doi:10.1152/ajpendo.00615.2012
Am J Physiol Endocrinol Metab 305:E975-E986, 2013. First published 13 August 2013;
Lin, Ming-Ching Chiang, Jer-Tsong Hsieh and Ho Lin
Fu-Ning Hsu, Mei-Chih Chen, Kuan-Chia Lin, Yu-Ting Peng, Pei-Chi Li,
Eugene
of Ser727 on STAT3 in prostate cancer cells
androgen receptor activation through
phosphorylation
Cyclin-dependent kinase 5 modulates STAT3 and
You might find this additional info useful...
This article cites 47 articles, 26 of which can be accessed free at:
/content/305/8/E975.full.html#ref-list-1
Updated information and services including high resolution figures, can be found at:
/content/305/8/E975.full.html
Additional material and information about AJP - Endocrinology and Metabolism can be found at:
http://www.the-aps.org/publications/ajpendo
This information is current as of October 20, 2013.
http://www.the-aps.org/.
20814-3991. Copyright © 2013 by the American Physiological Society. ISSN: 0193-1849, ESSN: 1522-1555. Visit our website
at
organization. It is published 12 times a year (monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda
MD
AJP - Endocrinology and Metabolism publishes results of original studies about endocrine and metabolic systems on any level
of
Downloaded from on October 20, 2013
Cyclin-dependent kinase 5 modulates STAT3 and androgen
receptor
activation through phosphorylation of Ser727 on STAT3 in
prostate cancer
cells
Fu-Ning Hsu,1 Mei-Chih Chen,1 Kuan-Chia Lin,4 Yu-Ting Peng,1 Pei-Chi Li,1 Eugene Lin,1,5
Ming-Ching Chiang,1 Jer-Tsong Hsieh,6 and Ho Lin1,2,3,6
Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan; 2Department of Agricultural
1
Biotechnology Center, National Chung Hsing University, Taichung, Taiwan; 3Graduate Institute of Rehabilitation
Science,
China Medical University, Taichung, Taiwan; 4Department of Health Care Management, National Taipei
University of
Nursing and Health Sciences, Taipei, Taiwan; 5Department of Urology, Chang Bing Show Chwan Memorial
Hospital,
Changhua, Taiwan; and 6Department of Urology, University of Texas Southwestern Medical Center, Dallas, Texas
Submitted 6 December 2012; accepted in final form 8 August 2013
Hsu FN, Chen MC, Lin KC, Peng YT, Li PC, Lin E, Chiang MC,
Hsieh JT, Lin H. Cyclin-dependent kinase 5 modulates STAT3 and androgen
receptor activation through phosphorylation of Ser727 on STAT3 in
prostate cancer cells. Am J Physiol Endocrinol Metab 305: E975–E986,
2013. First published August 13, 2013; doi:10.1152/ajpendo.00615.2012.—
Cyclin-dependent kinase 5 (Cdk5) is known to regulate prostate
cancer metastasis. Our previous results indicated that Cdk5 activates
androgen receptor (AR) and supports prostate cancer growth. We also
found that STAT3 is a target of Cdk5 in promoting thyroid cancer cell
growth, whereas STAT3 may play a role as a regulator to AR
activation under cytokine control. In this study, we investigated the
regulation of Cdk5 and its activator p35 on STAT3/AR signaling in
prostate cancer cells. Our results show that Cdk5 biochemically
interacts with STAT3 and that this interaction depends on Cdk5
activation in prostate cancer cells. The phosphorylation of STAT3 at
Ser727 (p-Ser727-STAT3) is regulated by Cdk5 in cells and xenograft
tumors. The mutant of STAT3 S727A reduces its interaction with
Cdk5. We further show that the nuclear distribution of p-Ser727STAT3 and the expression of STAT3-regulated genes (junB, c-fos,
c-myc, and survivin) are regulated by Cdk5 activation. STAT3 mutant
does not further decrease cell proliferation upon Cdk5 inhibition,
which implies that the role of STAT3 regulated by Cdk5 correlates to
cell proliferation control. Interestingly, Cdk5 may regulate the interaction
between STAT3 and AR through phosphorylation of Ser727STAT3 and therefore upregulate AR protein stability and transactivation.
Correspondingly, clinical evidence shows that the level of
p-Ser727-STAT3 is significantly correlated with Gleason score and the
levels of upstream regulators (Cdk5 and p35) as well as downstream
protein (AR). In conclusion, this study demonstrates that Cdk5 regulates
STAT3 activation through Ser727 phosphorylation and further
promotes AR activation by protein-protein interaction in prostate
cancer cells.
cyclin-dependent kinase 5; signal transducer and activator of transcription
3; androgen receptor; phosphorylation; prostate cancer
PROSTATE CANCER IS THE MOST COMMON CANCER in
men (20).
Androgen ablation therapy is the primary strategy for suppressing
prostate cancer growth; however, some castration-resistant
prostate cancers eventually relapse within two years. Therefore,
it is imperative to further understand the molecular
mechanisms of prostate cancer progression and to develop
effective treatment strategies.
Signal transducer and activator of transcription 3 (STAT3),
a transcription factor, has been reported to regulate prostate
cancer development (4, 16). It has been suggested that the
transcriptional activity of STAT3 is initiated by phosphorylation
at tyrosine 705 (Tyr705), followed by STAT3 dimerization, nuclear
translocation, and DNA binding (29, 33). Phosphorylation of
STAT3 at serine 727 (Ser727) is important in activating STAT3
signaling in response to a variety of extracellular stimuli, such as
growth factors, cytokines, or environmental stress (8, 44). Although
Tyr705 phosphorylation is critical to STAT3 activation,
Ser727 phosphorylation of STAT3 still shows the contribution
on its maximal transactivation by increasing the recruitment of
transcriptional cofactors (44); therefore, phosphorylation of
both residues is required for full activation of STAT3 (2).
Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/
threonine kinase. Without participating in cell cycle progression,
Cdk5 has been implicated in various aspects of neural
functions (11). Distinct from the other Cdk family members,
Cdk5 is activated not by binding to cyclins but rather through
association with its regulatory subunits p35 and p39 (37, 38).
p35 (Cdk5R1), a 35-kDa protein, has been widely investigated
and was originally defined as a neuron-specific activator of
Cdk5 (38). Recently, p35 was indicated to play important roles
in human cancers by regulating Cdk5 activity (15, 26, 27, 36),
and p35 overexpression was also reported in metastatic prostate
cancers (36). Multiple functions of Cdk5 in addition to
those in the central nervous system were recently discovered,
such as its roles in cancer biology (6, 22, 26, 27, 36). In our
previous research, we first identified the kinase activity and
apoptotic role of Cdk5 in prostate cancer cells (27). Our recent
work demonstrates the modulation of prostate cancer growth by
Cdk5 through activation of androgen receptor (AR) by phosphorylation
(15). Several lines of evidence have revealed that STAT3
can be modulated by Cdk5-dependent phosphorylation at the
Ser727 site in mouse neurons (12), muscle cells (12), and liver
cancer (34). A recent study indicates that Cdk5 prevents DNA
damage through Ser727 phosphorylation of STAT3 (9). Our previous
results also show that Cdk5 modulates STAT3 activation
and cell proliferation of thyroid cancer (26).
STAT3 has been shown to modulate signaling cross-talk
between steroid receptors such as AR (39) or glucocorticoid
receptor (47) and other signaling pathways in response to
Address for reprint requests and other correspondence: H. Lin, Dept. of Life
Sciences, National Chung Hsing University, 250 Kuokuang Rd., Taichung
402, Taiwan (e-mail: hlin@dragon.nchu.edu.tw).
Am J Physiol Endocrinol Metab 305: E975–E986, 2013.
First published August 13, 2013; doi:10.1152/ajpendo.00615.2012.
http://www.ajpendo.org 0193-1849/13 Copyright © 2013 the American Physiological Society E975
interleukin 6 (IL-6). Gene expression regulated by AR and
activation of the AR NH2-terminal domain by IL-6 are accomplished
through the STAT3 pathway in prostate cancer cells (7,
39, 40). Since both STAT3 and AR are substrates regulated by
Cdk5, it is of interest to investigate the detailed mechanism of
this regulation in prostate cancer cells. According to our in
vitro data, Cdk5 interacts with STAT3 and positively regulates
STAT3 activation as well as prostate cancer cell proliferation
through Ser727 phosphorylation of STAT3. On the other hand,
we found that Cdk5 activation might indirectly increase AR
activation through an STAT3-AR protein interaction. Furthermore,
we provide clinical evidence showing that p-Ser727STAT3 level positively correlates with Gleason score, Cdk5,
p35, and AR protein levels in prostate cancer patients’ specimens.
We propose that Cdk5-dependent Ser727 phosphorylation
of STAT3 might play important roles in prostate cancer
progression.
MATERIALS AND METHODS
Materials. Roscovitine (ROSC; a Cdk5 inhibitor; R7772) and
cycloheximide (CHX; a protein synthesis inhibitor; C1988) were
purchased from Sigma, MG132 (a proteasome inhibitor; 474791) was
purchased from Calbiochem, and R881 (methyltrienolone, a synthetic
androgen; NLP-005) was purchased from Perkin-Elmer Life Sciences.
Antibodies used for immunoblotting are as follows: _-actin
(MAB1501; Millipore), AR (sc-13062 and sc-7305, Santa Cruz Biotechnology;
and 554224, BD Biosciences), p-Ser81-AR (07-541, Upstate
Biotechnology; AND 07-1375, Millipore), Cdk5 (sc-750 and
sc-249, Santa Cruz Biotechnology; and 05-364, Upstate Biotechnology),
FLAG (sc-807, Santa Cruz Biotechnology; and F3165, Sigma),
c-fos (sc-52; Santa Cruz Biotechnology), junB (sc-73; Santa Cruz
Biotechnology), poly(ADP)-ribose polymerase (06-557; Upstate Biotechnology),
PSA (sc-7316; Santa Cruz Biotechnology), p35 (sc-820
and sc-5614; Santa Cruz Biotechnology), STAT3 (610190; BD Bioscience),
p-Ser727-STAT3 (9134, Cell Signaling Technology; and
612543, BD Bioscience), p-Tyr705-STAT3 (9145; Cell Signaling
Technology), _-tubulin (05-829; Upstate Biotechnology), and ubiquitin
(sc-8017; Santa Cruz Biotechnology). IgG was mouse anti-goat
IgG-horseradish peroxidase (sc-2354; Santa Cruz Biotechnology).
Secondary antibodies for immunoblotting were peroxidase-conjugated
AffiniPure goat anti-mouse and anti-rabbit IgG (H _ L) (115035-003 and 111-035-045, respectively; Jackson ImmunoResearch
Laboratory). Antibodies used for immunohistochemistry were Cdk5
(sc-750; Santa Cruz Biotechnology), p35 (sc-820; Santa Cruz Biotechnology),
AR (sc-7305; Santa Cruz Biotechnology), and p-Ser727STAT3 (sc-135649; Santa Cruz Biotechnology).
Cell culture. LNCaP (BCRC-60088), 22Rv1 (BCRC-60545),
DU145 (BCRC-60348), and PC3 (BCRC-60122) cell lines were
purchased from the Bioresource Collection and Research Center,
Food Industry Research and Development Institute in Taiwan. LNCaP
and 22Rv1 cells were cultured in RPMI-1640 culture medium (Sigma)
supplemented with 1.5 g/l sodium bicarbonate (NaHCO3; Sigma),
10% fetal bovine serum (FBS) (Gibco), 2 mM L-glutamine (Gibco),
4.5 g/l glucose (Sigma), 10 mM HEPES (Sigma), 1 mM sodium
pyruvate (Gibco), and 100 IU/ml penicillin-100 _g/ml streptomycin
(P/S; Sigma). Chinese hamster ovary (CHO) cells were kindly provided
by Prof. Hong-Chen Chen, Department of Life Sciences, National
Chung Hsing University, Taiwan. CHO and PC3 cells were
cultured in Ham’s F-12 medium plus 10% FBS, 1.5 g/l NaHCO3, and
P/S. DU145 cells were cultured in MEM plus 10% FBS, 1.5 g/l
NaHCO3, 0.1 mM NEAA, 0.1 mM sodium pyruvate, and P/S. All cell
lines were cultured at 37°C in a humidified atmosphere with 5% CO2.
The passage numbers of LNCaP cells in all experiments are between
passages 10 and 25.
Immunoprecipitation, fractionation, and immunoblotting analyses.
Cell were lysed in lysis buffer [50 mM Tris·HCl (pH 8.0), 0.5%
NP-40, 150 mM NaCl, 5 mM EDTA, 1 mM PMSF, 2 mM Na3VO4,
and protease inhibitor cocktail (Roche Applied Science)]. Lysates
were analyzed by direct immunoblotting (20–35 _g/lane) or blotting
after immunoprecipitation (0.5–1 mg/immunoprecipitation) using
methods modified from those described previously (3, 27, 28). Immunoprecipitates
were collected by binding to 25–40 _l of the
ExactaCruz beads (sc-45042 and sv-45043; Santa Cruz Biotechnology)
or 10–25 _l of the Mag Sepharose Xtra Protein G beads
(28-9670-70; GE Healthcare). To isolate subcellular proteins, cells
were collected and washed in PBS-Na3VO4. Pelleted cells were
resuspended in hypotonic buffer [10 mM HEPES (pH 7.9), 10 mM
KCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.5% NP-40, 1 mM PMSF, 2
mM Na3VO4, and protease inhibitor cocktail]. Nuclear proteins were
in the pellet, whereas the supernatant contained the cytosolic fraction.
The nuclear pellet was washed three times with hypotonic buffer
before lysing in nuclear extraction buffer [20 mM HEPES (pH 7.9),
0.4 M NaCl, 1 mM EDTA, 1 M EGTA, 20% glycerol, 1 mM PMSF,
2 mM Na3
VO4, and protease inhibitor cocktail]. The lysates were
mixed with a 1:3 volume of 5_ SDS sample buffer and resolved by
SDS-polyacrylamide gel electrophoresis. ECL detection reagent
(PerkinElmer Life Science) was used to visualize the immunoreactive
proteins on PVDF membranes (Perkin-Elmer Life Science) after
transfer using a Trans-Blot SD (Bio-Rad). The quantification software
was MCID Image Analysis Evaluation.
Cell proliferation assay. The modified colorimetric 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was
performed to quantify the proliferation of LNCaP cells. The yellow
MTT compound (Sigma) is converted by living cells into blue
formazan, which is soluble in isopropanol. The blue staining was
measured by using an optical density reader (Athos-2001) at 570 nm
(background of isopropanol, 620 nm) (26, 27).
Transfection. siRNA-cdk5, siRNA-p35, and nonspecific control
siRNA were purchased from Dharmacon (SMARTpool). shRNA
plasmids of pLKO.1-gfp and -cdk5 were obtained from the National
Fig. 1. STAT3 Ser727 phosphorylation is cyclin-dependent kinase 5 (Cdk5) dependent. A: the biochemical interaction among
STAT3, Cdk5, and androgen
receptor (AR) in LNCaP cells was examined by immunoprecipitation (IP) with anti-Cdk5 antibody, whereas IgG served as a
negative control. The levels of
STAT3, AR, and Cdk5 proteins (input) were evaluated by immunoblotting with commercial antibodies. _-Actin served as an
internal control. B: the inhibitory
effect of roscovitine (ROSC; 10 _M, 24 h) on the interaction between STAT3 and Cdk5 in LNCaP cells was evaluated by IP with
anti-Cdk5 antibody. Ser727
phosphorylation of STAT3 was evaluated by immunoblotting with commercial anti-p-Ser727-STAT3 antibody after ROSC
treatment. C: the interaction among
STAT3, AR, and Cdk5 in LNCaP cells was evaluated after p35 overexpression by IP with anti-STAT3 antibody. STAT3 Ser727
phosphorylation was evaluated
after p35 overexpression in LNCaP cells. D: Ser727 phosphorylation of STAT3 was evaluated after Cdk5 overexpression in
LNCaP cells (left) and Cdk5
knockdown in 22Rv1 cells (right). The control groups were transfected with pcDNA3 empty vector and siRNA control (siCon),
respectively. The numbers below
the immunoblotting images represent the fold change normalized by individual control group values. E: p-Ser727-STAT3, STAT3,
and Cdk5 in lysates of 22Rv1
xenograft tumors after Cdk5 overexpression or knockdown were examined by immunoblotting. The control groups were
overexpression or knockdown of
enhanced green fluorescent protein (EGFP). F: tyrosine (Tyr705) phosphorylation of STAT3 was evaluated after Cdk5
overexpression in LNCaP (left) and DU145
cells (right). The control groups were transfected with pcDNA3 empty vector. Tyr705 phosphorylation of STAT3 was evaluated
by immunoblotting with
commercial anti-p-Tyr705-STAT3 antibody after Cdk5 overexpression. G: the interactions of wild-type (WT)-STAT3 or
S727A-STAT3 mutant with Cdk5 were
evaluated by IP with anti-Cdk5 antibody after individual STAT3 proteins were overexpressed in LNCaP cells.
E976 CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
RNAi Core Facility located at the Institute of Molecular Biology/
Genome Research Center, Academia Sinica, Taiwan. pcDNA3FLAG-wild type (WT)-AR, pcDNA3-FLAG-S81A-AR (13), and
pGL3-3_ARE (androgen response element) expression plasmids
were kindly provided by Prof. Daniel Gioeli, Department of Microbiology,
University of Virginia. Mouse mammary tumor virus
(MMTV)-luciferase expression plasmid was a gift from Prof. ChawnShang Chang, Department of Pathology and Urology, University of
Rochester Medical Center, Rochester, NY (42). pSV-_-galactosidase
expression plasmid was a gift from Prof. Jeremy J. W. Chen, Institute
of Biomedical Sciences, National Chung Hsing University, Taiwan.
Human p35, Cdk5, and STAT3 expression plasmids were constructed
by RT-PCR amplification of the human p35 and cdk5 stat3-coding
sequences and inserted into the pcDNA3 and pcDNA4A vectors
(Invitrogen) by TA cloning. The STAT3-S727A mutant construct was
generated by PCR-based mutagenesis using the QuikChange II SiteSTAT3
Cdk5
IP Cdk5
ROSC - +
STAT3
Cdk5
IP
IgG Cdk5
AB
p-S727-STAT3
STAT3
Cdk5
β -actin
input
input
β -actin
AR
IgG Cdk5
EGFP
Cdk5
E
Xenografted tumors
p-S727-STAT3
STAT3
Cdk5
Con
Cdk5
D
β- actin
sicon
sicdk5
shgfp
shcdk5
p-S727-STAT3
STAT3
p35
β-actin
Con
p35
C
STAT3
Cdk5
IP STAT3
Cdk5 input
AR
G
STAT3
Cdk5
STAT3
WT
S72 7A
IP Cdk5
p -S727-STAT3
STAT3
β-actin
input
Cdk5
p -Y705-STAT3
STAT3
Cdk5
β -actin
Cdk5
Con
Cdk5
Con
LNCaP DU145
F
CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS E977
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
Directed Mutagenesis Kit (200524; Stratagene). Sequences of all
constructs were verified by DNA sequencing. Immunoblotting was
conducted to detect the corresponding expressed proteins after transfection.
Transfections of siRNAs or plasmids into cell lines were
performed using Lipofectamine 2000 (11668-019; Invitrogen) with 5
pmol of siRNA/105 cells and 0.8 _g DNA/105 cells.
Reporter assay. Luciferase reporter gene activity was carried out
according to the dual-light system (Applied Biosystems). Cells were
transfected with luciferase expression plasmids with _-galactosidase
plasmids, following the manufacturer’s instructions. Cells were
washed twice with PBS and lysed in lysis solution for 15–20 min. Cell
lysates were centrifuged for 20 min at 4°C. Supernatants were mixed
with luciferase substrate. Reporter gene activity was measured by
1420 Multilabel Counter Victor3 (Perkin-Elmer). The transfection
efficiency was normalized by _-galactosidase activity.
Analysis of clinical specimens. The analysis of clinical specimens
was performed using the tissue array of prostate cancer patients’
specimens purchased from US Biomax, and immunohistochemistry
was performed to determine the expression levels of examined proteins.
The specificity and selectivity of immunohistochemistry are
shown in Fig. 2. The experimental procedures were modified from the
paraffin immunohistochemistry protocol from Cell Signaling Technology.
The slides were deparaffinized in xylene and rehydrated in
graded alcohol and H2O. An antigen retrieval step with 10 nM sodium
citrate (pH 6.0) at subboiling temperature was used for each primary
antibody. Endogenous peroxidase activity was blocked by 3% hydrogen
peroxide for 10 min, followed by a 1-h incubation with blocking
serum (Vectastain ABC Kit; Vector Laboratories). The slides were
then incubated for 4 h at room temperature, followed by incubation
with biotinylated antibody (Vectastain ABC Kit) for 30 min. Finally,
the slides were incubated in ABC reagent (Vectastain ABC Kit) for 30
min and in 3,3=-diaminobenzidine (DAB; Thermo Fisher Scientific)
for 2 min. The slides were counterstained with diluted hematoxylin
solution (1:10; Merck) and dehydrated with graded alcohol and
xylene. Finally, the slides were mounted and imaged by light microscope
(Bx-51; Olympus). Blue color indicated nuclei stained by
hematoxylin. Brown color indicated the target proteins stained by the
DAB kit. The images were blinded and evaluated by two experts in
accord with a scoring system that was based on the intensity and
distribution of staining signals. The scores were divided into four
grades: negative (grade 0; 0%), low (grade 1; 1–17%), moderate
(grade 2; 18–35%), and high (grade 3; _35%) (for details, please see
Fig. 2) (15).
Quantitative real-time RT-PCR. Total RNA was isolated from
LNCaP cells with the Total RNA Miniprep Purification Kit (GeneMark). RT-PCR was performed with the High-Capacity cDNA Reverse
Transcription Kit (Applied Biosystems). The following primer
pairs were used: junB, 5=-ATCACGACGACGCCTACAC (forward)
and 5=-CTCCTGCTCCTCGGTGAC (reverse); c-fos, 5=-GGAGGAGGGAGCTGACTGAT
(forward) and 5=-GCTGCCAGGATGAATTCTAGTT
(reverse); c-myc, 5=-TGAGGAGACACCGCCCA
(forward) and 5=-AACATCGATTTCTTCCTCA (reverse); survivin, 5=TCCACTGCCCCACTGAGAAC (forward) and 5=-TGGCTCCCAGCCTTCCA
(reverse); _-actin, 5=-TTGCCGACAGGATGCAGAA (forward)
and 5=-GCCGATCCACACGGAGTACT (reverse). The quantitative
PCR reaction was conducted by the 7300 Real Time PCR System
(Applied Biosystems).
Xenograft tumor growth in nude mice. The BALB/c nude mice
were purchased from the National Laboratory Animal Center in
Taiwan. 22Rv1 cells (107 cells/mouse) were subcutaneously injected
into the backs of BALB/c nude mice. When the tumor volumes
reached 500–1,000 mm3, 10 _g of Cdk5 plasmids was mixed with in
vivo jet PEI transfection reagent (Polyplus) and injected directly into
the xenograft tumors every 3 days. The mice in the mock group
received enhanced green flourescent protein plasmids. The major axis
(L) and the short axis (W) were measured every day. Tumor volumes
were estimated using the following formula: L _ W _ W _ 3.14/6.
The mice were euthanized 3 days after the final injection. The tumors
were obtained, and the protein expression was analyzed by immunoblotting.
All animal experiments were conducted in accordance with
the National Institutes of Health Guidelines for the Care and Use of
Laboratory Animals and approved by the Institutional Animal Care
and Use Committee of National Chung Hsing University, Taiwan.
Statistics. All values are given as means _ SE. Student’s t-test was
used in the cell proliferation experiment, quantitative RT-PCR experiments,
and reporter assay. A difference between two means was
considered to be statistically significant when P _ 0.05. The correlations
between p-Ser727-STAT3 protein level and Gleason score,
Cdk5, p35, and AR protein levels in clinical specimens were analyzed
using
2
test by S-PLUS 6.2pProfessional software.
RESULTS
The correlation between STAT3 and Cdk5 in prostate cancer
cells. Here, we show the biochemical interaction of Cdk5 and
STAT3 in the prostate cancer LNCaP cell line by coimmunoprecipitation
(Fig. 1A). Consistent with our previous observation
(15), Cdk5 also interacted with AR. Interestingly, the
Cdk5-STAT3 protein interaction and STAT3 Ser727 phosphorylation
were significantly decreased by treatment with the
Cdk5 inhibitor ROSC (Fig. 1B). On the contrary, p35 overexpression
increased the Cdk5-STAT3 protein interaction and
STAT3 Ser727 phosphorylation in LNCaP cells (Fig. 1C).
Consistently, Cdk5 overexpression elevated p-Ser727-phosphorylation
level, whereas Cdk5 knockdown by siRNA reduced
it (Fig. 1D). The quantification of p-Ser727-STAT3 and
Cdk5 levels normalized by actin level was performed and
labeled in Fig. 1D. The numbers below the immunoblotting
image represent the fold change normalized to respective
control groups (Con and siCon). As the data show, Cdk5
overexpression led to a 4.9-fold increase in Cdk5 protein level
and a 2.4-fold increase in p-Ser727-STAT3 level (Fig. 1D, left).
In addition, a 30% decrease in Cdk5 level and a 60% decrease
in p-Ser727-STAT3 level were observed after Cdk5 knockdown
(Fig. 1D, right). In our published data (15), Cdk5 may positively
regulate in vivo prostate tumor growth, and those tumor
lysates were also collected to analyze protein expression in this
study (Fig. 1E). Consistently, Cdk5 levels positively modulated
Ser727 phosphorylation of STAT3 in 22Rv1 xenograft
tumors (Fig. 1E). However, the change in Tyr705 phosphorylation
of STAT3 by Cdk5 overexpression was not observed in
two different prostate cancer cell lines (Fig. 1F). Intriguingly,
the S727A (Ser/Ala) mutant of STAT3 decreased its interaction
with Cdk5 (Fig. 1G). These results suggest that the Ser727
site of STAT3 might be phosphorylated by Cdk5 before their
biochemical interaction.
In addition to the results from cell lines, we analyzed the
correlations of protein levels between p-Ser727-STAT3 and
Cdk5 or p35 in clinical samples. Prostate carcinoma specimens
from a cohort of 110 patients were collected from tissue array
product (Biomax). The protein levels in the specimens were
observed by immunohistochemical staining. The intensity of
protein staining was defined and divided into two levels (15),
negative/low and moderate/high, as indicated in Tables 1–3.
Representative images for each grade of p-Ser727-STAT3,
Cdk5, p35, and AR proteins were shown in Fig. 2. The
correlations between p-Ser727-STAT3 levels and Cdk5, p35, or
AR levels were analyzed by a
2 test.
As summarized in Table
E978 CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
1, the level of p-Ser727-STAT3 was shown to correlate significantly
with both Cdk5 and p35 levels (both P _ 0.0001,
2
27.08 and 29.69, respectively; Table 1). These results again
suggest that Cdk5 regulates STAT3 Ser727 phosphorylation in
prostate cancer.
The correlation of p-Ser727-STAT3 and prostate cancer progression.
Since p-Ser727-STAT3 might be an important factor
for prostate cancer, the correlation of STAT3 Ser 727 phosphorylation
and prostate cancer progression was investigated. The
correlation between p-Ser727-STAT3 level and Gleason score
(specific scoring system for prostate cancer and provided by
Biomax) was analyzed by
2 test.
Notably, the significant
correlation between p-Ser727-STAT3 level and Gleason score
(P
0.0115,
2
11.035; Table 2) was identified. These
observations imply that Ser727 phosphorylation of STAT3
might play an important role in prostate cancer progression.
Cdk5 responds to STAT3 activation. A previous study
showed that the levels of nuclear p-Ser727-STAT3 are increased
in breast cancer lesions and correlate to pathogenesis
(46). In our data, Cdk5 inhibition reduced the level of p-Ser727STAT3 in the nucleus of LNCaP cells, whereas the amount of
total STAT3 protein was unaffected (Fig. 3A). JunB (junB), a
gene targeted by STAT3 in response to cell proliferation (32),
was upregulated in both levels of mRNA and protein after
Cdk5 or p35 overexpression (Fig. 3, B and C). Conversely,
treatment with a Cdk5 inhibitor significantly decreased junB
protein expression (Fig. 3D). In addition to junB, we also found
that the expressions of other STAT3-regulated genes, including
survivin (18), c-myc (10), and c-fos (30), were all affected by
Cdk5 activity (Fig. 3, E–H). Taken together, our data reveal
that STAT3 transactivation is modulated by Cdk5 activity in
prostate cancer cells.
Table 1. Correlations between p-Ser727-STAT3 and Cdk5 or
p35 expression levels in human prostate cancer tissues
Expression Level
p-Ser727-STAT3, n (%)
Total (n) P Value (
2)
Negative,
low
Moderate,
high
Cdk5 _0.0001 (27.08)*
Negative, low 45 (41) 18 (16) 63
Moderate, high 10 (8.8) 37 (34) 47
Total (n) 55 55 110
p35 _0.0001 (29.69)*
Negative, low 32 (29) 5 (4.5) 37
Moderate, high 23 (21) 50 (45) 73
Total (n) 55 55 110
Cdk5, cyclin-dependent kinase 5. *P _ 0.05, statistically significant.
AR
Cdk5
p35
p- S727STAT3
Negative (0) Low (1) Moderate (2) High (3)
Fig. 2. Representative images of immunohistochemical
staining. The scoring standard for the intensities of
protein levels in the sections of patients’ specimens
was listed and categorized as negative (0, 0%), low (1,
1–17%), moderate (2, 18–35%), and high (3, _35%)
levels of 4 proteins, including p-Ser727-STAT3, AR,
Cdk5, and p35. Representative fields for the intensities
of the immunohistochemical staining are shown.
Table 2. Correlation between p-Ser727-STAT3 level and
Gleason score in human prostate cancer tissues
Gleason Score
p-Ser727-STAT3, n (%)
Negative, low Moderate, high Total (n) P Value (
2)
2–4 12 (11) 2 (1.8) 14 0.0115 (11.035)*
5–6 4 (3.6) 9 (8.2) 13
7–8 14 (13) 22 (20) 36
9–10 25 (23) 22 (20) 47
Total (n) 55 55 110
*P _ 0.05, statistically significant.
CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS E979
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
Furthermore, the data showed that the overexpression of
S727A-mutated STAT3 significantly prevented LNCaP cell
proliferation, whereas WT-STAT3 increased proliferation significantly
(WT and S727A; Fig. 4). Treatment with a Cdk5
inhibitor significantly inhibited the proliferation stimulated by
WT-STAT3 overexpression; however, combining expression
of S727A-STAT3 mutant and Cdk5 inhibitor treatment did not
cause any further decrease in proliferation (WT/ROSC and
S727A/ROSC; Fig. 4). These results suggest that Cdk5 activity
mediates prostate cancer cell proliferation by phosphorylating
STAT3.
Cdk5 promotes the interaction between STAT3 and AR.
STAT3 has been reported to positively activate AR (40). In
Fig. 1C, we observed the biochemical interaction between
p-S727-STAT3
STAT3
PARP
α-tubulin
ROSC
A NC
+
+
B
0
0.5
1
1.5
2
2.5
3
Con Cdk5 p35
Fold change of junB
mRNA (junB/actin)
∗
∗
junB
β-actin
Cdk5
Con
Cdk5
Con
p35
C
junB
ROSC - +
D
junB
p35
c-fos
Cdk5
β-actin
Con
Cdk5
0
0.25
0.5
0.75
1
C ROSC
Fold change of survivin
mRNA (survivin/actin)
Fold change of c-myc
mRNA (c-myc/actin)
Fold change of c-fos
mRNA (c-fos/actin)
E
G
F
H
**
0.9
1
1.1
1.2
C Cdk5/p35
*
0
0.9
1
1.1
1.2
C Cdk5/p35
*
0
β-actin
β-actin
Fig. 3. STAT3 activation is regulated by Cdk5.
A: LNCaP cells were treated with ROSC (10
_M) for 24 h, and protein fractionation was
performed. p-Ser727-STAT3 and STAT3 proteins
were immunoblotted in both nuclear (N)
and cytosolic (C) fractions. Poly(ADP)-ribose
polymerase (PARP) and _-tubulin represent
markers of N and C fractions, respectively. B
and C: the levels of junB (STAT3-regulated
gene) mRNA and junB proteins after Cdk5 or
p35 overexpression in LNCaP cell lysates
were evaluated by quantitative real-time PCR
and immunoblotting, respectively. The control
groups were transfected with pcDNA3 empty
vector. The experiments (B) were repeated 3
times. Data are represented as means _ SE. D:
the protein level of junB was examined after
24-h treatment with the Cdk5 inhibitor ROSC
(10 _M) in LNCaP cells. The effects of Cdk5/
p35 overexpression on expressions of survivin
(E) and c-myc (F) and the effect of ROSC (10
_M, 24 h) treatment on c-fos expression (G) in
LNCaP cells were evaluated by quantitative
real-time RT-PCR, as described in MATERIALS
AND METHODS.
H: the protein levels of c-fos
were evaluated by immunoblotting, as described
in MATERIALS AND METHODS. The experiments
were repeated 3 times, and data are
represented as means _ SE. *P _ 0.05, **P _
0.01 vs. control group.
E980 CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
STAT3 and AR by immunoprecipitating STAT3 proteins, and
this interaction could be increased by p35 overexpression (Fig.
1C). Here, we show that Cdk5 inhibition by ROSC and p35
knockdown decreased the biochemical interaction between
STAT3 and AR in LNCaP cells (Fig. 5, A and C). Conversely,
Cdk5 activation by p35 overexpression significantly stimulated
the association of STAT3 with exogenous AR in PC3 cells or
with endogenous AR in LNCaP cells (Fig. 5, B and C).
Furthermore, the STAT3 S727A mutant decreased the STAT3
interaction with endogenous AR in 22Rv1 cells and with
exogenous AR in CHO cells (Fig. 5D). These observations
indicate that Cdk5-dependent Ser727 phosphorylation of
STAT3 plays a critical role in the biochemical interaction
between STAT3 and AR in prostate cancer cells. Interestingly,
opposite of the S727A-STAT3 mutant, the S81A-AR mutant
showed an increased interaction with STAT3 compared with
WT-AR in two different prostate cancer cell lines (Fig. 5, E
and F). Notably, S81A-AR mutant obviously decreased its
interaction with Cdk5 (Fig. 5E). Our previous study indicates
that Cdk5 regulates AR functions though Ser81 phosphorylation
(15). Thus, these findings imply that when Cdk5-dependent
AR regulation (15) is blocked by the S81A mutant,
STAT3 might tend to activate mutant AR by increasing its
interaction with AR.
Cdk5 regulates AR stability through STAT3 phosphorylation.
Our previous findings indicated that Cdk5 directly regulates
AR protein stability through Ser81 phosphorylation (15). Here,
we found that Ser81 phosphorylation of AR was decreased by
S727A-STAT3 overexpression compared with WT-STAT3
overexpression in LNCaP cells (Fig. 6A). As the link between
AR Ser81 phosphorylation and AR protein stability showed in
our previous report (15), the involvement of p-Ser727-STAT3
in AR protein stability becomes interesting to explore. We used
CHX (an inhibitor of protein synthesis) to block cellular
protein synthesis and then monitored the degradation of the
existing protein. Compared with WT-STAT3 overexpression,
S727A-STAT3 mutant overexpression accelerated AR protein
degradation (Fig. 6B). The quantification from four independent
experiments was performed and statistically validated in
Fig. 6C. The quantitative results revealed the mean percentages
of AR stability compared with respective time
0 groups (the
value is 1). The percentage of AR stability in the S727ASTAT3overexpressed group was significantly lower than that
in WT-STAT3-overexpressed group after 7 h of treatment with
CHX (4 h: 70.0 _ 2.4 vs. 63.3 _ 2.9%, P
9.3 vs. 36.3 _ 4.4%, P
0.067; 7 h: 57.1 _
0.046, Fig. 6C). Furthermore, the
intensity of the ubiquitinated AR signal was stronger upon
overexpression of the S727A-STAT3 mutant compared with
WT-STAT3 overexpression in the presence of the proteasome
inhibitor MG132 (Fig. 6D). Consistently, we found that there is
a significant correlation in protein levels between p-Ser727STAT3 and AR (P _ 0.0001,
2
32.70) in the analysis of
clinical specimens (Table 3). Our data further show that AR
transcriptional activity that was performed by MMTV and
pGL3–3_ARE reporter assay was significantly decreased by
overexpression of S727A-STAT3 mutant compared with WTSTAT3
overexpression in LNCaP cells (Fig. 6E) and 22Rv1 cells
(Fig. 6F). Additionally, protein expression of the AR-regulated
gene PSA (prostate-specific antigen) was apparently inhibited by
overexpression of the STAT3 S727A mutant (Fig. 6G). Altogether,
these observations suggest that Cdk5-dependent Ser727
phosphorylation of STAT3 increases the STAT3-AR interaction,
AR phosphorylation, AR protein stability, and AR transactivation.
DISCUSSION
Cdk5 has recently been shown to play numerous roles in
nonneuronal human cells (11). Previously, we reported that
Cdk5 stabilizes AR protein through phosphorylation and
thereby promotes the growth of prostate cancer cells (15). In
this study, we discovered that Cdk5 is a positive modulator to
STAT3 activation, cell growth, and STAT3-dependent AR
activation in prostate cancer cells through phosphorylation of
Ser727 on STAT3. Although Cdk5-dependent STAT3 regulation
by phosphorylation has been shown in many studies (9, 12,
26, 34, 43), this study is the first one to investigate Cdk5
regulation of STAT3 Ser727 phosphorylation and activation in
prostate cancer. Based on our findings, the regulation of Ser 727
phosphorylation of STAT3 modulated by Cdk5 is involved in
the proliferation of prostate cancer cells and will become an
important target of future prostate cancer research.
STAT3 has been reported to be constitutively activated in
various tumors (17) and functions as an oncoprotein by contributing
to cell proliferation, cell cycle progression, cellular
transformation, differentiation, immune responses, and prevention
of apoptosis (5, 14, 21, 31, 41). Although Tyr705 phosphorylation
by nonreceptor or receptor tyrosine kinases has
been believed to be a prerequisite for STAT3 activation, the
role of Ser727 phosphorylation of STAT3 in biological function
is still controversial. The serine residue is located in a
conserved PMSP (or PSP) motif within the COOH-terminal
transcriptional activation domain of STAT3 (35) and has
been reported to be phosphorylated by many kinases, such
Change of proliferation (%)
-40
-30
-20
-10
0
10
Fig. 4. Prostate cancer cell growth is regulated by Cdk5 through STAT3 Ser 727
phosphorylation. The effects of WT-STAT3, S727A-STAT3 mutant, and
ROSC (10 _M, 48 h) treatment on LNCaP cell proliferation were determined
by MTT assay. The proteins were expressed for 4 days. Control (empty vector,
pcDNA3) value of proliferation was set at 0. The y-axis represents %cell
proliferation change; n 8/treatment, and experiments were repeated 3 times.
Data are represented as means _ SE. *P _ 0.05 and **P _ 0.01 vs.
WT-STAT3 group.
CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS E981
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
as Cdk5 (9, 12, 26, 34), Cdk1 (35), Erk (24, 25), p38 (45),
Pin1 (29), PKC_ (19), and PKC(2), upon exposure to
extracellular stimuli. Several lines of evidence have indicated
recently that Ser727 phosphorylation directly promotes
STAT3 activation, anchorage-independent growth of noncancerous
prostate epithelial cells (RWPE-1) and prostate
cancer cells (LNCaP), prostatic tumorigenesis in NOD/
SCID mice, and cell invasion in the absence of Tyr705
phosphorylation (33). According to our observations, Tyr 705
phosphorylation of STAT3 in AR-positive prostate cancer
cell lines was relatively weaker than Ser727 phosphorylation,
and there is no obvious correlation between Cdk5 activation
and STAT3 Tyr705 phosphorylation in prostate cancer cells
(Fig. 1F). The role of STAT3 is thought to be that of
conveying signals into the nucleus in combination with
Cdk5 (12, 23). Our published results demonstrate that Cdk5dependent Ser727 phosphorylation of STAT3 is important in
promoting thyroid cancer growth (26). Moreover, a recent
study indicates that Cdk5 prevents DNA damage through
STAT3 Ser727 phosphorylation (9). These observations im-
A
STAT3
Cdk5 IP AR
ROSC
-+
C
Con
p35
STAT3
AR
sip35
sicon
IP AR
AR
STAT3
Cdk5
AR
p35
IP AR
-+
B
STAT3
p-S727-STAT3
STAT3
AR
β-actin
AR
input
IP AR
STAT3
AR
+
+
D
p-Y705-STAT3
22Rv1 CHO
E
STAT3
AR
IP Flag
LNCaP
WT
S727A
S727A
WT
F
STAT3
AR
IP Flag
DU145
Flag-WT-AR
Flag-S81A-AR
Flag-WT-AR
Flag-S81A-AR Cdk5
Fig. 5. The interaction between STAT3 and AR is regulated by Cdk5-dependent Ser727 phosphorylation. A: the interaction among
Cdk5, STAT3, and AR after
ROSC (10 _M, 24 h) treatment in LNCaP cells or (B) p35 overexpression in PC3 cells was evaluated by IP with anti-AR
antibody. C: the protein interaction
between AR and STAT3 after p35 overexpression or knockdown was analyzed by immunoprecipitating AR proteins in LNCaP
cells. D: the interactions between
WT-STAT3 or S727A-STAT3 mutant and AR after transient expression of the aforementioned proteins were evaluated by IP
with anti-AR antibody in 22Rv1
and Chinese hamster ovary (CHO) cells. The inputs were evaluated by immunoblotting. E and F: the interactions between
exogenous FLAG-tagged WT-AR or
S81A-AR mutant with STAT3 were evaluated by IP with FLAG antibody in LNCaP and DU145 cells.
E982 CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
A
AR
p-S727-STAT3
STAT3
β-actin
WT
STAT3
S727A
STAT3
B
p-S727-STAT3
STAT3
p-S81-AR
AR
β-actin
STAT3
WT
S727A
D
Ub
STAT3
AR + +
AR
WT
S727A
IP AR
E
0
0.25
0.5
0.75
1
1.25
WT-STAT3 S727A-STAT3
MMTV
3XARE
Fold change of luciferase
activity (LNCaP)
∗
#
∗
C
0
0.2
0.4
0.6
0.8
1
1.2
047
WT-STAT3
S727A-STAT3
Fold change of AR stability
∗
0.0
0.2
0.4
0.6
0.8
1.0
MMTV
3XARE
F
STAT3
PSA
p-S727-STAT3
STAT3
β-actin
WT
S727A
# ∗
∗
Fold change of luciferase
activity (22Rv1)
G
Fig. 6. The protein phosphorylation, stability, and transactivation of AR are mediated by STAT3 through Ser727 phosphorylation.
A: Ser81 phosphorylation status
was evaluated after overexpressing WT-STAT3 or S727A-STAT3 mutant in LNCaP cells. B: LNCaP cells were treated with
cycloheximide (CHX; an inhibitor
of protein synthesis, 10 _g/ml) for 0, 4, or 7 h, and AR protein degradation was monitored by immunoblotting after the
overexpression of WT-STAT3 or
S727A-STAT3 mutant. C: the quantitative results revealed the mean percentages of AR stability compared with respective time
0 groups (the value is 1). The
independent experiments were repeated 4 times. Data are represented as means _ SE; *P _ 0.05 vs. WT-STAT3-overexpressed
group. D: the ubiquitination
of exogenous AR was detected after overexpressing WT-STAT3 or S727A-STAT3 mutant by IP with anti-AR antibody. MG132
(proteasome inhibitor; 5 _M,
6 h) was used to block the proteasome-dependent degradation. E and F: mouse mammary tumor virus (MMTV) luciferase (black
bars) and 3_ARE (androgren
response element)-luciferase (open bars) reporter assays were performed in LNCaP (E) and 22Rv1 cells (F) after WT-STAT3 or
S727A-STAT3 overexpressions.
The expression of _-galactosidase served as the internal control. Data are represented as means _ SE; #P _ 0.05 vs.
WT-STAT3-overexpressed group by using
MMTV-luciferase expression plasmid and **P _ 0.01 vs. WT-STAT3-overexpressed group by using 3_ ARE-luciferase
expressing plasmid. G: the levels of
PSA (AR-regulated gene) protein after WT-STAT3 or S727A-STAT3 mutant overexpressions in LNCaP cells were evaluated by
immunoblotting.
CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS E983
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
ply that the regulation of Cdk5-dependent STAT3 Ser727
phosphorylation is a relevant finding in cancer biology.
In this study, we first demonstrate Cdk5 activity-dependent
STAT3-Cdk5 interaction and Ser727 phosphorylation of STAT3
in prostate cancer cells and 22Rv1 xenograft tumor cells (Fig.
1). Significant correlations of p-Ser727-STAT3 levels with
Cdk5 or p35 expression in clinical specimens of prostate
cancer were also shown (Table 1). This evidence suggests that
p-Ser727-STAT3 levels were mediated by Cdk5 in prostate
cancer. In regard to the function of STAT3 transactivation, our
data show that inhibition of Cdk5 by ROSC treatment decreased
only the level of p-Ser727-STAT3 in the nucleus but
not total STAT3 levels (Fig. 3A). We further examined the
expression of several STAT3-targeted genes related to cell
proliferation and confirmed that Cdk5 does promote STAT3
transactivation (Fig. 3, B–H). Therefore, we infer that Cdk5
primarily affects nuclear STAT3 by phosphorylation, in turn
promoting cell proliferation (Fig. 4). The experiment in Fig. 4
was performed by LNCaP cells that contain a relatively high
basal level of phospho-Ser727-STAT3 compared with other
prostate cancer cell lines in our previous observation. This
phenomenon suggests that LNCaP cells might rely more on
p-Ser727-STAT3-related signaling than other cell lines. It is
hard to obtain more active STAT3 by overexpression since the
basal activation of STAT3 has already been high. This might
explain why STAT3 overexpression in LNCaP cells induced
only a 10% proliferation increase. On the other hand, overexpression
of the S727A-STAT3 mutant dominant negatively
reversed the function (cell proliferation) of endogenous STAT3
(S727A; Fig. 4), which supports the above explanation. Furthermore,
combining overexpression of the S727A-STAT3
mutant and ROSC treatment did not cause further inhibition of
proliferation compared with WT-STAT3 overexpression with
ROSC treatment (WT/ROSC and S727A/ROSC; Fig. 4). These
results again suggest that STAT3 serves as a downstream
signaling protein of Cdk5 in the regulation of cell proliferation.
It has been shown that the biochemical interaction of STAT3
with AR can be enhanced by IL-6 challenge (7). In addition,
the STAT3 S727A mutant significantly blocks IL-6-induced
AR transactivation and STAT3-AR complex formation (1).
Therefore, Cdk5 regulation on the interaction between AR and
STAT3 becomes interesting to investigate. The results show
that the coimmunoprecipitation of Cdk5, AR, and STAT3
molecules was observed (Figs. 1, A and C, and 5, A, B, and E).
Besides, our data indicate that Cdk5 activation is important to
the interaction between STAT3 and AR (Fig. 5, A–C). The
STAT3 S727A mutant diminished its binding to AR (Fig. 5D).
These findings suggest that S727 phosphorylation of STAT3
plays an essential role in the interaction between STAT3 and
AR in prostate cancer cells, and this phenomenon is controlled
by Cdk5. Additionally, the data in Fig. 3A reveal that Cdk5
phosphorylates STAT3 in the nucleus. Thus, we assume that
p-Ser727-STAT3 proteins would also interact with AR proteins
in the nucleus. Interestingly, a slight increase in Tyr705 phosphorylation
was observed in the S727A-STAT3 mutant (Fig.
5D), implying that there might be a compensatory effect
between Tyr705 and Ser727 phosphorylation in prostate cancer
cells. On the other hand, our previous report indicates that
Ser81 of AR is a Cdk5-phosphorylated site and important to AR
function (15). Interestingly, distinct from the results in Fig. 5D,
the interaction between STAT3 and the S81A-AR mutant was
significantly increased compared with that of STAT3 and
WT-AR (Fig. 5, E and F). These results suggest that STAT3
might activate mutant AR by increasing their interaction in a
negative feedback manner, whereas Cdk5-dependent AR activation
(15) is blocked by S81A-AR mutant. Finally, since
Ser81 phosphorylation contributes to AR stability and activation
(15), we found that AR protein stability, AR transactivation,
and the expression of the AR-regulated gene (PSA) were
all regulated by Ser727 phosphorylation of STAT3 (Fig. 6).
Qin et al. (33) demonstrated that high levels of STAT3
Ser727 phosphorylation are observed in malignant prostate
specimens. Table 2 and our unpublished data also indicate that
p-Ser727-STAT3, p35 (Cdk5 activator), and AR proteins all
correlated with the Gleason score in prostate cancer patients.
Consistent with the clinical observations, we discovered that
protein levels of Cdk5, p35, AR, and p-Ser727-STAT3 were all
higher in androgen-independent LNCaPdcc cells [screened
from LNCaP cells in androgen-deprived conditions (15)] than
in parental LNCaP cells (unpublished data). Altogether, our
clinical evidence and our in vitro data show that Cdk5-dependent
STAT3 Ser727 phosphorylation plays an important role in
the transition of androgen requirement of prostate cancer cells
and prostate cancer progression.
In conclusion, our results illustrate that Cdk5 activity contributes
to the proliferation of prostate cancer cells by directly
regulating STAT3 function through Ser727 phosphorylation
and indirectly mediating AR activation through p-Ser727-
STAT3 interaction. These findings lead us to hypothesize that
a Cdk5-STAT3-AR axis plays a decisive role in the development
and progression of prostate cancer and will become a
research target or a diagnostic and therapeutic target in the near
future.
ACKNOWLEDGMENTS
We thank Dr. M. T. Lai, (Chang Bing Show Chawn Memorial Hospital,
Taiwan) for helping with immunohistochemical analysis and Drs. H. C. Chen,
T. H. Lee, J. W. Chen, and H. C. Cheng (National Chung Hsing University,
Taiwan) for technical support.
GRANTS
This work was supported by the National Science Council (NSC 97-2320B-005-002-MY3, NSC101-2320-B005-004-MY3), the Taichung Veterans
General Hospital/National Chung Hsing University Joint Research Program
(TCVGH-NCHU1027606), and in part by the Taiwan Ministry of Education
under the Aiming for the Top University plan. RNAi reagents (shcdk5
TRCN0000021467 and shgfp TRCN0000072178) were obtained from the
National RNAi Core Facility located at the Institute of Molecular Biology/
Genomic Research Center, Academia Sinica, supported by the National Research
Program for Genomic Medicine Grants of the NSC (NSC 97-3112-B001-016).
DISCLOSURES
The authors have no conflicts of interest, financial or otherwise, to declare.
Table 3. Correlation between p-Ser727-STAT3 and AR
expression levels in human prostate cancer tissues
Expression Level
(AR)
p-Ser727-STAT3, n (%)
Negative, low Moderate, high Total (n) P Value (
2)
Negative, low 35 (32) 6 (5.5) 41 _0.0001 (32.70)*
Moderate, high 20 (18) 49 (45) 69
Total (n) 55 55 110
AR, androgen receptor. *P _ 0.05, statistically significant.
E984 CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
AUTHOR CONTRIBUTIONS
F.-N.H., M.-C. Chen, Y.-T.P., P.-C.L., and M.-C. Chiang performed the
experiments; F.-N.H., M.-C. Chen, K.-C.L., Y.-T.P., E.L., and H.L. analyzed
the data; F.-N.H., E.L., and H.L. interpreted the results of the experiments;
F.-N.H. prepared the figures; F.-N.H. drafted the manuscript; M.-C. Chen,
E.L., and H.L. contributed to the conception and design of the research; M.-C.
Chen, J.-T.H., and H.L. edited and the revised manuscript; H.L. approved the
final version of the manuscript.
REFERENCES
1. Aaronson DS, Muller M, Neves SR, Chung WC, Jayaram G, Iyengar
R, Ram PT. An androgen-IL-6-Stat3 autocrine loop re-routes EGF signal
in prostate cancer cells. Mol Cell Endocrinol 270: 50–56, 2007.
2. Aziz MH, Manoharan HT, Church DR, Dreckschmidt NE, Zhong W,
Oberley TD, Wilding G, Verma AK. Protein kinase Cepsilon interacts
with signal transducers and activators of transcription 3 (Stat3), phosphorylates
Stat3Ser727, and regulates its constitutive activation in prostate
cancer. Cancer Res 67: 8828–8838, 2007.
3. Berger R, Lin DI, Nieto M, Sicinska E, Garraway LA, Adams H,
Signoretti S, Hahn WC, Loda M. Androgen-dependent regulation of
Her-2/neu in prostate cancer cells. Cancer Res 66: 5723–5728, 2006.
4. Bowman T, Garcia R, Turkson J, Jove R. STATs in oncogenesis.
Oncogene 19: 2474–2488, 2000.
5. Buettner R, Mora LB, Jove R. Activated STAT signaling in human
tumors provides novel molecular targets for therapeutic intervention. Clin
Cancer Res 8: 945–954, 2002.
6. Chen F, Wang Q, Wang X, Studzinski GP. Up-regulation of Egr1 by
1,25-dihydroxyvitamin D3 contributes to increased expression of p35
activator of cyclin-dependent kinase 5 and consequent onset of the
terminal phase of HL60 cell differentiation. Cancer Res 64: 5425–5433,
2004.
7. Chen T, Wang LH, Farrar WL. Interleukin 6 activates androgen
receptor-mediated gene expression through a signal transducer and activator
of transcription 3-dependent pathway in LNCaP prostate cancer
cells. Cancer Res 60: 2132–2135, 2000.
8. Coffer P, Lutticken C, van Puijenbroek A, Klop-de Jonge M, Horn F,
Kruijer W. Transcriptional regulation of the junB promoter: analysis of
STAT-mediated signal transduction. Oncogene 10: 985–994, 1995.
9. Courapied S, Sellier H, de Carné Trécesson S, Vigneron A, Bernard
AC, Gamelin E, Barré B, Coqueret O. The cdk5 kinase regulates the
STAT3 transcription factor to prevent DNA damage upon topoisomerase
I inhibition. J Biol Chem 285: 26765–26778, 2010.
10. Demeterco C, Itkin-Ansari P, Tyrberg B, Ford LP, Jarvis RA, Levine
F. c-Myc controls proliferation versus differentiation in human pancreatic
endocrine cells. J Clin Endocrinol Metab 87: 3475–3485, 2002.
11. Dhavan R, Tsai LH. A decade of CDK5. Nat Rev Mol Cell Biol 2:
749–759, 2001.
12. Fu AK, Fu WY, Ng AK, Chien WW, Ng YP, Wang JH, Ip NY.
Cyclin-dependent kinase 5 phosphorylates signal transducer and activator
of transcription 3 and regulates its transcriptional activity. Proc Natl Acad
Sci USA 101: 6728–6733, 2004.
13. Gioeli D, Ficarro SB, Kwiek JJ, Aaronson D, Hancock M, Catling AD,
White FM, Christian RE, Settlage RE, Shabanowitz J, Hunt DF,
Weber MJ. Androgen receptor phosphorylation. Regulation and identification
of the phosphorylation sites. J Biol Chem 277: 29304–29314, 2002.
14. Hodge DR, Hurt EM, Farrar WL. The role of IL-6 and STAT3 in
inflammation and cancer. Eur J Cancer 41: 2502–2512, 2005.
15. Hsu FN, Chen MC, Chiang MC, Lin E, Lee YT, Huang PH, Lee GS,
Lin H. Regulation of androgen receptor and prostate cancer growth by
cyclin-dependent kinase 5. J Biol Chem 286: 33141–33149, 2011.
16. Huang HF, Murphy TF, Shu P, Barton AB, Barton BE. Stable
expression of constitutively-activated STAT3 in benign prostatic epithelial
cells changes their phenotype to that resembling malignant cells. Mol
Cancer 4: 2, 2005.
17. Inghirami G, Chiarle R, Simmons WJ, Piva R, Schlessinger K, Levy
DE. New and old functions of STAT3: a pivotal target for individualized
treatment of cancer. Cell Cycle 4: 1131–1133, 2005.
18. Ito T, Shiraki K, Sugimoto K, Yamanaka T, Fujikawa K, Ito M,
Takase K, Moriyama M, Kawano H, Hayashida M, Nakano T, Suzuki
A. Survivin promotes cell proliferation in human hepatocellular carcinoma.
Hepatology 31: 1080–1085, 2000.
19. Jain N, Zhang T, Kee WH, Li W, Cao X. Protein kinase C delta
associates with and phosphorylates Stat3 in an interleukin-6-dependent
manner. J Biol Chem 274: 24392–24400, 1999.
20. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J
Clin 60: 277–300, 2010.
21. Kortylewski M, Jove R, Yu H. Targeting STAT3 affects melanoma on
multiple fronts. Cancer Metastasis Rev 24: 315–327, 2005.
22. Kuo HS, Hsu FN, Chiang MC, You SC, Chen MC, Lo MJ, Lin H. The
role of Cdk5 in retinoic acid-induced apoptosis of cervical cancer cell line.
Chin J Physiol 52: 23–30, 2009.
23. Levy DE, Darnell JE Jr. Stats: transcriptional control and biological
impact. Nat Rev Mol Cell Biol 3: 651–662, 2002.
24. Lim CP, Cao X. Regulation of Stat3 activation by MEK kinase 1. J Biol
Chem 276: 21004–21011, 2001.
25. Lim CP, Cao X. Serine phosphorylation and negative regulation of Stat3
by JNK. J Biol Chem 274: 31055–31061, 1999.
26. Lin H, Chen MC, Chiu CY, Song YM, Lin SY. Cdk5 regulates STAT3
activation and cell proliferation in medullary thyroid carcinoma cells. J
Biol Chem 282: 2776–2784, 2007.
27. Lin H, Juang JL, Wang PS. Involvement of Cdk5/p25 in digoxintriggered
prostate cancer cell apoptosis. J Biol Chem 279: 29302–29307,
2004.
28. Lin H, Lin TY, Juang JL. Abl deregulates Cdk5 kinase activity and
subcellular localization in Drosophila neurodegeneration. Cell Death Differ
14: 607–615, 2007.
29. Lufei C, Koh TH, Uchida T, Cao X. Pin1 is required for the Ser727
phosphorylation-dependent Stat3 activity. Oncogene 26: 7656–7664,
2007.
30. Mori S, Sakamoto A, Yamashita K, Fujimura L, Arima M, Hatano M,
Miyazaki M, Tokuhisa T. Effect of c-fos overexpression on development
and proliferation of peritoneal B cells. Int Immunol 16: 1477–1486, 2004.
31. Nikitakis NG, Siavash H, Sauk JJ. Targeting the STAT pathway in head
and neck cancer: recent advances and future prospects. Curr Cancer Drug
Targets 4: 637–651, 2004.
32. Piechaczyk M, Farras R. Regulation and function of JunB in cell
proliferation. Biochem Soc Trans 36: 864–867, 2008.
33. Qin HR, Kim HJ, Kim JY, Hurt EM, Klarmann GJ, Kawasaki BT,
Duhagon Serrat MA, Farrar WL. Activation of signal transducer and
activator of transcription 3 through a phosphomimetic serine 727 promotes
prostate tumorigenesis independent of tyrosine 705 phosphorylation. Cancer
Res 68: 7736–7741, 2008.
34. Selvendiran K, Koga H, Ueno T, Yoshida T, Maeyama M, Torimura
T, Yano H, Kojiro M, Sata M. Luteolin promotes degradation in signal
transducer and activator of transcription 3 in human hepatoma cells: an
implication for the antitumor potential of flavonoids. Cancer Res 66:
4826–4834, 2006.
35. Shi X, Zhang H, Paddon H, Lee G, Cao X, Pelech S. Phosphorylation
of STAT3 serine-727 by cyclin-dependent kinase 1 is critical for nocodazoleinduced mitotic arrest. Biochemistry 45: 5857–5867, 2006.
36. Strock CJ, Park JI, Nakakura EK, Bova GS, Isaacs JT, Ball DW,
Nelkin BD. Cyclin-dependent kinase 5 activity controls cell motility and
metastatic potential of prostate cancer cells. Cancer Res 66: 7509–7515,
2006.
37. Tang D, Yeung J, Lee KY, Matsushita M, Matsui H, Tomizawa K,
Hatase O, Wang JH. An isoform of the neuronal cyclin-dependent kinase
5 (Cdk5) activator. J Biol Chem 270: 26897–26903, 1995.
38. Tsai LH, Delalle I, Caviness VS Jr, Chae T, Harlow E. p35 is a
neural-specific regulatory subunit of cyclin-dependent kinase 5. Nature
371: 419–423, 1994.
39. Ueda T, Bruchovsky N, Sadar MD. Activation of the androgen receptor
N-terminal domain by interleukin-6 via MAPK and STAT3 signal transduction
pathways. J Biol Chem 277: 7076–7085, 2002.
40. Ueda T, Mawji NR, Bruchovsky N, Sadar MD. Ligand-independent
activation of the androgen receptor by interleukin-6 and the role of steroid
receptor coactivator-1 in prostate cancer cells. J Biol Chem 277: 38087–
38094, 2002.
41. Vinkemeier U. Getting the message across, STAT! Design principles of
a molecular signaling circuit. J Cell Biol 167: 197–201, 2004.
42. Wang L, Lin HK, Hu YC, Xie S, Yang L, Chang C. Suppression of
androgen receptor-mediated transactivation and cell growth by the glycogen
synthase kinase 3 beta in prostate cells. J Biol Chem 279: 32444–
32452, 2004.
CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS E985
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org
43. Wang Y, Xie WY, He Y, Wang M, Yang YR, Zhang Y, Yin DM, JordanSciutto KL, Han JS, Wang Y. Role of CDK5 in neuroprotection from serum
deprivation by mu-opioid receptor agonist. Exp Neurol 202: 313–323, 2006.
44. Wen Z, Zhong Z, Darnell JE Jr. Maximal activation of transcription by
Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:
241–250, 1995.
45. Xu B, Bhattacharjee A, Roy B, Xu HM, Anthony D, Frank DA,
Feldman GM, Cathcart MK. Interleukin-13 induction of 15-lipoxygenase
gene expression requires p38 mitogen-activated protein kinase-mediated
serine 727 phosphorylation of Stat1 and Stat3. Mol Cell Biol 23:
3918–3928, 2003.
46. Yeh YT, Ou-Yang F, Chen IF, Yang SF, Wang YY, Chuang HY, Su
JH, Hou MF, Yuan SS. STAT3 ser727 phosphorylation and its association
with negative estrogen receptor status in breast infiltrating ductal
carcinoma. Int J Cancer 118: 2943–2947, 2006.
47. Zhang Z, Jones S, Hagood JS, Fuentes NL, Fuller GM. STAT3 acts as
a co-activator of glucocorticoid receptor signaling. J Biol Chem 272:
30607–30610, 1997.
E986 CDK5 REGULATES STAT3/AR IN PROSTATE CANCER CELLS
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00615.2012 • www.ajpendo.org