Chapter 12: DNA-protein interactions
Preparation of nuclear extracts and cytoplasmic
(S-100) fraction
• Use hypotonic solutions and 10 up-and-down strokes with a
glass Dounce homogenizer.
• Check for cell lysis under a microscope and trypan blue
exclusion.
• Centrifuge to separate the supernatant and the nuclei
fraction.
• The nuclei fraction first in low-salt buffer, then in high saltbuffer. Dounce and centrifuge to obtain the nuclear extract. .
• Centrifuge the supernatant at 100,000 x g for 1 hr. The
supernatant is the S-100 fraction.
• Dialyze 4. and 5, until the conductivities within and outside
the dialysis bag are equal.
• Aliquot, rapidly freeze in liquid nitrogen, and store at -800C.
Mobility shift assay
• Use 4% or 5% non-denaturing acrylamide gel and TAE or
TBE buffer.
• Labeled DNA of 20 - 300 bp as probes.
• Pre-run the gel, 30 - 60 min at 100V
• Mix: DNA probe
DNA-binding proteins (purified proteins or crude
extract)
BSA
Glycerol
Carrier DNA, eg., poly(dI-dC).poly(dI-dC)
• Incubate 15-30 min, at 25 - 37oC.
• Load on gel and electrophoresis.
• Autoradiopgraphy.
Competition mobility shift assay
In the binding reactions,
In addition to the labeled DNA probe, add increasing
amounts of unlabelled specific and non-specific
competitor DNAs.
Add DNA-binding protein last.
Antibody supershift assay
In 2 tubes of binding reactions,
In addition to the labeled DNA probe, add specific
antibody to 1 tube, and add nonspecific control antibody
to the other tube.
Multicomponent mobility shift assay
• Proteins B and C will bind to the protein A-DNA complex.
• Need to saturate probe with protein A to reach a
concentration where the ABC complex can form.
Purification of DNA-binding proteins using biotin/ streptavidin
affinity systems.
(Biotin form tight and irreversible complex with streptavidin.)
• Labeled a DNA fragment with biotin-11-dUTP, one isotopic
dNTP, and the other 2 unlabelled dNTPs by klenow.
• Set up binding reaction with DNA-binding proteins.
• Add streptavidin, incubate at 300C for 5 min.
• Transfer the binding reaction to an eppendorf tube
containing biotin-cellulose resin (Pierce) or streptavidinagarose beads.
• Incubate.
• Wash the pellet.
• Resuspend the pellet in elution buffer.
• Centrifuge, and save the supernatant.
• Assay for binding activity.
Purification of oligonucleotides by preparative gel
electrophoresis
• Prepare 16% polyacylamide/urea gel for separating 10-45
base oligonucleotides.
• Pre-run at 30 W for >1 hr.
• Dissolve DNA in formamide loading buffer. Heat 15 min at
650C to remove 20 structure, and load on gel.
• 30 W for ～ 4 hr until bromphenol blue move to 75% of the gel.
(With 16% polyacylamide/urea gel, bromphenol blue comigrate
with ～ 10-base oligonucleotides, and cylene cyanol ～ 30-base
oligonucleotides.)
• Transfer the gel to a Saran wrap, and cut the DNA band under
a short-wavelength UV lamp.
• Add TE, shaking for overnight at 370C.
• Filter through a pipet with a glass wool plug.
• Extract DNA with sec-butanol, diethyl ether, and evaporate.
• Dissolve in TE, and ethanol precipitation.
• Dissolve in TE, measure OD260, and store at -200C.
• For sequence-specific DNA affinity column, assume 1OD = 40
μg/ml DNA.
Purification of DNA-binding proteins by
affinity chromatography
I.
II.
Preparation of DNA affinity resin.
DNA affinity chromatography.
I. Preparation of DNA affinity resin
1. Mix 2 complementary HPLC- or gel-purified oligonucleotides,
T4 polynucleotide kinase, and γ-32PATP. Incubate.
2. Inactivate T4 polynucleotide kinase by adding
ammonium acetate. Heat at 650C for 15 min and
cool to rt (annealing).
3. Ethanol precipitate, dissolve in TE
4. Phenol extraction and ethanol precipitation
5. Ligate to multimers, store at -200C.
6. Wash Sepharose CL-2B (GE) with water with a glass
funnel. Transfer to hood, and keep slow stirring.
7. Dissolve CNBr (Aldrich) with N,N-dimethylformamide in
hood.
8. Add 7. to 6. within 1 min dropwise.
9. Every 10 sec add 30 μl 5 N NaOH for 10 min, until 1.8 ml
NaOH has been added.
10. Add ice-cold water.
11. Wash the resin with ice-cold water, 2X, and 10 mM
potassium phosphate, 2X, with a glass funnel.
12. Add 4 ml of 10 mM potassium phosphate.
13. Add DNA, incubate at rt for overnight on a rotating
wheel.
14. Transfer to hood, wash with water 2X, and 1 M
ethanolamide hydrochloride, 1X.
15. Add 1M ethanolamide hydrochloride, incubate at rt for
2-4 hr on a rotating wheel.
16. Wash the resin with 10 mM potassium phosphate, 1 M
potassium phosphate, 1 M KCl, water, and then,
column
storage buffer. .
17. Store at 40C. Resins are stable at least 1 year.
II. DNA affinity chromatography
1. Equilibrate 1 ml DNA affinity resin in a chromatography
column with 10 ml of buffer Z/0.1 M KCl, 2X.
(Buffer Z: HEPES, MgCl2, DTT, 20% glycerol, 0.1% NP-40, pH 7.6.)
2. Combine protein solution in wash buffer Z/0.1 M KCl with
non-specific competitor DNA, incubate 10 min on ice.
3. Centrifuge and discard the insoluble DNA-protein complexes.
4. Load onto the column at gravity flow.
5. Wash with 2 ml wash buffer Z/0.1 M KCl, 4X (not 8 ml, 1X).
6. Elute with 1ml of buffer Z/0.2 M KCl, buffer Z/0.3 M KCl,
buffer Z/0.4 M KCl, buffer Z/0.5 M KCl, buffer Z/0.6 M
KCl, buffer Z/0.7 M KCl, buffer Z/0.8 M KCl, buffer Z/0.9
M KCl, buffer Z/1 M KCl, successively. Collect 1 ml
fractions corresponding to the addition of 1 ml portions of
buffer. Freeze in liquid nitrogen and store at -800C.
7. Regenerate the affinity resins with regeneration buffer (Tris,
EDTA, 2.5 M NaCl, 1% NP-40), and wash with storage
buffer (Tris, EDTA, 0.3 M NaCl, 0.04% (w/v) sodium
azide). Store at 40C.
Determination of protein-DNA sequence specificity by PCRassisted binding site selection
1. Random-sequence oligonucleotides R76
5’CAGGTCAGTTCAGCGGATCCTGTCG(A/C/G/T)26GAGGC
GAATTCAGTGCAACTGCAGC-3’
Primer F: 5’-GCTGCAGTTGCACTGAATTCGCCTC-3’
R: 5’- CAGGTCAGTTCAGCGGATCCTGTCG-3’
2. Gel-purified primers R76, F, and R.
3. In an eppendorf tube, add R76,
F,
3 dNTP (0.5 mM each),
dCTP (40 μM),
α32PdCTP,
Taq polymerase.
4. One cycle for 940C, 1 min; 620C, 3 min; 720C, 9 min.
5. Chase extension by adding 0.5 mM dCTP, 720C, 9 min.
6. Purify dsR76 on 8% non-denaturing PAGE.
7. Rehydrate and wash protein A-Sepharose CL-4B beads in
water.
8. Wash with wash buffer containing 50 μg/ml BSA.
9. Add binding buffer containing 50 μg/ml BSA.
Poly (dI-dC).poly(dI-dC)
protein sample
dsR76
antiserum
10. 20-30 min on ice (to form protein-DNA complex).
11. Transfer protein A-sepharose (step 7.) to an eppendorf
tube containing wash buffer without BSA.
12. Centrifuge, discard supernatant.
13. Add binding reaction (step 9), mix.
14. 40C overnight on a rotating wheel.
15. Wash with binding buffer without BSA, 2X.
16. Elute DNA from beads by adding recovery buffer and
incubate at 450C for 1 hr.
17. Phenol extraction
18. Add glycogen carrier, and ethanol precipitation.
19. Measure pellet for Cerenkov counts on a scintillation
counter.
20. Add 1 pg DNA (step 18.),
R,
F,
3 dNTP (0.5 mM each),
dCTP (40 μM),
α32PdCTP,
Taq polymerase.
21. PCR, 15 cycles : 940C, 1 min; 620C, 1 min; 720C, 1 min.
22. Phenol extraction
23. Add glycogen carrier, ethanol precipitation.
24. Gel-purified DNA.
25. Repeat 4 cycles of binding-site selection (step 9 to 24),
save DNAs from each selection.
26. Perform binding assay (step 9 lacking antiserum, and
step 10) with DNAs of each selection cycles.
27. Mobility shift assay.
If the selections have been successful, complexes
appear with DNAs of later selections.
Isolation of bound oligonucleotides from mobility shift gels
• Cut out the gel Add with the DNA-protein complex.
• Add R,
F,
3 dNTP (0.5 mM each),
dCTP (40 μM),
α32PdCTP,
Taq polymerase
• PCR, 17 cycles: 940C, 1 min; 620C, 1 min; 720C, 1 min.
• Check and purify PCR products
• EcoRI and BamHI double digestion.
• Phenol extraction and ethanol precipitation, and cloning.
Colonies might be slightly radioactive.
Chapter 15: The polymerase Chain reaction
Standard procedures and optimization of PCR
• First check 0 mM, 1.5 mM, 3.0 mM, and 4.5 mM MgCl2, and
best enhancer for PCR, using undiluted DNA as template.
• PCR condition: 30 cycles;
940C, 30 sec;
550C (GC< or = 50%) or 600C (GC>50%), 30 sec;
720C, 1 min/ kb.
(For the last cycle, extension can be 7 min.)
• Take one tenth for electrophoresis.
• Choose the best condition, then check amounts of
template DNA, preparation temperature (rt or 40C), and
hot start.
Use the same PCR condition but adding 940C, 5 min
before PCR.
Ligation-mediated PCR (single site PCR, anchored
PCR)
Digest genomic DNA, add linker, and PCR.
Generation of T-vectors for cloning of PCR
products.