29
Nucleotide – monomer that makes
up DNA
 Warm-Up:

 Who was the first to discover that DNA is
the transforming principle?
 Who discovered the transforming principle?
 What did Hershey and Chase use to confirm
that DNA was the transforming principle?

Objective: Today we will trace the
steps for DNA replication using
notes, manipulatives, and questions.
Wednesday, November 30



Double helix: two strands of DNA wind around each
other (like a twisted ladder)
Warm-Up:
 Why is DNA replication important?
 What are the 3 parts of a nucleotide? Which part
allows for the differences in everyone’s DNA?
Objective: Today we will investigate transcription
and translation through a video and coloring WS.
Wednesday, December 5
*If weren’t finished with your warm-up sheet and it
is turned in, just do this on a separate paper and
you can transfer it later!
 Base pairing rules – adenine pairs with thymine
and guanine pairs with cytosine
 Warm-Up: Write what strand 2 would be for the
following DNA sequence.
 AATCGCTACAGTGAC
 What would happen to DNA replication if there
were no enzymes?
 Objective: Today we will analyze transcription
and translation using a video and worksheets.
Friday, December 2


DNA Polymerases – group of enzymes that
bond new nucleotides together
Objective: Today we will use base pairing
rules and lecture information to transcribe
and translate a DNA sequence.
Thursday, December 6


In your notes!!!
Write the list below in your notes, then put
next to each one what structure it relates to
in the cell.
 Chefs
 Castle
 Recipe Book
 Recipes
 Ingredients
 Monk
 Cop
Thursday, December 13





Objective: Today we will apply the information on
DNA using our quiz.
Transcription – process of copying a sequence of DNA
to produce a complementary strand of RNA
Warm-Up
Transcribe and Translate the following DNA
sequence:
AATTACGCGAGTGAGCGCTACACT
 mRNA = UUAAUGCGCUCACUCGCGAUGUGA
 Amino acids= MET-ARG-SER-LEU-ALA-MET-STOP
Tuesday, December 6
Objective: Today we will distinguish
between types of mutations using our
devices and review questions.
 mRNA: brings information from the DNA to
the cell to be turned into proteins
 Warm-Up: Transcribe and Translate the
following sequence

 DNA: AATCGGATAGCCCAT
 mRNA:UUAGCCUAUCGGGUA
 AA: Leu-Ala-Tyr-Arg-Val

What should be at the beginning and end
of the amino acid sequence?
Monday, February 7
 Restriction
Enzymes – cut DNA at
specific nucleotide sequences
 Warm-Up: What were your thoughts
on the video from Friday?
 Objective: Using information from
the video and your own knowledge,
discuss the pros and cons of genetic
engineering.
Tuesday, January 8
Transgenic – containing genes from more
than one organism
 Warm-Up:
 You are a watermelon grower and want
to stop a pest from consuming your
watermelon. What are some possibilities
for accomplishing this?
 Objective: Today we will explain what
genetic engineering is and how it is used
with our notes and discussion.

Thursday, December 8



Recombinant DNA – contains genes from more than
one type of organism
Warm-Up:
 How can biotechnology reunite families?
 How does a child’s DNA compare with the DNA of
his or her parents?
Objective: Today we will use information from the
book or lecture PPT to explain how genetic
engineering works and how it can be applied.
Thursday, January 10

Plasmid – closed loops of DNA found in bacteria
that replicate on their own

Warm-Up:
 Explain why a liger would be considered a
transgenic organism
 Give 3 examples of how we use biotechnology
in everyday applications

Objective: Today we will trace the steps of
genetic engineering using a video and by
creating posters.
GE Posters
Process of genetic engineering
 Uses for genetic engineering
 Pros/Cons (at least 2 of each)

Display using pictures
 No more than 10 words on the poster!
 Neat/Creative/Colorful/Easy to follow

Monday, January 14
Recombinant DNA – contains genes from
more than one type of organism
 Warm-Up: How are restriction enzymes
used to make both recombinant DNA and
transgenic organisms?
 Objective: Today we will use our review
worksheet and posters to explain the
concepts of genetics.

Wednesday, January 16
Species – group of organisms similar
enough to reproduce and have fertile
offspring
 Group the following animals based on
similarities. You must have at least 2
groups and at least 2 animals in each
group.

 Cockatoo, hummingbird, ant, sparrow, bee, marlin,
toucan, crab, lobster

Objective: Today we will explain the
relationship between different scientific
articles using our jigsaw activity.
Thursday, January 17
Evolution – process of change where descendents
come to differ from their ancestors
 Warm-Up:
 Choose 1 of the articles from yesterday and
explain how it relates to evolution.
 Objective: Today we will explain the difference
between variation and adaptation and define
natural selection using our notes and scenarios.

Friday, January 18
Adaptation- a variation or trait that allows
an animal to better survive in its
environment.
 Using the animal card you have, explain a
variation and adaptation for that animal.
 Objective: Today we will analyze how
adaptations work using our beak lab.

Tuesday, January 22
Homologous structure: features with similar
structure but different function
 Warm-Up:
 How does the beak lab from Friday relate to
variation and adaptation?
 Objective: We will apply the principles of
natural selection to an animal using a
scenario and by designing a lab.

Wednesday, January 23


Vestigial Structure: remnants of organs or
structures that had a function in earlier
ancestors
Choose one of the organisms below, come up
with a situation where natural selection could
take place. Give specifics as to what the
selection was and what caused it.
 Organisms: Panda’s teeth, gray whale’s fin size,
foxes’ tail, mouse’s color, crab’s shell

Objective: Today we will apply the principles of
natural selection using our lab.
Thursday, January 24
Analogous structure – structures with
similar functions but different structure
 Warm-Up: Apply the 4 principles of
natural selection to one of the following
animals: Shark, Whale, Jellyfish, Stingray
 Objective: Today we will evaluate the
evidence behind the theory of evolution
using our notes and opinion statement.

Tuesday, January 10


Warm-Up: Explain the similarities and
differences between the following terms:
 Homologous and analogous structure
 Adaptation and descent with
modification
Objective: We will explain the principles
of natural selection using our quiz
answers.
Monday, January 28


Gene pool – the combined alleles of all individuals in a
population
Warm-Up –
 Do you see variation within this population?
 What would happen if there were no variation?
 How might this population change if Antarctica became warmer?
Objective: Today we will analyze what allele frequency is and how it
can change with notes and an activity.
Wednesday, January 30



Directional selection – one extreme of an
organism’s phenotype is favored
Warm-Up: Rabbit fur color is determined by
dominant (Black) and recessive (white) alleles. If
you have a population with 5 white rabbits and
10 black rabbits, half heterozygous and half
homozygous dominant, what is the allele
frequency for each allele?
Objective: We will demonstrate how harmful
alleles can stay in a population using our lab
activity.

Today we will distinguish between
the 3 types of natural selection using
lecture, response devices, and mini
posters.
Thursday, January 31


Allele frequency – measure of how common an
allele is in a population
Warm-Up:
 What creates the genetic variation necessary for natural
selection to take place?
 If medium sized sharks were advantageous for survival, what
would you expect to happen to the population of sharks over
several generations?

Objective: Today we will explain how deadly
traits can be maintained in a population using
our lab activity.
Tuesday, January 17



Disruptive selection – both extreme phenotypes are
favored, the middle becomes less common
Warm-Up:
 Is it possible for an allele that is harmful to stay
in a population? Why or why not?
 If I toss a coin, what is the probability of tossing
heads or tails? Would I see that ratio better in 6
tosses or 60?
Objective: Apply the principles of natural selection
by creating a new species adapted to its
environment.
Friday, February 1
Gene flow – movement of alleles from one
population to another
 Warm-Up:

 What effect has immigration had on the genetic
variation in the US?

Objective: Today we will explain how gene
flow, genetic drift, and sexual selection
can lead to evolution of population
through notes and discussion.
Monday, February 4



Genetic drift – changes in allele frequencies
due to chance
WarmUp
 Give an example of genetic drift
 Why are small populations more susceptible
to genetic drift?
 Explain the difference between genetic drift
and evolution.
Objective: Today we will use the notes and
create examples to describe evolution
patterns.
Tuesday, February 5
Convergent evolution – evolution of
similar characteristics in unrelated species
 Give an example of coevolution.
 Objective: Today we will apply the ideas
of evolution to various animals using our
review questions and key concepts.

Thursday, February 7
Divergent evolution – two related species
become different
 What were 3 interesting things you
learned from the Life movie?
 Objective: Today we will apply the
concepts of evolution using our written
response questions.

Monday, February 11



Word: capsid – protein shell surrounding a
virus
Warm-up: What causes sickness?
Objective: Today we will analyze how
disease can spread and where pathogens are
found using our activities.
Wednesday, February 13
Word:
 Vaccine: substance that stimulates the body’s
immune response against invasion by
microscopic particles
 Warm-Up:
 What are some defense mechanisms your body
uses to keep out/get rid of germs?
 Objective: Today we will compare various
pathogens using notes and discussion.

Thursday, February 14
Obligate anaerobe – bacteria that are poisoned by
oxygen
 Warm-Up: Create a Venn Diagram to compare
and contrast the lytic and lysogenic cycles for
viruses.
 Objective: Today we will analyze the structure of
various organisms and compare them to bacteria
using our microscope lab.

Bacteria Microscope Data
Organism
Hypothesis –
Draw what you
think it will look
like
Actual Drawing
(under 100x or
400x
magnification)
Observations/
Description
Friday, February 3
Obligate aerobe – requires oxygen to
survive
 Warm-Up

 What are 3 ways that we classify bacteria?
 How do bacteria cause disease?

Objective: Today we will compare
diseased and healthy tissue using our
microscope lab.
Thursday, March 17

Warm-Up: Using your information and
talking with those around you, determine
which person/cup # you think started with
the virus, then answer these questions.
 Would this virus spreading most likely resemble a
lytic or lysogenic infection? Why?
 Why is washing your hands important to keep from
spreading an illness?
 What is your first line of defense against any
pathogen? What are some ways viruses can get past
that?

Objective: Use the movie to relate
pathogens to your immune system.
Monday, February 25
Word: humoral immunity – immune response
that depends on antibodies
 Warm-Up:
 What are some signs that you are getting sick?
 Why do you get tired when you are sick?
 Objective: Today we will evaluate the scientific
method as it applies to our lab reports.

Introduction

This lab looks at the effects of variation
and adaptation in beaks on a bird
population trying to pick up seeds. We
have discussed variation and adaptation in
class. Variation is the different options
within a population for a given trait, while
adaptation is the variation that is best
suited for survival. Our procedure will use
a variety of bird “beaks” to pick up seeds
and try and determine which one is the
most successful, thus best for survival and
the adaptation for the birds.
Tuesday, February 26
Germ theory – specific microorganisms
cause disease
 Warm-Up:

 What are some causes of disease?
 Are all diseases able to be passed from one person
to another?

Objective: Today we will discuss what
causes illness in your body using a video,
WS, and notes.
Thursday, February 28

Cellular Immunity – immune response
involving T cells; used against viruses

Warm-Up: Contrast the various
pathogens we discussed yesterday.

Objective: Distinguish between cellular
and humoral immunity using our notes,
devices, and questions.
Monday, March 4
allergy – oversensitivity to a normally harmless
antigen
 Warm-Up: List 2 nonspecific defenses your body
can use against pathogens.
 Objective: Today we will create a skit
demonstrating the immune response for various
pathogens.

Tuesday, March 5
Phagocyte – white blood cell that engulfs
pathogens, a type of macrophage
 Warm-Up:
 What role do phagocytes play in cellular
immunity?
 What are some ways you can be immune from a
pathogen?
 Objective: Today we will demonstrate how the
body responds to pathogens using our skits.

Wednesday, March 6
Autoimmune disease – failure of the body to
recognize healthy and diseased cells
 Warm-Up:

 Trace the steps for humoral and cellular immunity.

Explain how the immune system functions using
our quiz.
Thursday, March 7
Anaphylaxis – extreme swelling due to
large amount of histamine
 Warm-Up:

 Why are opportunistic infections called
opportunistic?
 Why is HIV so hard to fight?

Objective: Today we will analyze key
concepts about the immune system and
pathogens using our review game and
study guide.
Friday, March 8
Alveoli – tiny air sacs where gas
exchange takes place in the lungs
 Warm-Up: Can a person die from
holding their breath? Why or why not?
 Objective – Today we will explore how
the respiratory/circulatory system work
by creating a comic book with our
research.

Monday, March 11
 Diaphragm
– dome shaped muscle at
the base of the rib cage that helps with
breathing
 Warm-Up: WHY is smoking bad? What
is it doing in our body that can cause
problems?
 Objective – Today we will distinguish
and relate the respiratory and
circulatory systems using our Power
Notes and diagrams.
Thursday, March 14
 Arteries
– carry blood away from the
heart
 Warm-Up: How do the respiratory and
circulatory systems function together
to maintain homeostasis?
 Objective – Today we will determine
main ideas about the respiratory and
circulatory systems using discussion
and listen and sketch.
Monday, February 27
Veins – blood vessels that carry blood
toward the heart
 Warm-Up:

 When is pressure the greatest in the lungs?
 How do the diaphragm and rib cage help create this
pressure?

Objective: Today we will explain how gas
exchange takes place in the lungs using
our notes and discussion.
Friday, March 15
Hemoglobin – iron-rich protein molecules
in red blood cells that carry oxygen
 Warm-Up:

 Trace the flow of oxygen from the air to the blood
 The left ventricle is the largest chamber of the
heart. How is its size related to its function?

Objective: Today we will explain the
structure and function of the circulatory
system using our discussion and activities.
Wednesday, February 29
Atrium – smaller, top chambers of the
heart; pump blood to ventricles
 Warm-Up:

 Explain the difference between systolic and diastolic
blood pressure.
 Why does narrowing of the arteries increase blood
pressure?

Objective: Today we will analyze heart
health using our BP lab and review
assignment.
Thursday, March 1
Ventricle – larger, lower chambers of the
heart; pump blood to lungs and body
 Warm-Up:

 What happened to your blood pressure after lying
down? After exercising? Why?

Objective: Today we will diagram how the
heart and lungs maintain oxygen levels in
the body using a pictorial.
Monday, March 18
Lymphatic system – complex network of
organs, vessels, and nodes that helps in
circulation
 Warm-Up:

 Starting in the brain, trace the blood’s route
through the body.

Objective: Today we will explain the
function of the lymphatic system using our
books and study guide.
Tuesday, March 19
Platelets – cell fragments that help in
blood clotting
 Warm-Up: Explain how the lymphatic
system works with both the circulatory
and immune systems.
 Objective: Today we will explain how the
respiratory and circulatory systems
function using our pictorial.

Wednesday, March 7
Tissue – group of similar cells working
together
 Warm-Up:

 What are some examples of tissues in your body?
 What are some examples of organs?

Objective: Today we will explain how cells
are organized and the difference between
positive and negative feedback loops
using notes, devices, and a WS.
Wednesday, March 20
Organ – group of tissues working together
 Warm-Up: Give an example of a positive
or negative feedback loop.


Objective: Today we will analyze how the
nervous system works our notes and discussion.
Friday, March 9
Homeostasis – set of internal conditions
that need to be maintained for best
survival
 Warm-Up:

 What have you discovered about your nervous
system from the activities you have done?

Objective: Today we will analyze how the
nervous system works using various
activities.
Thursday, March 21
Central nervous system – brain and spinal
cord
 Warm-Up:

 What causes you to sweat and your pupils to dilate?
 How is that related to the nervous system?

Objective: Today we will explain how
signals travel in the nervous system using
our notes and activities.
Friday, March 22
Peripheral nervous system – the nerves
leading to and from the spinal cord
 Warm-Up:

 Write the steps for a neuron to transmit an impulse.
 Why does the nervous system use both electrical
and chemical signals?

Objective: Today we will analyze how our
nervous system works using our olfactory
lab.
Monday, March 25
Hormones – chemical signals made by
glands of the endocrine system and
released into the blood stream
 Warm-Up:

 Create a Venn diagram comparing and contrasting
the endocrine and nervous system.

Objective: Today we will explain how the
endocrine system and nervous system
function using our notes.
Tuesday, March 20
Glands – organs that produce hormones
and release them into the blood stream
 Warm-Up:

 Why is the bloodstream a good means for
transporting hormones such as growth hormone?

Objective: Today we will distinguish
between the nervous and endocrine
system using our notes.
Tuesday, March 26
Resting potential – state of a neuron when
it contains the energy needed to transmit
an impulse
 Warm-Up:

 What are some body processes that are influenced
by the endocrine system?
 Why don’t hormones affect all cells?

Objective: Today we will review the
systems of the body using our review
questions.
Thursday, March 28
Community – a group of different species
that live together in one area
 Warm-Up: Brainstorm

 What do you think of when you hear the word
ecology?

Objective: Today we will learn how to use
Prezi using our example and questions.
Monday, April 8
Ecosystem – all the organisms and
nonliving things in a given area
 Warm-Up:

 Create a food chain using 3 organisms

Objective: Today we will explain how we
classify things in ecology using our notes
and devices.
Wednesday, April 10
Keystone species – species that has an
unusually large effect on its ecosystem
 CA Standards Review pgs. 4,6,8
 Objective: Today we will explain how
energy flows within an ecosystem using
our notes and food web posters.

Thursday, April 11
Autotroph – organisms that make their
own food
 Warm-Up: Pgs. 10, 12
 Objective: Today we will create a food
web using our story and posters.

Friday, April 12
Heterotroph – organism that must eat
different food for energy
 Warm-Up: Review pgs. 14, 16
 Objective: Today we will analyze changes
in a population based on predator prey
relationships using our lab.

Monday, April 15
Niche – specific factors within a habitat
that an organism needs to survive and
reproduce
 Warm-Up: Review pgs. 18 & 20
 Objective: Today we will analyze
predator-prey relationships using our lab.

Tuesday, April 16
Symbiosis – close relationship between
two organisms of different species that
live in direct contact
 Warm-Up: Review pgs.22-26
 Objective: Today we will explain the
cycles using our diagrams.

Cycles Vocab
Water Cycle (Blue):
 Precipitation
 Condensation
 Evaporation
 Transpiration
 Run-off
Nitrogen Cycle (Brown):
 Nitrogen fixation
 Nitrification
 Ammonification
 Denitrification
 Decomposition
Wednesday, April 17
Competitive exclusion – two species
cannot occupy the same niche
 Warm-Up: pgs. 32, 34
 Objective: Today we will explain various
ways organisms interact in ecosystems
using our notes.

Monday, April 18
Kinesis – increase in random movement
Warm-Up:
 What reasons were there for behaviors
you saw on the Planet Earth video Friday?
 Objective: Explain why animals behave the
way they do using notes and discussion.


Thursday, April 18
Immigration – movement of individual
into a population
 Warm-Up: Review pgs. 36,38,40
 Objective: Today we will analyze
population changes using our notes.

Friday, April 19
Emigration– movement of individual out of
a population
 Warm-Up: Review pg. 164
 Objective: Today we will apply ecology
concepts to real ecosystems using our
Planet Earth assignment

Tuesday, April 19



Taxis – movement toward or away from a
stimulus
Warm-Up:
 What internal and external stimuli might
trigger an Alaskan caribou to migrate?
 A peacock uses its colorful tail feathers to
attract a mate. What factors might control
how large a peacock’s train of feathers grow
to be?
Objective: Choose an animal and brainstorm
ideas on behaviors to demonstrate in a movie.
Wednesday, April 20
Habituation – an animal learns to ignore a
repeated stimulus
 Warm-Up

 How is learning to read and write an adaptive
behavior?
 What other behaviors have you learned that are
adaptive?

Objective: Use the internet to research
behaviors for your animal.
Friday, April 26



Cognition – mental process of knowing through
perception or reasoning
Warm-Up: List the structures for each body system
 Respiratory
 Circulatory
 Excretory
 Digestive
Objective: Explain the function and find the
location of the parts of a rat using the rat handout
and flashcards.
Monday, May 9



Imprinting – a rapid and irreversible
learning process that only occurs
during a short period of time
Warm-Up:
 If you had $1000, what are some
things you would consider spending
it on?
 How did you decide?
Objective: Use research to create a
video about an animal’s behavior.
Tuesday, May 10



Altruism – kind of behavior where an animal
reduces its own fitness to help members of its
social group
Warm Up
 What are some behaviors you have that are
instinctive?
 What are some things you can learn through
imitation?
Use PowerPoint lecture and discussion to
explain why animals have certain behaviors.
Wednesday, May 11

Animals
 Elk
 Ferrets
 Cockroaches
 Porcupines
 Rhinoceros
 Goats
 Giraffes
 Monkeys
 Owls
 Crows
 Jays
 Frogs
 Sharks
 Tigers

Animal
Group
Names
 Streak
 Intrusion
 Gang
 Prickle
 Shiver
 Business
 Parliament
 Crash
 Tower
 Tribe
 Party
 Barrel
 Murder
 Army
Monday, May 16
Cognition – mental process of
knowing through perception or
reasoning
 Warm-Up – explain the connection
between the following words






Stimulus, taxis
Survivorship, territoriality
Altruism, eusocial
Instinct, innate
Objective: Use your knowledge of
animal behavior to create a practice
test
Practice Test Assignment

Requirements
25 - multiple choice
10 - true/false
10 - fill in the blank
5 - short answer (should require at least 2
sentences to answer)
 Answer Key on separate paper





Due Wednesday
Tuesday, May 17



Survivorship – the number of individuals
that survive from one year to the next
Pg. 843 #1-3
Objective: Create a practice test using your
book and knowledge of animal behavior.