Discussion of
Ecological Speciation in South Atlantic Island Finches
by
Peter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport
University of Cape Town
University of Pretoria
South Africa
Science
315:1420-1423
BIO101, Oct. 3, 2011
What’s the overall question?
What’s the overall conclusion?
Ecological Speciation in South Atlantic Island Finches
Peter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport
Examples of sympatric speciation in nature are rare and hotly debated. We describe the parallel
speciation of finches on two small islands in the Tristan da Cunha archipelago in the South
Atlantic Ocean. Nesospiza buntings are a classic example of a simple adaptive radiation, with
two species on each island: an abundant small-billed dietary generalist and a scarce large-billed
specialist. Their morphological diversity closely matches the available spectrum of seed sizes,
and genetic evidence suggests that they evolved independently on each island. Speciation is
complete on the smaller island, where there is a single habitat with strongly bimodal seed size
abundance, but is incomplete on the larger island, where a greater diversity of habitats has
resulted in three lineages. Our study suggests that the buntings have undergone parallel
ecological speciation.
Where in the world is Tristan da Cunha?
The most remote inhabited islands in the world
Where in the world is Tristan da Cunha?
Approx. 12 miles
between
Approx.
250 miles
South
Inaccessible Island
Rough circle, 2 miles in diameter.
3 million years old.
Ecology largely stable for 20,000 years.
Low coast with high cliffs.
Extensive plateau of 300-600 m.
Nightingale Island
Several small islands.
Largest is approx. 1 mile diameter
18 million years old.
Ecology largely stable for 20,000 years.
Mostly low lying (<300 m)
The Flora
Tall tussock grass, Spartina arundinacea
Trees, Phylica
Heath, Blechnum palmiforme
The Flora
Inaccessible Island:
Low-lying coast is mostly tussock grasses
with a few clumps of trees
East side of plateau is mostly Phylica trees
West side of plateau is mostly heath
Nightingale Island:
Mostly tussock grass
with a few clumps of trees
Fig. 1A
Nesospiza Finches/Buntings
Evolved from South American finches (crossed 4800 miles of ocean!)
Two species:
N. acunhae – also called Tristan Bunting
wide variety diet
small bill
found on both islands
differences in ‘upland’ and
‘lowland’ types on Inaccessible
N. wilkinsi – also called Wilkins’ Bunting
eats Phylica fruit
large bill
found on both islands
Nesospiza Finches/Buntings
Each species has a different subspecies
N. dunnei
subspecies of N. wilkinsi
only found on Inaccessible Island
N. questi
subspecies of N. acunhae
only found on Nightingale Island
Hybrids of dunnei x acunhae
Hybrids only occur on Inaccessible
Nesospiza Finches/Buntings
Fig. 1BC
Allopatric Speciation:
Species developed in geographic isolation,
then dispersed and mixed
Sympatric Speciation:
One species inhabited both islands,
large and small bills evolved on both islands
Morphological Analyses
Fig. 2A
Found on Nightingale Island
Found on Inaccessible Island
More extreme morphological differences on Nightingale
Fig. 2B
Ecological Analyses
Inaccessible
Inaccessible
Inaccessible
Inaccessible
Ecological Analyses
Fig. S1
Morphological and Ecological Analyses
Which model do these data support?
Allopatry? Sympatry? Both? Neither?
Genetic Analyses
Analysis of a mitochondrial gene
9 birds on Nightingale analyzed.
One genotype found, which is different from those on Inaccessible.
Which model do these data support? Allopatry? Sympatry? Both? Neither?
Which factor is more important – species or location?
Fig. S2
Genetic Analyses
For higher resolution, conducted an analysis of a microsatellites
Short, repetitive DNA sequences
High levels of variation within species
Variation in the number of repeats
Generally between genes, so not selected for or against
CCGTAGATCGATCGATCTTACTGGT
CCGTAGATCGATCGATCGATCGATCTTACTGGT
372 birds analyzed for 7 microsatellites each
Genetic Analyses
Does the variation deviate from Hardy-Weinberg?
Microsatellite Names
p-values for a statistically significant deviation from Hardy-Weinberg:
Five of the 42 loci/species combinations show evidence of evolution.
(may be due to ongoing speciation)
37 of 42 show neutral variation.
Table S2a
Fig. 3B
Genetic Analyses
Visual representation of the microsatellite data.
Each vertical line is one bird, with location and species/subspecies indicated.
Colors code for genotypes at the four microsatellites
First bird shows
~65% “green” lineage
~25% “blue” lineage
~10% “gray” lineage
slight amount of “red” lineage
All N. wilkinsi finches on Nightingale
are genetically similar to each other
26 finches
Genetic Analyses
Each island/species grouping is well-resolved by the genetic data
Figure 3BC
Genetic Analyses
Can also present the microsatellite data as a tree:
Distance of lines corresponds to
genetic distance .
(Nei’s Genetic Distance, D)
Figure 3A
Genetic Analyses
Which model do these data
support?
Allopatry? Sympatry?
Both? Neither?
Which factor is more important –
species or location?
Figure 3A
Current Model:
Buntings colonized Tristan da Cunha islands
~3 MYA (based on molecular clock data)
Speciation occurred ~0.3-0.4 MYA
Complete speciation on Nightingale
Single habitat
Speciation is not yet done on Inaccessible
Greater habitat diversity
Three lineages, including hybrids
Sympatric Speciation!