Welcome to Molecular Biology Through Discovery Tuesday, 17 September 2013 DNA Structure DNA Structure Biology Today and Tomorrow Starr, Evers, and Starr (2010) DNA Structure Biology: Understanding Life Alters (2000) DNA Structure E. How can the helical structure of DNA and internucleotide distance be discerned from Franklin and Gosling's x-ray photograph? DNA Structure E. How can the helical structure of DNA and internucleotide distance be discerned from Franklin and Gosling's x-ray photograph? DNA Structure http://h2physics.org/?cat=48 DNA Structure http://h2physics.org/?cat=48 DNA Structure http://h2physics.org/?cat=48 DNA Structure 1 Å = 10-8 cm 1 cm http://h2physics.org/?cat=48 DNA Structure ~D ~D + nλ a D a = f (D, λ, Δx) = λ D / Δx Would like to be able to do the math. http://h2physics.org/?cat=48 Δx DNA Structure http://h2physics.org/?cat=48 DNA Structure SQ7. What would you expect to happen to the diffraction pattern if the helix shown in Fig. 8B-D were squashed, i.e. the helix were more tightly wound, more like a solenoid? DNA Structure SQ7. What would you expect to happen to the diffraction pattern if the helix shown in Fig. 8B-D were squashed, i.e. the helix were more tightly wound, more like a solenoid? ? ? ? ? DNA Structure SQ7. What would you expect to happen to the diffraction pattern if the helix shown in Fig. 8B-D were squashed, i.e. the helix were more tightly wound, more like a solenoid? angle? ? ? DNA Structure SQ7. What would you expect to happen to the diffraction pattern if the helix shown in Fig. 8B-D were squashed, i.e. the helix were more tightly wound, more like a solenoid? DNA Structure SQ7. What would you expect to happen to the diffraction pattern if the helix shown in Fig. 8B-D were squashed, i.e. the helix were more tightly wound, more like a solenoid? angle? ? DNA Structure DNA Structure It's necessary to be slightly underemployed if you are to do something significant. - Jim Watson O NH N N P NH N N N -O O 2 N O O N O O O -O O P O From the nucleotides shown above, construct a double-stranded DNA fragment with the sequence ACTG. You may: duplicate (Ctrl-d) horizontal flip (Alt-hgoh) vertical flip (Alt-hgov) and/or rotate (Alt-hgor) the nucleotides, but you may not change the relative positions of their atoms. N NH NH N O 2 O -O P N N O O O -O O P O NH 2 DNA Directionality & Palindromes SQ10. If one strand of DNA had the sequence 5'-GGACT-3', what would be the sequence of the second strand? DNA Directionality & Palindromes I understand what a palindrome is in English but when it comes to DNA how come 5'-AGTTGA-3' isn't a palindrome when it's anti-parallel strand is 3'-TCAACT-5' which is also a palindrome. Palindromic Sequences What is it? Backwards = forwards ROTATOR What about with DNA? GCTATCG • DNA is double stranded TTAATGTGAGTTAGCTCACTCATT AATTACACTCAATCGAGTGAGTAA Palindromic Sequences What is it? Backwards = forwards ROTATOR What about with DNA? GCTATCG • DNA is double stranded • DNA is redundant TTAATGTGAGTTAGCTCACTCATT AATTACACTCAATCGAGTGAGTAA Palindromic Sequences What is it? Backwards = forwards ROTATOR What about with DNA? GCTATCG • DNA is double stranded • DNA is redundant • DNA has direction (read 5’->3’) 5’- TTAATGTGAGTTAGCTCACTCATT -3’ 3’- AATTACACTCAATCGAGTGAGTAA -5’ AATGAGTGAGCTAACTCACATTAA Palindromic Sequences 5’- TTAATGTGAGTTAGCTCACTCATT -3’ 3’- AATTACACTCAATCGAGTGAGTAA -5’ TA T G GC AT GC TA GC TTAAT TCATT AATTA AGTAA CG TA CG DNA: cruciform AT CG RNA: stem/loop G T AT Palindromic Sequences 5’- TTAATGTGAGTTAGCTCACTCATT -3’ 3’- AATTACACTCAATCGAGTGAGTAA -5’ UA U G GC AU GC UA GC UUAAU UCAUU DNA: cruciform RNA: stem/loop tRNA Palindromic Sequences why [are] palindromes… targeted by DNA-binding proteins why palindromes are targeted by DNA-binding proteins Palindromic Sequences NNNNNNNNNNNNNN TTAATGTGAGTTAGCTCACTCATTNNNNNNNNNNNNN NNNNNNNNNNNNNN NNNNNNNNNNNNN AATGAGTGAGCTAACTCACATTAA recognizes GTGAGTT Palindromic Sequences NNNNNNNNNNNNNN TTAATGTGAGTTAGCTCACTCATTNNNNNNNNNNNNN NNNNNNNNNNNNNN NNNNNNNNNNNNN AATGAGTGAGCTAACTCACATTAA recognizes GTGAGTT Palindromes: Serve as binding sites for dimeric protein gene 5’-GTA 3’-CAT GTA ..(8).. TAC ..(8).. ..(8).. TACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN ATGNNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN gene 5’-GTA 3’-CAT GTA ..(8).. ..(8).. TACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN ATGNNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN Transcription RNA factor RNA Polymerase ..(8).. TAC Reading articles Reading articles • Read through (Highlight problems) • Reread (Put words to problems) • Plan solution to problems (What do you need to know?) • Solve problems (Find what you need to know) Problem Set 5 Problem Set 5 Goodbye from Molecular Biology Through Discovery Tuesday, 17 September 2013