Appendix Supplementary Methods
Yeast Strain Constructions
To construct strains expressing His–FLAG–Atg8 and His–FLAG–Atg8G116, DNA fragments were amplified
by PCR using the plasmids pFA6a–8xHIS–TEV–3xFLAG–ATG8–KanMX6 or pFA6a–8xHIS–TEV–
3xFLAG–ATG8(G116)–KanMX6 as a template and the following primers: His8–3xFLAG–ATG8–kan-FW
5’-ATAAGAGAATCTAATAATTGTAAAGTTGAGAAAATCATAATAAAAATAATTACTAGAGACatgcatcaccatcat
cacca; His8–3xFLAG–ATG8-kan-RV 5’- CATTCTTATACTGGAACAATAGATGGCTAATGAGTCCCTAT
AATTTCGATTTTAGATGTTttagaaaaactcatcgagca. Amplified fragments were introduced into yeast cells to
allow replacement of the chromosomal ATG8 gene by homologous recombination. Total DNA was isolated
from kanamycin-resistant transformants, and subjected to PCR amplification for a region containing the
ATG8 gene locus and subsequent DNA sequencing. Strains expressing GFP–Atg8 were similarly
constructed with a PCR product prepared using pFA6a-GFP–ATG8-zeo and the following primers:
ATG8-flk(951-1030)-FW 5’-CTAATAATTGTAAAGTTGAGAAAATCATAATAAAAATAATTACTAGAGACAT
GAAGTCTACATTTAAGTCTGAATATCCA; ATG8-flk(1595-1535)-RV 5’- ACAGATCGTAATCTGTAAGTAA
ATACCATAACGTGCTCACATTTGTCTCCAAATACTGGTGatcgatgaattcgagctcg. All these plasmids were
gifted from Dr. Hitoshi Nakatogawa (Tokyo Institute of Technology, Japan).
Enzymatic Measurement of Autophagic Activity
Cells derived from the KOY137 strain background containing a chromosomally integrated Pho860 were
subjected to an alkaline phosphatase (ALP) assay as reported previously (Noda et al., 1995). The
autophagic activity was estimated by ALP assays using 1-naphthyl phosphate disodium salt as a
fluorogenic substrate. One unit was defined as the activity to release 1 mol naphthol/min/mg protein.
Immunoprecipitation
Coimmunoprecipitation assays were performed using control (pep4 prb1 atg32) or opi3 (pep4 prb1
ATG32 or ATG32–HA) strains expressing Atg32 or Atg32–HA from a low-copy plasmids with the ATG32
promoter. 200 OD600 units of cells gown in SDGly for 24 h were collected by centrifugation, washed once
with H2O, resuspended in TD buffer (0.1 M Tris-SO4 [pH 9.4], 10 mM DTT), and incubated for 10 min at
30°C. Cells were then collected by centrifugation, and resuspended in SP buffer (20 mM potassium
phosphate buffer [pH7.4], 1.2 M sorbitol) containing Zymolyase 100T (Seikagaku). After digestion for 90
min at 30°C, spheroplasts were washed with SP buffer, and resuspended in SH buffer (0.6 M sorbitol, 20
mM HEPES-KOH [pH 7.4]) containing protease inhibitor cocktail (Thermo Scientific). Whole cell
homogenates were subjected to centrifugation (500 x g) at 4°C for 5 min. Membrane-enriched and soluble
fractions were separated by centrifugation (17,000 x g) at 4°C for 10 min. Mitochondria-enriched fractions
were resuspended in lysis buffer (50 mM Tris-HCl [pH 7.5], 100 mM NaCl, 0.1 mM EDTA, 0.4% Triton-X100,
and protease inhibitor cocktail) at 4°C for 8 min, and subjected to centrifugation (15,000 x g) at 4°C for 5
min. The supernatant was incubated with 30 l anti-HA antibody-conjugated agarose (Sigma) at 4°C for 2 h
with gentle agitation. The beads were washed twice with wash buffer (50 mM Tris-HCl [pH 7.5], 300 mM
NaCl, 0.1 mM EDTA, 0.4% Triton-X100, and protease inhibitor cocktail), and once with PBS.
Immunoprecipitates were eluted with SDS-sample buffer, and analyzed by western blotting. The solubilized
fractions and eluted immunoprecipitates loaded per lane were 0.5% and 30% of the total extracts subjected
to incubation with anti-HA antibody-conjugated agarose, respectively.
Fluorescence Microscopy
To examine the localization of Atg32–GFP, Atg11–2xmCherry, and Atg17–2xmCherry, fluorescence
microscopy was performed using an inverted fluorescence microscope (IX81, Olympus) equipped with an
electron-multiplying CCD camera (ImagEM, C9100-13, Hamamatsu Photonics) and a 150x TIRF objective
(UAPON 150XOTIRF, NA/1.45, Olympus). To increase image intensity and decrease background intensity,
specimens were illuminated with a highly inclined laser beam (Tokunaga et al., 2008). Images were
acquired and processed by MetaMorph software (Molecular Devices).
In Vitro GATE-16-lipidation and -delipidation Assay
Recombinant protein expression/purification, liposome preparation, and in vitro conjugation of GATE-16 to
PE or PMME were performed according to methods described elsewhere (Hanada et al., 2007; Ichimura et
al., 2004; Nakatogawa et al., 2007). Briefly, human GATE-16 (5 M), Atg7 (E1, 1 M), and Atg3 (E2, 2 M)
were purified from E. coli, and incubated with liposomes (2 mM lipids, Avanti Polar Lipids) composed of 55
mol%
dioleoylphosphatidylethanolamine
(DOPE)
or
dioleoylphosphatidylmonomethylethanolamine
(DOPMME), 35 mol% 1-palmitoyl-2-oleoylphosphatidylcholine (POPC), and 10 mol% phosphatidylinositol
(PI) from bovine liver in the presence of 1 mM ATP at 30°C for 2 h. The reactions were further treated with
or without purified Atg4 (2 M) at 30°C for 0 or 60 min, and analyzed by 12% Bis-Tris NuPAGE (Life
Technologies) and CBB staining.
Appendix References
Brachmann, C.B., Davies, A., Cost, G.J., Caputo, E., Li, J., Hieter, P., and Boeke, J.D. (1998). Designer
deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for
PCR-mediated gene disruption and other applications. Yeast 14, 115-132.
Hanada, T., Noda, N.N., Satomi, Y., Ichimura, Y., Fujioka, Y., Takao, T., Inagaki, F., and Ohsumi, Y. (2007).
The Atg12-Atg5 conjugate has a novel E3-like activity for protein lipidation in autophagy. J. Biol. Chem. 282,
37298-37302.
Ichimura, Y., Imamura, Y., Emoto, K., Umeda, M., Noda, T., and Ohsumi, Y. (2004). In vivo and in vitro
reconstitution of Atg8 conjugation essential for autophagy. J. Biol. Chem. 279, 40584-40592.
Kondo-Okamoto, N., Noda, N.N., Suzuki, S.W., Nakatogawa, H., Takahashi, I., Matsunami, M., Hashimoto,
A., Inagaki, F., Ohsumi, Y., and Okamoto, K. (2012). Autophagy-related protein 32 acts as autophagic
degron and directly initiates mitophagy. J. Biol. Chem. 287, 10631-10638.
Nakatogawa, H., Ichimura, Y., and Ohsumi, Y. (2007). Atg8, a ubiquitin-like protein required for
autophagosome formation, mediates membrane tethering and hemifusion. Cell 130, 165-178.
Noda, T., Matsuura, A., Wada, Y., and Ohsumi, Y. (1995). Novel system for monitoring autophagy in the
yeast Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 210, 126-132.
Sikorski, R.S., and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient
manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.
Suzuki, K., Kirisako, T., Kamada, Y., Mizushima, N., Noda, T., and Ohsumi, Y. (2001). The
pre-autophagosomal structure organized by concerted functions of APG genes is essential for
autophagosome formation. EMBO J. 20, 5971-5981.
Tokunaga, M., Imamoto, N., and Sakata-Sogawa, K. (2008). Highly inclined thin illumination enables clear
single-molecule imaging in cells. Nat. Methods 5, 159-161.