Name: _______________________________
Period: _____
8th Grade Heredity Study Guide
1. What is asexual reproduction? (Also include # of parents & compare DNA of offspring to parents.)
Asexual reproduction involves 1 parent. The parent and offspring are genetically identical to each other.
2. What is sexual reproduction? (Also include # of parents & compare DNA of offspring to parents.)
Sexual reproduction involves 2 parents. The parents and offspring are genetically different from each other.
3. List 2 organisms that reproduce asexually: bacteria, hydra, starfish, some plants
4. List 2 organisms that reproduce sexually: dogs, rabbits, cats, humans, deer, horses
5. What molecule makes up the genes of an organism and is responsible for inheritance?
DNA
6. What does DNA stand for? Deoxyribonucleic acid
7. What is the basic structure of DNA molecule? (Use the two word name.) double helix
8. Draw a basic DNA molecule.
9. In a DNA molecule there are 4 kinds of nucleotides. List these four. A, T, G, C
10. What is the correct paring of these 4 from number 1? A-T and G-C
11. If the sequence is TCCATGGA what would be the complementary strand?
AGGTACCT
12. Explain how your DNA controls everything about you.
By controlling the production of proteins
Use the DNA Code Chart on the back to determine which amino acids will be formed for the following sequences
13. GCC TCC TAC CGG
Ala
Ser Tyr
Arg
14. GAC CGT CAT TGA
Asp
Arg
His Stop
15. The DNA code for a particular amino acid sequence contains 3 nucleotides.
16. How many amino acids would be coded for by the following DNA sequence?
ATGGCCCAGCAACCCCCTATG 7 amino acids (3 letters for each amino acid
16. What is a “mutation”? a change in DNA or a mistake in DNA
17. Name the 3 types of mutation. Illustrate how an example of each.
Substitution (ATGACG) Deletion (ATGA G) Addition (ATGACGT)
18. Are most mutations “good” or “bad”?
BAD
19. What are the effects of a “bad” mutation on an organism?
Genetic diseases/disorders, cancer, death
21. The genetic make up of an organism is called genotype. Give an example. AA, Aa, or aa
22. The physical expression of a trait is called phenotype. Give an example. Brown fur, blue eyes, etc.
23. What is the “dominant allele”?
The dominant allele is he allele that always shows when it is present. It covers up the recessive allele.
24. What is the “recessive allele”?
The recessive allele is the allele that only shows when the dominant is not present.
25. What does heterozygous mean? What is the heterozygous genotype?
Heterozygous means an organism has one dominant allele and one recessive allele- Aa
26. What does homozygous mean? What is the homozygous recessive genotype? What is the homozygous domin
genotype?
Homozygous means an organism has two alleles that are the same. Homozygous recessive = aa. Homozygous
dominant = AA
27. What is the purpose of a Punnett square?
The purpose of a Punnett square is to predict the offspring of 2 parents.
28. Complete a Punnett square for: Tt x tt
T = tall and t = dwarf (short)
29. Using the Punnett square from the previous question, give the phenotype & genotype and the % probability f
each.
50% Tt = 50% tall
50% tt = 50% dwarf (short)
30. Black fur in dogs in dominant and brown is recessive. If a brown dog is crossed with a homozygous black do
what percentage of the offspring will be expected to be brown?
B = black and b = brown
100% Bb = 100% black
31. What is selective breeding? Give an example.
Breeding two animals of the same species to get offspring with the “good” traits from both parents (hopefully)
32. Which of these is an advantage of selective breeding?
A. We can make corn that can grow in hot environments.
B. We can make corn that will attract more bugs.
C. We can make tomatoes that are small and green.
D. We can make pigs that have tough meat.
33. What is genetic engineering? Give an example.
Removing a gene for a “good” trait and putting it into the DNA of another organism to give the recipient organis
that “good” trait
34. Which of the following is not an advantage of genetic engineering?
A. We can make corn that produces its own pesticide.
B. We can make tomatoes that can cause allergic reactions in people.
C. We can make a plant that attracts pests.
D. We can give desirable to traits to organisms by giving them a gene from another species for that trait.
35. What can a DNA fingerprint be used for?
Identifying a criminal from DNA left at a crime scene, Identifying the parents of a child
36. Why does comparing DNA fingerprints work?
Because no two people have the same DNA fingerprint (except for identical twins)
37. When comparing two DNA fingerprints, what does a scientist look for?
They look for the DNA fingerprints of relatives to be similar (but not exactly the same). They look for the DNA f
a suspect to be identical to the DNA evidence left at the crime scene since the person who left the blood and the
suspect would be the same person if the suspect is guilty. They are comparing the patterns of the bands in a DNA
fingerprint to determine whose is similar or the same.
38. List the characteristics of life.
Living things are made of cells, reproduce, use energy, grow and develop, adapt to their environment, respond to
stimuli, have genetic material (usually DNA), and maintain homeostasis.
39. Define Homeostasis. Give some examples of an organism maintaining homeostasis.
Living things stay relatively the same internally (they remain stable or balanced internally). Examples would be
maintaining a relatively constant internal body temperature, heart rate, breathing rate, blood pressure, blood pH
40. A person takes a job outside on a hot summer day and begins sweating, this would most likely be an example
what characteristic of life? This could be an example of responding to their environment or maintaining homeost