Unit 4: Molecular Genetics
Left side
Pg #
Right Side
Pg #
Unit Page
58
Table of contents
59
Double Bubble
60
C.N. – DNA & RNA
Structure
61
DNA & RNA Coloring
62
DNA & RNA
Unit 4: DNA & RNA
Chapter 12-1
Learning Goals
• 1. What is the primary job of DNA? Why
are genes important?
• 2. Describe the structure of DNA.
(Include the 3 parts of a nucleotide)
• 3. Explain the base pairing rules.
• 4. Describe the parts of a DNA double helix
• 5. Compare & Contrast DNA & RNA (Give
at least 2 similarities & 2 differences.
Nucleic Acids
• DNA and RNA are nucleic
acids (polymer) made up of
nucleotides (monomer).
• DNA’s primary purpose is to
code for proteins.
–Proteins express our genes!
DNA: deoxyribonucleic acid
• Genes are made up of DNA
–1. Genes carry information from
one generation to the next.
–2. Genes determine inherited
traits.
–3. Genes are easily copied.
Structure of DNA
• Made up of nucleotides (3
parts of a nucleotide):
– 1) Deoxyribose: a sugar
– 2) Phosphate group: bonds one
nucleotide to the next sugar
– 3) Nitrogenous base: there are 4 kinds of
bases in DNA
• There are four kinds of bases
in DNA:
• Purines = adenine(A) & guanine(G)
• Pyrimidines = cytosine(C) & thymine (T)
Nucleotides
Base Pairing
• Rules
–Hydrogen bonds can only
form between certain base
pairs:
1) adenine only bonds to
thymine (Aunt = Tia)
2) guanine only bonds to
cytosine (Cat = Gato)
Practice pairing the bases to
complete the DNA
• ATCGGCTCAATCGATTACCA
• TAGC
Discovery of DNA
• Rosalind Franklin used X-ray
diffraction to get information
about the structure of DNA.
• She aimed an X-ray beam at
concentrated DNA samples and
recorded the scattering pattern of
the X-rays on film.
The Double Helix
–Using clues from Franklin’s
pattern, James Watson and
Francis Crick built a model
that explained how DNA
carried information and could
be copied.
• Shape of DNA: Double Helix
Double helix:
Double (2)
stranded,
twisted ladder
• Rails of ladder –
formed by the
“sugar-phosphate
backbone”
– alternating
deoxyribose sugar
and phosphates
• Steps of ladder formed by
nitrogenous base
pairs (A, T, G, C)
– two strands of the
ladder are
“complimentary” to
each other. (they
go together)
RNA: ribonucleic acid
• RNA is used to take
DNA info outside the
nucleus to be used by
cell
– Structure
• RNA is a single strand
• RNA has ribose instead
of deoxyribose
• RNA uses Uracil
instead of Thymine
Learning Goals
• 1. What is the primary job of DNA? Why
are genes important?
• 2. Describe the structure of DNA.
(Include the 3 parts of a nucleotide)
• 3. Explain the base pairing rules.
• 4. Describe the parts of a DNA double helix
• 5. Compare & Contrast DNA & RNA (Give
at least 2 similarities & 2 differences.