Unit V DNA RNA Prot Synthesis
advertisement
Subject/Course Title: Biology-H 15-16 Unit Title/Skill Set: 5. DNA, RNA and Protein Synthesis--10 Days Overview: This unit examines the role of nucleic acids and cellular organelles in the production of proteins and the resultant expression of phenotype. Unit Essential Question(s): How do organisms use DNA and RNA to make proteins? What factors affect gene expression? Unit Competencies—What students need to be able to do (skills) as Do Now’s. 2. Explain the structural relationships between DNA, genes, and chromosomes. 4. Describe how DNA replication results in the transmission and/or conservation of the genetic information. 8. Describe the role of the nucleus, ribosomes, ER, and Golgi apparatus in the production and processing of proteins. 9. Describe how genetic mutations alter DNA sequence and may or may not affect phenotype. 10. Explain the unified process of protein synthesis. Unit Concepts—What students need to know as Guided Reading Structure of DNA o Components of a nucleotide o Base-pair rule (Chargaff’s Rule) Structure of eukaryotic chromosomes Semi-conservative/DNA replication process Similarities and differences between DNA and RNA Types of RNA Transcription uses DNA to make RNA Translation uses RNA to make a protein Role of ribosomes, endoplasmic reticulum and Golgi apparatus in assembling, transporting, packaging and modifying different proteins Phenotype as a function of gene expression (DNA to protein to phenotype) Different types of gene mutations Possible effect of mutation (change in the DNA sequence) on phenotype Environmental influences on phenotype NUCLEIC ACIDS: DNA, RNA, and PROTEIN SYNTHESIS SYLLABUS—H 1. 2. 3. 4. 5. Every reading assignment is expected to be completed BEFORE you come to class. Confused about the reading? Prepare questions to ask in class AS YOU READ. Be a Scout and Be Prepared…Reading quizzes may be given at ANY time. Homework is due ON THE DUE DATE (Sectionals—Turn in on the due date…Field trips and illnesses—turn in on your first day back.). Do Now’s are to be completed in class and turned in THAT BLOCK. (Absent??—Turn in first day back. Questions on the reading that goes with the Do Now??—Turn in written question specifying what you don’t understand. Be specific. Don’t say, “I don’t get it”.) Vocabulary understanding is necessary. Attend to the words at the beginning of each chapter, or words that you encounter that are new to you. 6. **In order for you to participate in structured activities and labs, you must have your Guided Reading up-to-date as well as your vocabulary. 7. Labs are to be read beforehand. DAY 1-2 3 LESSON Guided Reading—self-scored DNA history DNA components/structure/function Relationship between DNA, genes, and chromosomes HOMEWORK/DUE Read: 9.2, 9.3, 10.1 p. 207-14, 10.2 p. 219-20 Watch Videos: 1 and 2 Activity: Nucleotide cha-cha otherwise known as line dancing in the hall Watch: remaining videos 4 Vocabulary DNA-structure/function 5 Vocabulary DNA replication-structure/function Activity: DNA base bonds, nucleotides Activity: DNA Chutes Ladders Activity: Replication Rock/Paper/Scissors 6 Vocabulary DNA transcription DUE: Reading corrections Activity: Transcription Jeopardy 7 Vocabulary Reading the AA Table Translation to proteins, ER, Golgi Activity: Translation Penny Toss 8 Lab: The Genetic Code/Stellar Thread DUE: Bgram 9 Amoeba Sisters video Putting It Together Activity: Amoeba Sisters HO Activity: Cut the strips, make models 10 11 Lab: CHNOPS Vocabulary Mutations Activity: Random Acts of Mutations, Sickle Cell DUE: Protein Synthesis CHNOPS Lab Test sometime, somewhere, somehow, good luck. TBA Videos that you need to watch Animation resources: You may also locate these on the server in my distribution box under Nucleic Acids Amoeba Sisters Youtube: Find the one(s) on DNA vs RNA and Protein Synthesis (we’re doing the worksheet that goes with this): DNA structure and Function-- https://www.youtube.com/watch?v=_POdWsii7AI DNA Replication-- https://www.youtube.com/watch?v=dKubyIRiN84 DNA Replication: The Cell’s Extreme Team Sport-https://www.youtube.com/watch?v=5qSrmeiWsuc&list=PLwL0Myd7Dk1F0iQPGrjehze3 eDpco1eVz&index=9 Why RNA is Just as Cool as DNA-- https://www.youtube.com/watch?v=0ElozX1k8M&index=19&list=PLwL0Myd7Dk1F0iQPGrjehze3eDpco1eVz Protein Synthesis and the Lean, Mean Ribosome Machines-https://www.youtube.com/watch?v=h5mJbP23Buo&index=20&list=PLwL0Myd7Dk1F0i QPGrjehze3eDpco1eVz Other soures: http://www.phschool.com/science/biology_ place/labbench/index.html http://www.wwnorton.com/college/biology/discover bio4/_core/ch/08/animations.aspx http://www.bozemanscience.com/ Interactive site http://www.dnai.org/ DNA/RNA/PROTEIN SYNTHESIS VOCABULARY 1. Chromosomes-A single piece of coiled DNA and associated proteins found in linear forms in the nucleus of eukaryotic cells and circular forms in the cytoplasm of prokaryotic cells; contains genes that code for traits. Each species has its own number of chromosomes. 2. Deoxyribonucleic Acid (DNA) A biological macromolecule that codes for the genetic information for traits (carried in proteins) in living organisms. It can make copies (replication) of itself and copies onto RNA. 3. DNA Replication-The process in which DNA makes a duplicate copy of itself from a template (pattern). 4. Golgi Apparatus-An organelle found in eukaryotic cells responsible for the final stages of processing proteins for release by the cell. 5. Mutation-A permanent change of genetic material (ie: chromosomal mutation or gene mutation) that may be passed to offspring. 6. Nucleus-A membrane-bound organelle in eukaryotic cells functioning to maintain the genetic material and, through the expression of that material, controlling and regulating cellular activities (homeostasis). 7. Protein Synthesis-The process in which amino acids are arranged in a linear sequence through the process of transcription of DNA and to RNA and the translation of RNA to a doubly twisted polypeptide molecule with a specific shape which determines its function. 8. Ribosome-A cellular structure composed of RNA and proteins that is the site of protein synthesis in eukaryotic AND prokaryotic cells. 9. Semiconservative Replication-The process in which the DNA molecule uncoils and separates into two strands. Each original strand becomes a template (pattern) on which a new strand is constructed, resulting in two DNA molecules identical to the original DNA molecule. 10. Transcription-The process in which a strand of messenger RNA (mRNA) is synthesized by using the genetic information found on a strand of DNA acting as a template. 11. Translation-The process in which the messenger RNA (mRNA) molecule on a ribosome is encoded to produce a sequence of amino acids for protein synthesis. DNA Chutes and Ladders Questions 1. Name three scientists responsible for discovering the structure of DNA. 2. What are the three components of a nucleotide? 3. What two components of a nucleotide never change? 4. What component of a nucleotide changes? 5. What are the four DNA bases and how do they pair? 6. Wilkins and Franklin are known for… 7. Watson and Crick are known for… 8. Explain the significance of the physical structure of each DNA base. 9. How can every living thing share the same four bases in their DNA and still have so much variety? 10. What is the result of a single error in DNA bases? REPLICATION ROCK/PAPER/SCISSORS QUESTIONS 1. What is the process called whereby a new copy of DNA is made? 2. What is the reason that DNA makes a copy of itself? 3. The ending, ‘ase’ refers to any molecule (usually an enzyme) that breaks bonds. What do you think DNA helicase does? 4. The resulting DNA strand from replication is an exact ___ of the original strand. 5. An important function of DNA polymerase is to check the new strand for ____. 6. What kind of bonds are formed between the bases? 7. A gene is a series of bases that code for a single ______? 8. What are replication forks? 9. Explain what a complementary base pair is. Give an example. 10. A virus that invades bacteria and makes the bacteria produce more viruses are called… TRANSCRIPTION JEOPARDY GAME QUESTIONS 1. The process of transcription copies the DNA code onto… 2. Three differences between DNA and mRNA are… 3. Thymine in DNA is replaced by ___ in mRNA. 4. DNA is found ONLY in the nucleus, but mRNA is made in the nucleus and then goes to the… 5. In the first step of transcription, DNA unwinds, the Hydrogen bonds between bases break and the DNA separates. Then… 6. What are the base pairing in mRNA? 7. RNA polymerase does what in transcription? 8. Explain how a template works in transcription. 9. How are prokaryotes different from eukaryotes during transcription? 10. What is the function of mRNA? Penny Toss Translation 1. A codon is to mRNA as a ______ is to tRNA. 2. Ribosomes function as an ________________________ for proteins. 3. The role of the ER is to _________________________________. 4. Golgi apparatus functions in _________________, __________________, _____________________, and ________________different proteins. 5. The ‘essential’ building blocks of proteins are ___________________, and come from the _____________that you eat. 6. ______________help to form peptide bonds between adjacent amino acids. 7. After the long chain of aa’s are formed, the chain ____________________ and ____________________which will determine its function. 8. The genetic code for making proteins is described as being nearly ___________ as all living things use the same series of ___________ in groups of three known as a ____________. 9. In order for a ribosome to begin making a protein, ___________must be present in the codon. 10. In order for a ribosome to stop making a protein, a ‘stop’ codon is needed. What disease may occur if there is a missing stop? CHNOPS Lab Constructing a Model of Protein Synthesis PRE-LAB DISCUSSION Genes are the units that determine inherited characteristics, such as hair color and blood type. Genes are lengths of DNA molecules that determine the structure of polypeptides (the building blocks of proteins) that our cells make. The sequence of nucleotides in DNA determines the sequence of amino acids in polypeptides, and thus the structure of proteins. In a process called transcription, which takes place in the nucleus of the cell, messenger RNA (mRNA) reads and copies the DNA’s nucleotide sequences in the form of a complementary RNA molecule. Then the mRNA carries this information in the form of a code to the ribosomes, where protein synthesis takes place. The code, in DNA or mRNA, specifies the order in which the amino acids are joined together to form a polypeptide. The code words in mRNA, however, are not directly recognized by the corresponding amino acids. Another type of RNA called transfer RNA (tRNA) is needed to bring the mRNA and amino acids together. As the code carried by mRNA is “read” on a ribosome, the proper tRNAs arrive in turn and give up the amino acids they carry to the growing polypeptide chain. The process by which the information from DNA is transferred into the language of proteins is known as translation. In this investigation, you will simulate the mechanism of protein synthesis and thereby determine the traits inherited by fictitious organisms called CHNOPS. CHNOPS, whose cells contain only one chromosome, are members of the kingdom Animalia. A CHNOPS chromosome is made up of eight genes (A, B, C, D, E, F, G and H), each of which is responsible for a certain trait. PROCEDURE 1. To determine the trait for Gene A of your CHNOPS, first you must transcribe the DNA into mRNA. 2. Then, you must write the nucleotides of tRNA that are complementary to mRNA. 3. Use the chart in Figure 1 to find the corresponding amino acid sequence. Remember to use the mRNA sequence and not the tRNA sequence in this chart! 4. Using figure 2, find the trait that matches the amino acid sequence. To save space, you may abbreviate each amino acid. Record this information in the appropriate place. 5. Repeat steps 1 through 4 for the remaining genes (B through F). 6. Create two additional traits for your CHNOPS and give their initial DNA sequence, mRNA codon, tRNA anticodon, and the amino acid sequence. Start with a trait listed in Figure 2 and work backwards to fill in the information for Genes G and H. 7. Using all the inherited traits, sketch your CHNOPS in the space provided. Figure 1 First Base U C A G U Phenylalanine Phenylalanine Leucine Leucine Leucine Leucine Leucine Leucine Isoleucine Isoleucine Isoleucine Methionine (start) Valine Valine Valine Valine Second Base C A Serine Tyrosine Serine Tyrosine Serine Stop Serine Stop Proline Histidine Proline Histidine Proline Glutamine Proline Glutamine Threonine Asparagine Threonine Asparagine Threonine Lysine Threonine Lysine Alanine Alanine Alanine Alanine Aspartate Aspartate Glutamate Glutamate G Cysteine Cysteine Stop Tryptophan Arginine Arginine Arginine Arginine Serine Serine Arginine Arginine Glycine Glycine Glycine Glycine Figure 2 Amino Acid Sequence Tyrosine – Alanine – Tyrosine Lysine – Leucine Proline – Alanine – Alanine Histidine – Arginine Tryptophan – Proline – Isoleucine Threonine – Serine – Serine Tyrosine – Glutamate - Aspartate Lysine – Arginine – Serine – Leucine Valine – Isoleucine Serine – Alanine Trait Hairless Hairy Plump Skinny Four-legged Two-legged Long nose Short nose No freckles Freckles Proline – Serine – Phenylalanine - Glycine Proline – Serine – Glycine Methionine – Tryptophan – Stop Cysteine – Methionine – Alanine Methionine – Phenylalanine – Valine Valine – Glycine – Cysteine Asparagine – Threonine – Methionine Cysteine – Aspartate - Stop Blue skin Orange skin Short legs Long legs Long tail Short tail Spots Stripes Third Base U C A G U C A G U C A G U C A G Gene A ACC GGT DNA T AT mRNA _____________________ tRNA _____________________ Amino Acid Sequence ___________________ Trait ______________________ Gene D GGA CGC Gene B Gene C DNA A G C C G A mRNA _____________________ tRNA _____________________ Amino Acid Sequence ___________________ Trait ______________________ DNA TTT AAC mRNA _____________________ tRNA _____________________ Amino Acid Sequence ___________________ Trait ______________________ Gene E GGG AGG AAA DNA C GA mRNA _____________________ tRNA _____________________ Amino Acid Sequence ___________________ Trait ______________________ DNA CCC mRNA _____________________ tRNA _____________________ Amino Acid Sequence ___________________ Trait ______________________ Gene G Gene H DNA mRNA _____________________ tRNA _____________________ Amino Acid Sequence ___________________ Trait ______________________ DNA mRNA _____________________ tRNA _____________________ Amino Acid Sequence ___________________ Trait ______________________ Gene F ATG CTC DNA C TA mRNA _____________________ tRNA _____________________ Amino Acid Sequence ___________________ Trait ______________________ ** Draw your CHNOPS on a blank sheet of paper. Use color. Label each gene with its letter. ______Score CHNOPS DQ’s Name_____________________ Date_______Blk__ ANALYZE AND CONCLUDE 1. Compare and contrast translation and transcription. Transcription Both Translation 2. What is the specific site for transcription in the cell? _____________________________ 3. What is the specific site for translation in the cell? _______________________________ 4. How many tRNA nucleotides form an anticodon that will attach to the mRNA codon? ____________ 5. Suppose you knew the makeup of specific proteins in a cell. How could you determine the particular DNA code that coded for them? (Think about it, you did this in this lab.) CHNOPS DQ’s. Cont. 6. How could one change in a DNA nucleotide alter the formation of the translated protein? For example, if we changed or removed the nucleotide in bold from the following DNA strand, how would that affect the formation of the protein? Explain (step by step). DNA : TACTCAATTCACGCT NAME __________________________________ Mutations Worksheet (staff.fcps.net/einman/biology/MutationsWS.doc) Deletion, Insertion & Substitution There are several types of mutation: DELETION (a base is lost/deleted) INSERTION (an extra base is added/inserted) --- Deletion & insertion may cause what’s called a FRAMESHIFT mutation, meaning the reading “frame" changes, thus changing the amino acid sequence from this point forward SUBSTITUTION (one base is substituted for another) --- If a substitution changes the amino acid, it’s called a MISSENSE mutation --- If a substitution does not change the amino acid, it’s called a SILENT mutation --- If a substitution changes the amino acid to a “stop,” it’s called a NONSENSE mutation Complete the boxes below. Classify each as Deletion, Insertion or Substitution AND as either frameshift, missense, silent or nonsense (Hint: Deletion & Insertion will always be frameshift). Original DNA Sequence: T A C A C C T T G G C G A C G A C T… mRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T… What’s the mRNA sequence? he chan What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T… What’s the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ chan Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T… What’s the mRNA sequence? chan What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T… What’s the mRNA sequence? chan What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? _________________________________ Original DNA Sequence: T A C A C C T T G G C G A C G A C T… mRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #5 T A C A C C T T G G G A C G A C T… What’s the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? _________________________________ 1. Which type of mutation is responsible for new variations of a trait? 2. Which type of mutation does not result in an abnormal amino acid sequence? 3. Which type of mutation stops the translation of an mRNA molecule? chan Sickle Cell Anemia Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the hemoglobin molecule. Recall that hemoglobin carries oxygen in your red bloods cells. The mutation causes these red blood cells to become stiff & sickleshaped when they release their oxygen. The sickled cells tend to get stuck in blood vessels, causing pain and increased risk of stroke, blindness, damage to the heart & lungs, and other conditions. --- Analyze the DNA strands below to determine what amino acid is changed AND what type of mutation occurred Normal hemoglobin DNA C A C G T A G A C T G A G G A C T C… Normal hemoglobin mRNA Normal hemoglobin AA sequence ---------------------------------------------------------------------------------------------Sickle cell hemoglobin DNA C A C G T A G A C T G A G G A C A C… Sickle cell hemoglobin mRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why. ----------------------------------------------------------------------------------------------------------------- DNA, RNA and Protein Synthesis Do Now Answers—H ________Score Name____________________________ Day Write sentences that rephrase the question. Use punctuation. 2 4 8 9 10 Unit V DNA/RNA/Protein Synthesis Guided Reading Honors 15-16 __________Score Name______________________________ Read: 10.2 The Structure of DNA 1. Make a small portion of the model (Fig. 10.6) of the double helix shape below in the space on the left. Make the model 8 base pairs long. Use four different colors for bases. Use circles to represent the bases. Make a key to identify the bases. Make the bonds double or triple. 2. Name five scientists and their part in the DNA discovery. 1. 2. 3. 4. 5. 3. In the following base sequence fill in the missing base based on the base-pairing rule. A- T- G- C- Read: 10.3 The Replication of DNA 4. Replication is the process of : _________________________________________ for the purpose of (there are three):_______________________________________________________________ _____________________________________________________________________. DNA/RNA/Protein Synthesis Guided Reading Page 2 5. Identify two enzymes during Replication, and tell the function of each. Enzyme Function Enzyme Function 6. Use the model below to color the bases according to your previous key. In two sentences, tell what happens at the replication fork. Define and use the word ‘nucleotide’ in your sentence. DNA/RNA/Protein Synthesis Guided Reading Page 3 Read: 10.4 Protein Synthesis: RNA and Transcription 7. What are four differences between DNA and RNA? (Hint: bases, # of strands, sugar, location.) _______________________________________________________________________ _______________________________________________________________________ _______________________________________________________________________ _______________________________________________________________________ 8. mRNA’s function is to ____________________________________________________(why is it called ‘messenger’?) of making ________________________ (what macromolecule) to the ___________________ (what organelle?) in the _________________(location). 9. The cell needs to make proteins. The first thing that has to happen is that the DNA in the ________________________(location) unzips a section that codes for the protein to be made. _____________(how many) strand(s), called the ‘sense’ strand, is used as a _______________________________(meaning the ‘pattern’) to make a copy strand. The new strand is going to take the message of making proteins to the ribosomes in the ________________________and so is called _________________________________. The Genetic Code: Three-Nucleotide ‘Words’ 10. The code for proteins is really a group of ____________(how many) bases that code for one _____________ ____________. These molecules come from the food that you eat. Look at Fig 4. Notice that the ending of most of these molecules is ____________ which is a feature they have in common, much like enzymes generally end in ‘ase’. In order to read the chart in Fig 4, think of Battleship, or Bingo. Notice the heading At the top on the left says, ‘First Base’. So if your sequence of bases is ‘ACG’, the first base is ‘A’. So I look down the column U, C, A, G and locate ‘A’, the third base down. Keep your finger there. Look across the top in the middle where it says ‘Second Base’. My second base is ‘C’. So I look across the row and find the C, just left of middle, and follow it down to my ‘A’ base row. The third base is ‘G’. Look across the top to the right and see the column going down that says, ‘third base’. Locate the DNA/RNA/Protein Synthesis Guided Reading Page 4 base ‘G’ in the third row grouping down the page that corresponds to where my finger was keeping my place for the first base, ‘A’. What is the amino acid that is coded for by the base sequence ACG? ____________________________________ Look for the AUG codon. What surprise ‘amino acid’ does it code for? ___________ Logically, if there’s a start signal, there’s probably a stop signal. What are the three ‘STOP’ codons? _______________ _______________ _______________ 11. What do you think might happen if the ‘start’ code had a mutation? _____________________________________________________________________ 12. What do you think might happen if the ‘stop’ code had a mutation? ____________________________________________________________________ Translation 13. In translation, the amino acids that are coded for in the mRNA codons, are located in the cytoplasm (and come from the breakdown of the food that you eat). In order for the correct amino acids to be transferred to the ribosomes/mRNA complex, another single stranded RNA is used: _______________, which transfers to amino acid the ribosome. tRNA drops the amino acid in place behind the previous amino acid, then continues back to the cytoplasm for more of that particular amino acid. When the new amino acid arrives in the correct place, a peptide bond is formed. 14. When the long string of amino acids are released from the ribosome, it is called a chain, because that’s what it looks like. It then folds, then twists, the twists again to form a very complex shape. It’s the complex shape that gives the protein its function. What is the ultimate source of the protein’s complex shape______________________ 15. How can only four bases, in a sequence of three’s, code for such diversity? _____________________________________________________________________ DNA/RNA/Protein Synthesis Guided Reading Page 5 Read: Mutations, p. 239-40 16. What are the four chromosome mutations and their effects? Mutation Effect 17. What are the four gene mutations and their effects? Mutation Effect DNA/RNA/Protein Synthesis Guided Reading Page 6 Watch These Videos, Answer the Questions: 18. https://www.youtube.com/watch?v=_POdWsii7AI Why don’t the stomach genes for digestive enzymes make digestive enzymes if they are found in your skin cells? What is this system of gene control called? ____________________________________________________________________ ____________________________________________________________________ 19. https://www.youtube.com/watch?v=dKubyIRiN84 What is the problem with the 3’ to 5’ strand in replication? ____________________________________________________________________ ____________________________________________________________________ Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Structure of DNA—Auditory _________Score Name______________________________Blk______ Directions: 1. Watch the following on Youtube: https://www.youtube.com/watch?v=_POdWsii7AI 2. Google an image of the structure of DNA. 3. Make a VOKI, PHOTO BOOTH (using the video option), or your iPhone audio app to produce an audio file describing: a. The three parts of a nucleotide. b. The four bases (just say the first letter for each). c. How the bases pair as complementary. d. What the double helix shape looks like. e. The number of Hydrogen bonds between the A/T, and the C/G. f. **Email your audio file at: sherry_kreamer @etownschools.org. 4. Ask your classroom partner to listen/watch your answers. 5. Ask your partner to verbally recite back to you 3 a. through 3e. 6. Have your partner print his/her name then sign in the space below. _____________________________________________(printed) _____________________________________________(signed) 7. Staple this page to your original Guided Reading and turn it in. **In your email: Subject line: StructDNAAudCorrect Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Replication of DNA—Auditory _________Score Name______________________________Blk______ Directions: 1. Google DNA Replication Video. (Pick one that is not longer than 5-10 minutes.) 2. Copy the URL below: 3. Use the information from the video or other sources to construct a rap, poem, song, cheer that describes the steps in DNA Replication. 4. Record your information in an audio file. 5. **Email it to me at sherry_kreamer@etownschools.org. 6. Perform your audio for your classroom partner. 7. Ask your partner to print his/her name and sign below. _______________________________________________(printed) _______________________________________________(signed) 8. Staple this page to the original and turn it in. **In your email: Subject line: RepDNAAudCorrect Unit V DNA/RNA/Prot Syn—H 15-16 Corrections From Genes to Proteins: Transcription—Auditory _________Score Name______________________________Blk______ Directions: 1. Google and watch the Amoeba Sisters, RNA. 2. Take notes on the similarities and differences between DNA/RNA. 3. Make a three column graphic organizer headed: DNA | BOTH | RNA 4. Complete the graphic organizer. 5. Take a picture of your graphic organizer either with an iPhone, or computer Photo Booth. 6. **Email the picture to me at: sherry_kreamer@etownschools.org. 7. Ask your classroom partner to listen to you explain the similarities and differences of DNA and RNA. 8. Ask your classroom partner to print and sign his/her name below. ________________________________________________(printed) ________________________________________________(signed) 9. Staple this to the original and turn in. **In your email: Subject line: TranscripAudCorrect Unit V DNA/RNA/Prot Syn—H 15-16 Corrections The Genetic Code: Three-Nucleotide ‘Words’—Auditory _________Score Name______________________________Blk______ Directions: 1. Record sentences 10-12 with the correct answers from the answer key (you may use your iPhone, Photo Booth Video, or other audio app). 2. Play your audio file for your classroom partner. 3. **Email your audio file to me at: sherry_kreamer@etownschools.org. 4. Ask your classroom partner to print and sign his/her name below. ______________________________________________(printed) ______________________________________________(signed) 5. Staple this to the original and turn in. **In your email: Subject line: GenCodeAudCorrect Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Translation—Auditory _________Score Name______________________________Blk______ Directions: 1. Google: Protein Synthesis Video for a clip that is no more than 5-10 minutes long. 2. Play and listen to the video as many times as you need to in order to learn the steps of translation. 3. Replay with the audio muted. 4. You will be the audio for the video while you play it muted. 5. Do this by watching the video while recording your audio on a school computer Photo Booth Video or your iPhone audio app. 6. **Email the audio file to me at: sherry_kreamer@etownschools.org. 7. Ask your classroom partner to listen to your audio. 8. Ask your classroom partner to print and sign his/her name below. ______________________________________________________(printed) ______________________________________________________(signed) 9. Staple this to the original and turn in. **In your email: Subject line: TranslAudCorrect \ Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Mutations—Auditory _________Score Name______________________________Blk______ Directions: 1. Google each of the mutation types for images. 2. Copy and paste OR screen capture pix one image for each mutation type. 3. Paste to a blank document (googledox, Word, whatever). 4. Audio tape your describing what each mutation looks like and the effects on the protein. 5. **Email the audio file to me at: sherry_kreamer@etownschools.org. 6. Ask your classroom partner to listen to your audio recording. 7. Ask your classroom partner to print and sign his/her name below. ____________________________________________________(printed) ____________________________________________________(signed) 8. Staple this to the original and turn in. **In your email: Subject line: MutatAudCorrect Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Structure of DNA—Kinesthetic _________Score Name______________________________Blk______ Directions: 1. Watch the following on Youtube: https://www.youtube.com/watch?v=_POdWsii7AI 2. Make a cartoon strip that shows/explains the structure of DNA. You can use a googledox, or any computer cartoon application, OR you can draw one on a piece of paper. 3. **Email the cartoon strip to me (or take a pix of it and mail the pix) at: sherry_kreamer@etownschools.org. 4. Explain the cartoon strip to you classroom partner. 5. Ask your classroom partner to print and sign his/her name below. __________________________________________(printed) __________________________________________(signed) 6. Staple this to the original and turn it in. **In your email: Subject line: DNAKinCorrect Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Replication—Kinesthetic _________Score Name______________________________Blk______ Directions: 1. Google: Replication on Youtube. 2. Pick one that is no longer than 5-10 minutes. 3. Use your text replication section as additional information. 4. Create a colored pencil model of DNA replication. 5. Use a title and the following labels: DNA, A, T, C, G, Original, Copy, DNA synthase, DNA ligase, nucleotide 6. Explain your model to your classroom partner. 7. Ask your classroom partner to print and sign his/her name below. __________________________________________________(printed) __________________________________________________(signed) 8. Staple this to your original and turn it in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Transcription—Kinesthetic _________Score Name______________________________Blk______ Directions: 1. Google: DNA transcription, images and choose one that is easy to see and understand. 2. Print the image. 3. Cut the image into at least eight squares puzzle pieces, all the exact same size. 4. Practice putting the puzzle together. 5. Explain what is happening as you practice. 6. Ask your classroom partner to put the puzzle together. 7. YOU explain to your partner what is happening as he/she assembles the puzzle. 8. Take a picture of your partner with the assembled picture. 9. **Email the picture to me as an attachment or as part of a googledoc. 10. Ask your partner to print and sign his/her name below. ________________________________________(printed) ________________________________________(signed) 11. Staple this to the original and turn it in. **In your email: Subject line: TranscKinCorrect Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Genetic Code: Three-Nucleotide ‘Words’—Kinesthetic _________Score Name______________________________Blk______ Directions: 1. Use an amino acid chart (there’s one in your textbook) to create a secret code book. Here’s how: 2. Take a picture of the chart and print it, or go to the IMC and print a copy of the one in your textbook, or find one on the internet and print it. 3. Use the following ‘secret message’ that refers the base pairing rules for DNA and RNA. The six message amino acids are: (their codon arrangements are below them.) A and T Codon 1 C and G Codon 2 are in DNA Codon 3 but A and U Codon 4 and C and G Codon 5 are in RNA Codon 6 4. These will substitute for the real amino acids on the chart (you will have to make the six ‘message amino acids’ on paper, cut them out, glue them onto the amino acid chart in ANY box). 5. Now create the mRNA codon sequence that will reproduce the six ‘amino acids’ in order. (Choose ANY of the codon sequences in the chart box that code for the amino acid you glued into the box.) 6. Write the mRNA codons 1-6 below the amino acid chart. 7. Ask your classroom partner to put the six amino acids in order according to the mRNA that you wrote on the bottom of the amino acid chart. (He/she should have the message as in #3 above.) 8. Give your partner assistance and explanations as needed to complete the task successfully. 9. Ask your partner to print and sign below. __________________________________________________(printed) __________________________________________________(signed) 10 Staple the amino acid chart paper that you created, this instruction/signature page, and your original assignment together and turn it in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Translation—Kinesthetic _________Score Name______________________________Blk______ Directions: 1. Use your text, google, youtube to find images of DNA translation. 2. Use Playdoh to create a color-coded replica of translation. 3. Make a key using a blank sheet of paper. 4. The key should have the following vocabulary (use color squares with each word): ribosome, tRNA, mRNA, codon, amino acid, protein chain, A-U, C-G 5. Take a picture of the completed project. 6. **Email the picture to me at: sherry_kreamer@etownschools.org. 7. Explain the model to classroom partner. 8. Ask your classroom partner to print and sign his/her name below. ______________________________________________(printed) ______________________________________________(signed) 9. Staple this to the original and turn it in. **In your email: Subject line: TranslKinCorrect Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Mutations—Kinesthetic _________Score Name______________________________Blk______ Directions: 1. Read your text information on ‘Mutation’. 2. Create a box chart just like your original reading assignment. 3. Cut out each of the boxes. 4. You now have a box puzzle with the mutation and effects. 5. Explain each mutation and its effects to your classroom partner. 6. Ask your partner to assemble the puzzle. 7. If needed, explain any corrections to your partner. 8. Ask your partner to print and sign below. __________________________________________(printed) __________________________________________(signed) 9. Staple this to the original and turn it in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Structure of DNA-Visual _________Score Name______________________________Blk______ Directions: 1. Make flashcards for matching with the word on ONE card, and the definition on ANOTHER card of the following: DNA, phosphate, sugar, base, nucleotide, A-T, C-G, Wilkins, Watson, Crick 2. 3. 4. 5. 6. Practice matching the words with the definitions. Practice doing the matching game with your classroom partner. Ask your partner to complete the game by him/herself. If needed, give your partner helpful clues to make any corrections. Ask your partner to print and sign his/her name below. ___________________________________________(printed) ___________________________________________(signed) 7. Staple this to the original and turn it in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Replication-Visual _________Score Name______________________________Blk______ Directions: 1. Google: DNA replication coloring blank OR go to the IMC and enlarge and print the picture or replication that is in your original reading assignment. 2. Color the model using the following structures and colors: phosphate/sugar (original strand)-yellow, phosphate/sugar (copy strand)-orange, A-light blue, T-dark blue, C-pink, G-red, replication fork-green (just box in the general area of the fork and lightly color over the DNA pieces). 3. Explain the process to your classroom partner. 4. Ask your partner to explain it back to you. 5. Ask your partner to print and sign his/her name below. ____________________________________________(printed) ____________________________________________(signed) 6. Staple your model and this paper to your original and turn in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Transcription-Visual _________Score Name______________________________Blk______ Directions: 1. Use numbers 7-9 on your original assignment to create questions/answers for a matching test. 2. Make an answer key on a separate piece of paper. 3. Explain transcription to you classroom partner. 4. Ask your partner to take the test. 5. If necessary, re-explain and missed questions to your partner. 6. DO NOT ERASE ANY MISSED ANSWERS ON YOUR PARTNER’S TEST. 7. Ask your partner to print and sign his/her name below. ___________________________________________(printed) ___________________________________________(signed) 8. Staple your matching test and this paper to your original and turn in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Genetic Code: Three-Nucleotide ‘Words’-Visual _________Score Name______________________________Blk______ Directions: 1. Make a treasure message map using the amino acid chart as the map. 2. Use the following mRNA codons to bury the ‘treasure message’: AUG = Start codon, UUU = You, CGA = Just, GGU = Won, GUU = A ACU = Prize, UAG = Stop 3. First, go to the IMC and print a copy of the amino acid chart, OR download one from the internet and print it. 4. Locate the ‘treasure message’ codons on the amino acid chart. 5. Cut out the following ‘amino acid words’ below: START YOU JUST WON A PRIZE STOP 6. Glue these amino acid words on the chart instead of the real amino acid. Be sure you are substituting the right word with the right mRNA sequence. 7. Explain to your classroom partner how to read the amino acid chart. 8. Give your partner this strip of mRNA codons to find the amino acid treasure message: AUGUUUCGAGGUGUUACUUAG 9. Tell your partner that he/she must complete the amino acid sequence from the mRNA strip to find the buried treasure. 10. If necessary, re-explain how to use the bases in groups of three and find the correct amino acid. 11. When your partner successfully completes the code, bring him/her to me and you will both get a prize. 12. Have your partner print and sign his/her name below. ________________________________________________(printed) ________________________________________________(signed) 13. Staple the chart and this paper to your original and turn it in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Translation-Visual _________Score Name______________________________Blk______ Directions: 1. Review the text model of translation. 2. Make a colored pencil model of the text model. 3. Do NOT use titles or labels. 4. Explain the model to your classroom partner. 5. As you explain, write the title and labels on the model. 6. Have your partner explain back to you the process. 7. If necessary, re-explain areas where your partner appears to be stuck. 8. Ask your partner to print and sign his/her name below. ___________________________________________(printed) ___________________________________________(signed) 9. Staple the model and this paper to your original and turn it in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Mutations-Visual _________Score Name______________________________Blk______ Directions: 1. Make colored pencil models of each of the mutations. 2. Number them. 3. Do NOT title them. 4. Do NOT indicate what are their effects. 5. On ‘flashcards’, write the type of mutation on one side, and the effects on the other. 6. Explain the model pictures to your classroom partner, using the name and effects on proteins. 7. Ask your partner to match the models with the flashcard name/effects. 8. If necessary, re-explain the mutation name and effect. 9. Have your partner print and sign his/her name below. ___________________________________________(printed) ___________________________________________(signed) 10. Take a photo of your partner with his/her correctly completed model. 11. Print the picture in the IMC. 12. Staple the picture and this paper to your original. 13. Turn in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Structure of DNA—Universal _________Score Name______________________________Blk______ Directions: 1. Re-read the text. 2. Complete the Section questions below. 3. Use complete sentences that restate the question. 4. Use punctuation. 5. Staple this page to your original and turn in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Replication of DNA—Universal _________Score Name______________________________Blk______ Directions: 1. Re-read the text. 2. Complete the Section questions below. 3. Use complete sentences that restate the question. 4. Use punctuation. 5. Staple this page to your original and turn in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Transcription—Universal _________Score Name______________________________Blk______ Directions: 1. Re-read the text. 2. Complete the Section questions below. 3. Use complete sentences that restate the question. 4. Use punctuation. 5. Staple this page to your original and turn in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections The Genetic Code: Three-Nucleotide ‘Words’—Universal _________Score Name______________________________Blk______ Directions: 1. Make a treasure message map using the amino acid chart as the map. 2. Use the following mRNA codons to bury the ‘treasure message’: AUG = Start codon, UUU = You, CGA = Just, GGU = Won, GUU = A ACU = Prize, UAG = Stop 3. First, go to the IMC and print a copy of the amino acid chart, OR download one from the internet and print it. 4. Locate the ‘treasure message’ codons on the amino acid chart. 5. Cut out the following ‘amino acid words’ below: START YOU JUST WON A PRIZE STOP 6. Glue these amino acid words on the chart instead of the real amino acid. Be sure you are substituting the right word with the right mRNA sequence. 7. Explain to your classroom partner how to read the amino acid chart. 8. Give your partner this strip of mRNA codons to find the amino acid treasure message: AUGUUUCGAGGUGUUACUUAG 9. Tell your partner that he/she must complete the amino acid sequence from the mRNA strip to find the buried treasure. 10. If necessary, re-explain how to use the bases in groups of three and find the correct amino acid. 11. When your partner successfully completes the code, bring him/her to me and you will both get a prize. 12. Have your partner print and sign his/her name below. ________________________________________________(printed) ________________________________________________(signed) 13. Staple the chart and this paper to your original and turn it in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Translation—Universal _________Score Name______________________________Blk______ Directions: 1. Re-read the text. 2. Complete the Section questions below. 3. Use complete sentences that restate the question. 4. Use punctuation. 5. Staple this page to your original and turn in. Unit V DNA/RNA/Prot Syn—H 15-16 Corrections Mutations—Universal _________Score Name______________________________Blk______ Directions: 1. Make colored pencil models of each of the mutations. 2. Number them. 3. Do NOT title them. 4. Do NOT indicate what are their effects. 5. On ‘flashcards’, write the type of mutation on one side, and the effects on the other. 6. Explain the model pictures to your classroom partner, using the name and effects on proteins. 7. Ask your partner to match the models with the flashcard name/effects. 8. If necessary, re-explain the mutation name and effect. 9. Have your partner print and sign his/her name below. ___________________________________________(printed) ___________________________________________(signed) 10. Take a photo of your partner with his/her correctly completed model. 11. Print the picture in the IMC. 12. Staple the picture and this paper to your original. 13. Turn in.
