1. Important Features
• a. DNA contains genetic template" for
proteins.
• b. DNA is found in the nucleus
• c. Protein synthesis occurs in the
cytoplasm - ribosome.
• d. "Genetic information" must be
transferred to the cytoplasm where
proteins are synthesized.
2. Processes of Protein
Synthesis
• a. Transcription - genetic template for a
protein is copied and carried out to the
cytoplasm
• b. Translation - template serves as a
series of codes for the amino acid
sequence of the protein
Cells Use RNA to Make Protein
• The RNA Players – mRNA, rRNA, tRNA
• During polypeptide synthesis, ribosomal
RNA (rRNA) is the site of polypeptide
assembly.
– Transfer RNA (tRNA) transports and positions
amino acids.
– Messenger RNA (mRNA) directs which amino
acids are assembled into polypeptides.
• Central Dogma
– DNA  RNA Protein
Central Dogma of Gene
Expression
Gene Expression
• Transcription – in the nucleus (if you have one)
– DNA sequence is transcribed into RNA sequence
• initiated when RNA polymerase binds to
promoter binding site
– moves along DNA strand and adds corresponding
complementary RNA nucleotide
» disengages at stop signal
3. Steps of Transcription
a. DNA unwinds
b. One side of DNA "codes for a protein"
c. Genetic code of DNA is a triplet code of 3 nucleotides
or bases
d. Each triplet is specific for the coding of a single amino
acid
e. Sequence of triplet codes on DNA will specify the
amino acid sequence on the protein
f. Major step is the synthesis of the coded "messenger"
molecule – mRNA
g. mRNA is "transcribed" from DNA by complementary
base pairing (mRNA has no thymine, which is
replaced by uracil)
h. mRNA passes out to cytoplasm to the ribosome
Transcription
• RNA polymerase
– only one of two DNA strands (template) is
transcribed
– non-transcribed strand is termed coding
strand - same as RNA (except T’s are U’s)
– In both bacteria and eukaryotes, the
polymerase adds ribonucleotides to the
growing 3’ end of an RNA chain.
• synthesis proceeds in 5’3’ direction
Transcription Bubble
Transcription
• Promoter
– Transcription starts at RNA polymerase
binding sites called promoters on DNA
template strand.
• Initiation
– Other eukaryotic factors bind, assembling a
transcription complex.
• RNA polymerase begins to unwind DNA helix.
Transcription
• Elongation
– Transcription bubble moves down DNA at
constant rate leaving growing RNA strands
protruding from the bubble.
• Termination
– Stop sequences at the end of the gene cause
phosphodiester bond formation to cease,
transcription bubble to dissociate, and RNA
polymerase to release DNA.
Transcription
• Eukaryotic transcription differs from
prokaryotic transcription:
– three RNA polymerase enzymes
– initiation complex forms at promoter
– RNAs are modified after transcription
Spliced Gene Transcripts
• DNA sequence specifying a protein is broken
into segments (exons) scattered among longer
noncoding segments (introns).
• Initially, primary RNA transcript is produced for
the entire gene.
– Small nuclear ribonuclearproteins (snRNPs)
associate with proteins to form spliceosomes.
• Excise introns and splice exons to form mature mRNA.
RNA Splicing
• During RNA processing, intron sequences
are cut out of primary transcript before it is
used in polypeptide synthesis.
• remaining exon sequences are spliced together to
form final processed mRNA
Eukaryotic Genes are
Fragmented
Now TRANSLATION!!!!
4. Translation overview
a. mRNA attaches to the ribosome
b. tRNA's attach to free amino acids
in the cytoplasmic "pool" of amino
acids
c. tRNA carries its specific amino
acid to the ribosome
Translation overview
(cont.)
d. tRNA "delivers" its amino acid based on
complementary pairing of a triplet code
(anticodon) with the triplet code (codon) of
the mRNA.
e.Enzyme "hooks" the amino acid to the last
one in the chain forming a peptide bond.
f. Protein chain continues to grow as each
tRNA brings in its amino acid and adds it
to the chain. - This is translation!!
Gene Expression
• Translation – in the cytoplasm at ribosome
– nucleotide sequence of mRNA transcript is
translated into amino acid sequence in the
polypeptide
• rRNA recognizes and binds to start sequence
– moves three nucleotides at a time
» disengages at stop signal
• Gene expression - collective of transcription
and translation
Translation
• Begins when initial portion of mRNA
molecule binds to rRNA in a ribosome
– tRNA molecule with complimentary anticodon
binds to exposed codon on mRNA
• some tRNA molecules recognize more than one
codon
Translation
• Start and stop signals
– start signal coded by AUG codon
– stop signal coded by one of three nonsense
codons: UAA - UAG - UGA
• Initiation
– Polypeptide synthesis begins with the
formation of an initiation complex.
• initiation factors
Translation
• Translocation
– ribosome moves nucleotides along mRNA
molecule
• Termination
Translation
– Nonsense codons are recognized by release
factors that release the newly made polypeptide
from the ribosome.
Genetic Code
• Genetic code consists of a series of
information blocks called codons.
– reading frame (triplet)
• each codes for one amino acid
– genetic code is nearly universal
» mitochondria
» chloroplasts
The Genetic Code
1.A triplet code comprised of three nucleotide
bases in a sequence.
2.How many triplet codes?
20 common amino acids in a protein
4 diff. bases on DNA
A,T,C, & G
|
4 diff. bases on RNA
| |
|
U,A,G, & C
4 things put together in combinations of 3 =
43= 64
Therefore - 64 different DNA triplet codes or RNA
codons
The 64 triplet codes
• 60 code for amino acids
• 4 act as "stop" and "start codes
• Degenerate Code- more than
one triplet code for some amino
acids e.g.,
GGG
GGU
GGC
GGA
All code for the
amino acid glycine
Differences Between
Prokaryotic and
Eukaryotic Gene Expression
• Most eukaryotic genes possess introns.
• Individual bacterial mRNA molecules often
contain transcripts of several genes.
• Eukaryotic mRNA molecules must be
completely formed and must pass across the
nuclear membrane before translation.
• In prokaryotes, translation begins at the AUG
codon preceded by a special nucleotide
sequence.
Differences Between
Prokaryotic and
Eukaryotic Gene Expression
• Eukaryotic mRNA molecules have introns cut
out and exons joined together before
translation.
• Eukaryotic ribosomes are larger than
prokaryotic ribosomes.
Challenge Question
DNA Template:
5’
3’
(?)
mRNA
(?)
GGTCAGTATTATTACGCGACGGGCAATCCGCACGTGTCATCAATAGTGCCTTCGTCTGAGATC
mRNA:
Polypeptide:
3’
5’