THIS IS NOT THE EXAM REVIEW SHEET!
HELLO EVERYONE!!! These are questions from
old exams that are relavent to Exam 2. I
understand that there are many... however,
these are an INCREDIBLY HELPFUL resource.
I highly recommend running through all of them
(maybe try answering 25-50 per day?) These
questions are directly copied and pasted from a
folder on blackboard posted by your professors.
1. A reaction will proceed spontaneously when a. it is endergonic.
*b. It is exergonic.
2. A reaction will proceed spontaneously when:
a. The products of the reaction have more free
energy than the reactants, therefore the ΔG < 0.
b. The products of the reaction have more free
energy than the reactants, therefore the ΔG > 0.
*c. The products of the reaction have less free
energy than the reactants, therefore the ΔG < 0.
d. The products of the reaction have less free energy
than the reactants, therefore the ΔG > 0.
e. The products of the reaction have the same
amount of free energy as the reactants, therefore
the ΔG = 0.
3. We measure energy in the units of
______________________, and power in units of
________________.
a. joules or watts, calories or kilocalories
*b. joules or calories, watts or calories/day
c. Gibbs free energy, entropy
d. ATP, NADH
4. The manufacture of a large protein from hundreds
of amino acids is likely to
*a. require energy input
b. release energy that can potentially be used for
other purposes
c. result in no change in free energy
d. be exergonic, with a large negative ΔG
5.Which of the following statements is correct with
respect to anabolic pathways?
a. They do not depend on enzymes.
*b. They consume energy to build up polymers from
monomers.
c. They release energy as they degrade polymers to
monomers.
d. They result in net production of ATP.
6. Which of the following statements correctly
describe(s) catabolic pathways?
a. They do not depend on enzymes.
b. They consume energy to build up polymers from
monomers.
*c. They release energy as they break down organic
molecules.
d. both A and B are correct
7. Living organisms increase in complexity as they
grow, resulting in an apparent decrease in their
entropy. How does this relate to the second law of
thermodynamics?
a. Living organisms do not obey the second law of
thermodynamics, which states that disorder
(entropy) must increase with time.
*b. Life obeys the second law of thermodynamics
because living things are not closed systems –
though they become more complex (ordered), they
extract free energy from their surroundings to do
that, and increase the entropy of their surroundings.
c. Living organisms can create new free energy via
photosynthesis, and use that energy to decrease
their own entropy.
d. Enzyme catalysts reduce the activation energy for
the conversion of entropy back into free energy.
8. According to the second law of thermodynamics,
which of the following statements is INCORRECT?
*a. The synthesis of large molecules from small
molecules is exergonic (releases free energy).
b. Living organisms cannot be closed system.
c. Life exists at the expense of energy derived from
its environment.
d. A living cell can never function indefinitely as a
closed system.
e. Every chemical reaction in a cell results in a loss of
free energy.
9. Growing organisms increase in complexity, so
their entropy must decrease. The only way to
reconcile this with the second law of
thermodynamics is to realize that
a. Living organisms do not obey the second law of
thermodynamics, which states that disorder
(entropy) must increase with time.
*b. Living things are not closed systems –they
extract free energy from their surroundings to do
biological work necessary to maintain and increase
order, the entropy of the total system in which they
live still increases.
c. Living organisms can create new free energy via
photosynthesis, and use that energy to decrease
their own entropy.
d. Enzyme catalysts reduce the activation energy for
the conversion of entropy back into free energy.
10. The second law of thermodynamics is consistent
with each of the following statements EXCEPT:
a. Conversion of energy from one form to another
always results in some loss of free energy.
b. Without occasional input of energy, organisms
would tend to fall apart.
c. Cells must use energy continually to maintain their
high level of organization.
*d. Every energy transformation by a cell increases
the order and decreases the entropy of the universe.
11. In exergonic reactions, like the oxidation of
glucose,
a. the end products have more total energy than the
starting reactants.
*b. there is a net release of free energy.
c. a net input of energy from the surroundings must
occur.
d. the reaction cannot proceed without enzymes
that lower the activation energy.
12. Which of the following is true for all exergonic
reactions?
a. The products have more total energy than the
reactants.
*b. There is a net release of free energy.
c. A net input of energy from the surroundings is
required for the reactions to proceed.
d. The reactions are nonspontaneous.
13. The mathematical expression for the change in
free energy of a system is: ∆G = ∆H - T∆S. Which of
the following is NOT CORRECT for this expression?
a. ∆G is the change in free energy.
*b. ∆H, the change in enthalpy, is defined as the
energy available to do work.
c. ∆S is the change in entropy, a measure of
randomness.
d. T is the absolute temperature measured in
Kelvins.
14. In the following graph, the change in free energy
is represented by –
a. A + C or B + C
b. A or B
*c. C
d. C – A or B
15. In the following graph, both the red and blue
curves represent the same chemical reaction. In one
case an enzyme is present and in the other case an
enzyme is not present. Which curve likely represents
a reaction with enzyme present?
a. the red curve.
*b. the blue curve.
c. the red curve minus the blue curve.
16. Which of the following best describes the
reaction illustrated here?
*a. negative ∆G, potentially spontaneous
b. positive ∆G, nonspontaneous
c. positive ∆G, exergonic
d. negative ∆G, endergonic
17. A chemical reaction occurs spontaneously with
the release of energy. Which of the following must
be true for that reaction?
a. ∆G > 0
b. ∆G = 0
*c. ∆G < 0
d. T∆S < 0
18. ATP is produced by _______ , ________
reactions and is used to drive ________, ________
reactions. What words filled in these four spaces (in
order) result in a true statement?
a. endergonic, catabolic exergonic, anabolic
b. exergonic, anabolic endergonic, catabolic,
*c. exergonic, catabolic endergonic, anabolic
d. endergonic, anabolic exergonic, catabolic
19. ATP generally energizes cellular processes by
which of the following?
a. releasing heat upon hydrolysis
b. acting as a catalyst
*c. direct chemical transfer of a phosphate group
d. releasing ribose electrons to drive reactions
20. Why is ATP an important molecule in
metabolism?
a. Its hydrolysis provides an input of free energy for
exergonic reactions.
*b. It provides energy coupling between exergonic
and endergonic reactions.
c. Its terminal phosphate group is highly unstable,
and thus reactive.
d. A and B are both correct
21. Which of the following is most similar in
structure to ATP?
a. a steroid, like cholesterol
b. a DNA double helix
*c. a nucleotide
d. an amino acid with three phosphate groups
attached
e. a phospholipid
22. Which of the following statements regarding ATP
is (are) correct?
a. ATP serves as a main energy shuttle inside cells.
b. ATP drives endergonic reactions in the cell by
transfer of the phosphate group to specific
reactants.
c. The regeneration of ATP from ADP and phosphate
is an endergonic reaction, requiring energy input.
*d. All of the above are correct.
23. How could you tell whether or not a particular
reaction you were studying was enzyme-catalyzed?
a. Remove proteins from the reaction mixture and
see what happened to the reaction rate.
b. Try different concentrations of the reactants to
see if the reaction rate first increased with reactant
concentration, then stopped changing even though
reactant concentration was further increased.
c. Measure the activation energy.
*d. A and B would both provide useful information,
but C would not.
24. Enzymes speed the rate of substrate conversion
to product by which of the following mechanisms?
a. increasing the energy of the substrate
b. decreasing the energy of the product
c. decreasing the ∆G of the reaction
*d. decreasing the activation energy of the reaction
25. The reaction A + B => C + D illustrated here
shows the change in reaction energetics that
resulted when a catalytic enzyme was added, and
the reaction rate went way up. Which of the
following distances labeled on the graph represents
the activation energy required for the enzymecatalyzed reaction?
a. a
*b. b
c. c
d. d
e. e
26. Which of the following statements about
enzymes is FALSE?
a. Enzyme catalysis is dependent on the threedimensional structure or conformation of the
enzyme.
*b. Enzymes provide activation energy for the
reaction they catalyze.
c. Enzymes are composed primarily of protein, but
they may bind nonprotein cofactors.
d. Enzyme activity can be inhibited by other
molecules, even if they do not bind to the active site.
27. The effect on the reaction illustrated here of
adding a catalytic enzyme would be to
a. reduce the free energy of the reactants.
b. increase the free energy of the products.
c. reverse the direction of the reaction.
*d. reduce the value labeled E A, and increase the
rate of the reaction.
28. A solution of starch at room temperature does
not readily decompose to form a solution of simple
sugars because
a. the starch solution has less free energy than the
sugar solution.
b. the hydrolysis of starch to sugar is endergonic.
*c. the activation energy barrier is too high for the
reaction to go very fast at room temperature.
d. starch cannot be hydrolyzed in the presence of
water.
29. What is the term that best describes the
metabolic pathway in which glucose (C6H12O6) is
degraded to carbon dioxide (CO2) and water?
*a. cellular respiration
b. glycolysis
c. fermentation
d. citric acid cycle
e. oxidative phosphorylation
31. Which statement about the subcellular
localization of the respiratory pathways is FALSE? If
they are all true choose E.
a. Glycolysis reactions are located in the cytosol (the
cytoplasm of the cell).
b. The citric acid cycle (also known as the Krebs cycle
or tricarboxylic acid cycle) occurs within the
mitochondrial matrix
c. The electron transport chain and ATP synthase are
located in the inner mitochondrial membrane
d. Pyruvate must be transported from the cytosol to
the mitochondrial matrix in oxidative respiration.
*e. All of the above are correct
32. In the following graph, the same chemical
reaction is represented. The different curves either
have no inhibitor present, a non-competitive
inhibitor, or a competitive inhibitor. Which curve
represents when a non-competitive inhibitor is
present?
a. A
b. B
*c. C
33. In the following graph, the same chemical
reaction is represented. The different curves either
have no inhibitor present, a non-competitive
inhibitor, or a competitive inhibitor. Which curve
represents when a competitive inhibitor is present?
30. Most of the ATP made during cellular respiration
is produced by
a. glycolysis.
*b. oxidative phosphorylation.
c. substrate level phosphorylations.
d. direct synthesis of ATP by the tricarboxylic acid
cycle.
a. A
*b. B
c. C
34. A drug is designed to make the glycolytic
pathway more productive. What part of the cell
would the drug need to be delivered to for it to
directly affect this pathway?
a. mitochondrial matrix
*b. cytosol/cytoplasm
c. mitochondrial intermembrane space
d. nucleus
e. chloroplast
35. What molecule is produced by glycolysis, and is
then imported into the mitochondria to enter into
the TCA cycle?
a. glucose
b. NADPH
*c. pyruvate
d. citric acid
36. The ATPs generated during glycolysis are formed
by which mechanism, substrate-level
phosphorylation or oxidative phosphorylation?
*a. Substrate-level
b. Oxidative phosphorylation
37. A proton ionophore is a substance that creates a
proton leak in a membrane. What might you predict
that a proton ionophore would do in mitochondria?
a. Nothing.
b. Create a greater proton motive force.
c. Block electrons from being transported from one
carrier to another.
*d. Prevent the synthesis of ATP.
e. None of the above.
38. A drug that increases the number of NADH &
FADH2 molecules produced through the citric acid
cycle/Krebs cycle and has no other effects on the cell
would theoretically
a. decrease the activity of ATP synthase.
b. decrease the cell’s ability to manufacture glycerol.
*c. increase the number of ATPs produced per
glucose.
d. increase lactic acid production.
e. decrease the cell’s need for oxygen.
39. A substance that increases the number of
protons (H+) in the mitochondrial matrix (and has no
other effect on the cell) would theoretically ____.
a. increase the ATP yield of glycolysis
b. decrease ATP yield in the citric acid cycle/Krebs
cycle
c. inhibit pyruvate metabolism
*d. decrease the ATP yield in oxidative
phosphorylation
e. increase the ATP yield of fermentation
40. Which of the following statements concerning
the metabolic degradation of glucose (C6H12O6) to
carbon dioxide (CO2) and water is (are) true?
a. The breakdown of glucose to carbon dioxide and
water is exergonic, releasing free energy.
b. The breakdown of glucose to carbon dioxide and
water in a cell is usually coupled to the production of
more than 25 ATP.
c. The breakdown of glucose to carbon dioxide and
water is completed in the reactions of the citric acid
cycle in the mitochondrial matrix.
*d. All of the above are true.
41. Which of the following produces the most ATP
when a glucose molecule (C6H12O6) is oxidized to
carbon dioxide (CO2) and water?
a. glycolysis
b. fermentation
c. oxidation of pyruvate to acetyl CoA
d. the citric acid cycle
*e. oxidative phosphorylation (electron transport
and chemiosmosis)
42. The citric acid cycle is a “cycle” because:
a. CO2 is released at various steps in the cycle and
then fixed again.
*b. oxaloacetate is regenerated in each round of the
cycle.
c. ATP is hydrolyzed, then resynthesized.
d. All of the above.
e. None of the above
43. [180] is an isotope of Oxygen. In the experiment
below, [180] is present either in water (Experiment
1), or in carbon dioxide (Experiment 2). Which of the
flasks in the experiment below will produce 18O2
in the presence of light?
*a. Experiment 1
b. Experiment 2
c. Both Experiment 1 and 2
d. Neither Experiment 1 or 2
44. [180] is an isotope of Oxygen. It contains extra
a. Protons
*b. Neutrons
c. Electrons
45. A change in an enzyme's three-dimensional
shape and disruption of normal function, due to
alteration of hydrogen bonds or ionic bonds caused
by an increase in temperature, is best labeled:
a. hydrolysis
b. destabilization
c. allosteric inhibition
*d. denaturation
46. Shutdown of an early step in a metabolic
pathway by an end product of that pathway is best
described, without any additional information, as
*a. feedback inhibition.
b. allosteric inhibition.
c. noncooperative inhibition.
d. competitive inhibition.
47. The most important function of long-chain
polypeptides in organisms is in
a. storage of chemical potential energy for later use.
*b. catalysis that speeds up the rate of important
biochemical reactions.
c. coding of genetic information in a form that can
be duplicated and partitioned when cells divide.
d. All of the above are important functions of longchain polypeptides.
48. Which of the following is FALSE?
a. Enzyme catalysis is dependent on the pH and
temperature of the reaction environment.
b. Enzyme catalysis is dependent on the threedimensional structure or conformation of the
enzyme.
*c. Enzymes provide activation energy for the
reaction they catalyze.
d. Enzyme activity can be inhibited by a molecule
that binds to the enzyme far from the active site.
49. Which of the following are CORRECT statements
about enzymes?
a. Enzymes may require a nonprotein cofactor or
metal atom for catalysis to take place.
b. An enzyme's catalytic rate is likely to change if its
three-dimensional structure is altered.
c. Enzyme activity is influenced by physical and
chemical environmental factors such as pH and
temperature.
d. Enzymes increase the rate of chemical reaction by
lowering activation energy barriers.
*e. All of the above are correct.
50. Phosphofructokinase is a protein that catalyzes a
reaction that controls the rate of glycolysis in animal
cells. The term kinase means that this protein
a. breaks a large molecule down to smaller parts
(catabolism)
b. catalyzes a reaction that produces ATP
c. can be allosterically activated by molecules that
bind to regions away from its active site.
*d. adds a phosphate group to or removes a
phosphate group from another molecule.
51. Which type of inhibitor binds to the active site of
an enzyme?
a. allosteric inhibitor
*b. competitive inhibitor
c. non-competitive inhibitor
d. feedback inhibitor
52. Hemoglobin is a tetramer, composed of four
polypeptide subunits. When one of the subunits
binds an oxygen molecule, the affinity for oxygen of
other subunits increases, so additional oxygen
uptake becomes more likely. This is best described
as the result of:
a. enzyme saturation
b. allosteric inhibition
*c. allosteric activation
d. oxidative damage
53. Which of the following statements about NAD+ is
FALSE?
a. NAD+ is reduced to NADH during both glycolysis
and the citric acid cycle.
*b. NAD+ has more chemical potential energy than
NADH.
c. NAD+ can receive electrons for use in electron
transport and oxidative phosphorylation.
d. In the absence of NAD+, glycolysis cannot
proceed.
54. The ATP made during glycolysis is generated by
*a. transfer of phosphate from a phosphorylated
carbon molecule to ADP, called substrate-level
phosphorylation.
b. electron transport.
c. chemiosmosis.
d. oxidation of NADH to NAD+.
55. In addition to ATP, other end products of
glycolysis include:
a. CO2 and H2O
b. CO2 and pyruvate
*c. NADH and pyruvate
d. CO2 and NADH
56. Where does glycolysis takes place?
a. mitochondrial outer membrane
b. mitochondrial inner membrane
c. mitochondrial intermembrane space
*d. cytosol (the cytoplasm of the cell)
57. You are studying the biochemistry of muscle cell
samples from world-class sprinters, and isolate a
compound that is highly soluble in water, and varies
in molecular weight, but averages about
C60H100O50. Cells without this substance run out of
ATP very quickly when oxygen is absent, but work
for longer periods if this substance is present. The
substance is most likely to be a
a. Lipid
b. Protein
*c. Carbohydrate
d. Nucleic acid
e. Enzyme
58. During glycolysis, when glucose is catabolized to
pyruvate, most of the energy of glucose is
a. transferred to ADP, forming ATP.
b. transferred directly to ATP.
*c. retained in the pyruvate.
d. stored in the NADH produced.
59. Which statement is NOT TRUE about glycolysis?
If all are true, select alternative D.
a. Two ATP are needed per glucose in the energy
investment phase of glycolysis
b. Four ATP per glucose are produced during the
energy yielding phase of glycolysis
c. The two NADH produced per glucose can be
oxidized back to NAD+ by the mitochondrial electron
transport chain.
*d. All of the above are true.
60. If all of the molecules of an enzyme are saturated
with substrate, the most effective way to obtain a
faster yield of products (increase the reaction rate) is
to
*a. add more of the enzyme.
b. heat the solution to 90°C.
c. add more substrate.
d. add an allosteric inhibitor.
61. If an enzyme is added to a solution where the
substrates and products are in equilibrium, what
would occur?
a. Additional product would be formed.
b. Additional substrate would be formed.
c. The reaction would change from endergonic to
exergonic.
d. The free energy of the system would change.
*e. Nothing; the reaction would stay at equilibrium.
62. Where does the Calvin cycle take place?
*a. stroma of the chloroplast
b. thylakoid membrane
c. cytoplasm surrounding the chloroplast
d. chlorophyll molecule
e. outer membrane of the chloroplast
63. In a plant cell, where are the ATP synthetase
complexes located?
a. A. stroma of the chloroplast
b. B. thylakoid membrane
c. C. outer membrane of the chloroplast
d. D. inner membrane of the mitochondria
*e. choices B and D are both correct
64. What key component is necessary for
photosystems to harvest light?
a. vesicles
b. NADP reductase
*c. pigment molecules
d. ATP synthase
e. Calvin cycle
65. Which of the following are products of the light
reactions of photosynthesis that are utilized in the
Calvin cycle?
a. CO2 and glucose
b. H2O and O2
c. ADP, Pi, and NADP+
d. electrons and H+
*e. ATP and NADPH
66. Which of the following are true about
photorespiration?
a. A. It is an apparently wasteful side reaction of
ribulose bisphosphate carboxylase (Rubisco).
b. B. It is a useful supplement to cellular respiration.
c. C. It is minimized in C4 plants due to specialized
photosynthetic pathways and leaf architecture.
d. All of the above.
*e. Choices A and C are both correct.
67.Which of the following is NOT a result of the citric
acid cycle?
a. Oxidation of pyruvate to CO2
b. Reduction of NAD+ to NADH
c. Production of ATP through substrate level
phosphorylation
*d. Partial oxidation of glucose in the absence of
oxygen to produce ATP at low rates during anaerobic
conditions.
68. Which of the following intermediary metabolites
enters the citric acid cycle and is formed, in part, by
the removal of a carbon (CO2) from one molecule of
pyruvate?
a. glucose-6-phosphate
b. glyceraldehyde-3-phosphate
c. oxaloacetate
*d. acetyl CoA
69. Which is the oxidized form?
*a. NAD+
b. NADH
70. Photosystem II strips electrons from chlorophyll
and delivers them to the chloroplast electron
transport (cytochrome) chain. Where do the
replacement electrons come from?
a. splitting O2
b. photosystem I
*c. splitting H2O
d. splitting CO2
e. NADPH
71. Where is the chlorophyll located in a plant?
a. Cristae
b. Plasma membrane of the cell
c. Outer membrane of the chloroplast
*d. Thylakoid membrane
e. Stroma
72. How many carbon atoms are fed into the citric
acid cycle as a result of the oxidation of one
molecule of pyruvate, and eventually emerge as
CO2?
*a. 2
b. 4
c. 6
d. 8
73. 1.5 g of radish seeds in each of three dishes. The
following conditions are
created for each dish and incubated at room
temperature:
77. Which of the following statements about the
chemiosmotic mechanism of ATP synthesis is TRUE?
a. electron transport from NADH to O2 pumps H+
from the intermembrane space into the
mitochondrial matrix.
b. The high concentration of H+ in the mitochondrial
matrix pulls water into the matrix through the ATP
synthase channel by osmosis, and the energy in this
water flow is used to power ATP synthesis.
*c. H+ movement down a concentration gradient
The dry biomass of three treatments at the end of
the experiment is shown above.
Most of the biomass that accumulates in the
presence of light and water comes from:
a. water during photosynthesis.
b. the building of carbohydrates during respiration.
c. the release of CO2 during respiration.
*d. the incorporation of CO2 into carbohydrates
during the Calvin cycle.
74. All of the following are products of the citric acid
cycle EXCEPT
a. ATP.
b. NADH.
c. FADH2.
d. carbon dioxide.
*e. water
75. Carbon dioxide (CO2) is released during which of
the following stages of cellular respiration?
a. glycolysis and the oxidation of pyruvate to acetyl
CoA
*b. oxidation of pyruvate to acetyl CoA and the citric
acid cycle
c. the citric acid cycle and oxidative phosphorylation
d. oxidative phosphorylation and fermentation
e. fermentation and glycolysis
76. Which statement about the formation of water
by the mitochondrial electron transport chain is
TRUE?
*a. The electrons come from carbohydrates and the
oxygen come from O2.
b. The ∆G is positive.
c. Energy from ATP is required to make the reactions
occur.
d. Cytochromes do not play any role in the process.
from the intermembrane space into the
mitochondrial matrix through ATP synthase results in
ATP synthesis
d. All these statements describe parts of the
chemiosmotic mechanism.
78. A major function of the mitochondrial inner
membrane is the conversion of energy from
electrons to the stored energy of the phosphate
bond in ATP. To accomplish this function, the inner
mitochondrial membrane must have all of the
following features EXCEPT
a. carrier proteins to accept electrons from NADH.
b. ATP synthase as an integral protein spanning the
width of the membrane.
c. the electron transport chain of proteins.
*d. high permeability to protons (H+ ions).
79. Which steps in the metabolic pathway of cellular
respiration occur in the cytosol?
*a. glycolysis
b. pyruvate break down
c. citric acid cycle
d. oxidative phosphorilation
e. all but d
f. a & b
g. none of the above
80. The oxygen consumed during cellular respiration
is involved directly in which process or event?
a. glycolysis
*b. accepting electrons (and H+) at the end of the
electron transport chain, forming water
c. the citric acid cycle
d. the oxidation of pyruvate to acetyl CoA
e. the phosphorylation of ADP to form ATP
81. Where are the proteins of the respiratory
electron transport chain located?
a. cytosol
b. mitochondrial outer membrane
*c. mitochondrial inner membrane
d. mitochondrial intermembrane space
e. mitochondrial matrix
87. Where do the catabolic products of fatty acid
breakdown enter into the citric acid cycle?
a. pyruvate
b. malate or fumarate
*c. acetyl CoA
d. alpha-ketoglutarate
e. succinyl CoA
82. The primary role of molecular oxygen (O2) in
cellular respiration is to
a. yield energy in the form of ATP as it is passed
down the respiratory chain.
*b. act as an acceptor for electrons and hydrogen,
forming water.
c. combine with carbon, forming CO2.
d. react with pyruvate to form lactate or ethanol,
regenerating NAD+.
88. In fermentation by yeast, NAD+ is regenerated
from NADH during the
*a. conversion of pyruvate to ethanol (ethyl alcohol).
b. conversion of pyruvate to acetyl CoA.
c. conversion of pyruvate to lactate.
d. phosphorylation of ADP to form ATP.
83. During aerobic cellular respiration, a proton
gradient in mitochondria is generated by ________
and used primarily for ________.
*a. the electron transport chain; ATP synthesis
b. the electron transport chain; substrate-level
phosphorylation
c. glycolysis; production of H2O
d. fermentation; NAD+ reduction
84. Anaerobic fermentation adds reactions to
glycolysis in which ________ is ________.
a. NAD+; oxidized to NADH
*b. NADH; oxidized to NAD+
c. pyruvate; converted to acetylCoA
d. ethanol; oxidized
85. Each of the following can be converted to an
intermediate of glycolysis and produce some ATP
without entering the citric acid cycle EXCEPT
*a. fatty acids
b. some amino acids
c. glucose and sucrose
d. glycerol
e. starch and glycogen
86. When oxygen is in short supply, your muscle cells
convert pyruvate produced by glycolysis to
________, and in this step gain ________.
*a. lactate; NAD+ which permits glycolysis to
continue.
b. alcohol; CO2
c. alcohol; ATP
d. ATP; NADH2
89. Which of the following normally occurs in your
cells regardless of whether or not oxygen (O2) is
present?
*a. glycolysis
b. fermentation
c. conversion of pyruvate to lactate
d. citric acid cycle
e. oxidative phosphorylation (chemiosmosis)
90. The following graph shows how the reaction rate
for an enzyme catalyzed reaction varied over a range
of substrate (reactant) concentrations. The thin (gray
or magenta) line (upper curve) shows reaction rates
in a control experiment, and the thick black line
(lower curve) shows reaction rates after the addition
of a small molecule (called X) that is neither a
reactant nor a product in the reaction. These data
suggest that molecule X …
a. binds to the active site of the enzyme, blocking
access of the substrate.
b. is a competitive inhibitor of the reaction.
*c. is a non-competitive (allosteric) inhibitor, that
does not block the active site but changes the
conformation of the enzyme to reduce its activity.
d. activates the enzyme, because the reaction rate
reaches a maximum at lower substrate
concentrations.
91. As ATP levels in the cytoplasm of a cell increase,
the rate of glycolysis is likely to________.
a. go up, because more ATP is available for the
energy investment phase of glycolysis.
*b. go down, because elevated ATP results in
feedback inhibition of phosphoglucokinase.
c. remain unchanged, because the rate of glycolysis
is controlled by the availability of oxygen.
d. slow, because NAD+ is used up.
92. An enzyme whose regulation by a variety of
other molecules is important in controlling the rate
of glycolysis in a cell is
a. coenzyme A
b. pyruvate carboxylase
*c. phosphofructokinase
d. isomerase
93. Citric acid cycle intermediates, like oxaloacetate,
alpha ketogluterate, succinate, fumerate, and
malate
a. carry electrons in the electron transport chain that
ends in the conversion of O2 to H2O.
b. are specialized molecules that are useful only in
the citric acid cycle, because removing them would
break the cycle.
*c. are important as building materials for other
organic molecules, in addition to their role in the
citric acid cycle.
d. are converted to pyruvate at the end of the citric
acid cycle reaction sequence.
94. Trans-fats are are
a. rich in cholesterol
*b. unsaturated, and contain one or more double
bonds.
c. saturated, and more abundant in plant oils than in
fish oils.
d. phospholipids, with both polar and non-polar
regions.
95. The following graph shows how the reaction rate
for an enzyme catalyzed reaction varied over a range
of substrate (reactant) concentrations. The thin gray
(or magenta) line (upper curve) shows reaction rates
in a control experiment, and the darker (or blue) line
(lower curve) shows reaction rates after the addition
of a small molecule (called X) that is neither a
reactant nor a product in the reaction. These data
suggest that molecule X …
a. binds to the active site of the enzyme, blocking
access of the substrate.
*b. is a competitive inhibitor of the reaction.
c. is a non-competitive (allosteric) inhibitor, that
does not block the active site but changes the
conformation of the enzyme to reduce its activity.
d. activates the enzyme, because the reaction rate
reaches a maximum at lower substrate
concentrations.
DNA/genetics
96. When Hershey/Chase performed phage infection
experiments, what compounds did they use to label
and detect DNA and protein?
a. 35S was used to label DNA, and 32P was used to
label protein.
*b. 35S was used to label protein, and 32P was used
to label DNA.
97. Choose the list of three terms that correctly fill
the blanks in the following sentence:
The molecules illustrated here are
________________________ that combine with
_________________________ and with a
___________________ group to form monomers
that can combine to make DNA.
a. pyrimidines, ribose, amino
b. purines, ribose, phosphate
*c. purines, deoxyribose, phosphate
d. pyrimidines, deoxyribose, ATP
98. Hydrogen bonding between nitrogenous bases is
essential for correct replication of DNA. Which of the
following base pairs forms two hydrogen bonds in
DNA?
a. Adenine - Guanine
b. Adenine - Cytosine
*c. Adenine – Thymine
d. Adenine - Adenine
104. The purine bases in DNA are—
a. Cytosine, thymine and uracil
*b. Adenine and guanine
c. Cytosine and thymine
d. Thymine, guanine and cytosine
e. Adenine, uracil and guanine
105.
99. The structural feature that allows near-perfect
copying of DNA molecules is
a. their sugar-phosphate backbone.
*b. the capability of its nitrogenous bases to form
specific hydrogen bonds that lead to matching of
specific pairs of nucleotides.
c. disulfide bonds that hold the two helixes together.
d. the three-component (base, sugar, and
phosphate) structure of the nucleotides, because all
three must be matched to make a perfect copy.
100. In your body, the most important function of
ribonucleic acid (RNA) is to
a. transmit genetic information to offspring.
*b. direct the synthesis of protein.
c. serve as a template for the synthesis of a
complementary copy, thus ensuring genetic
continuity.
d. act as a template directing the synthesis of DNA.
101. The two strands making up the DNA double
helix molecule
a. cannot be separated.
b. contain ribose and deoxyribose in opposite
strands.
*c. are held together by hydrogen bonds.
d. are attached via ester bonds between phosphates
that hold the strands together.
How many bands of DNA would you expect to see in
the cesium gradient above after 3 generations if the
mechanism of DNA replication was semiconservative?
a. 1 band that is half heavy
*b. 2 bands, one is light and the other half heavy
c. 3 bands, one is heavy, one is half-heavy, and one is
light
d. 2 bands, one is heavy and one is light
106. Which of the four structures labeled A, B, C and
D in the figure is best described as a nucleotide?
102. In the double helix structure of nucleic acids,
cytosine hydrogen-bonds to
a. deoxyribose.
b. adenine.
c. thymine.
*d. guanine.
103. The pyrimidine bases in DNA are—
a. Cytosine, thymine and uracil
b. Adenine and guanine
*c. Cytosine and thymine
d. Thymine, guanine and cytosine
e. Adenine, uracil and guanine
a. A
*b. B
c. C
d. D
107. Which of the following is the best description of
the class of molecules known as nucleotides?
a. a nitrogenous base linked to a phosphate group
b. a nitrogenous base linked to a pentose (5 carbon)
sugar
*c. a molecule including a nitrogenous base, a
pentose (5 carbon) sugar and a phosphate group
d. a phosphate group linked to an adenine or uracil
e. a pentose sugar linked to a purine or pyrimidine
108. What is the function of helicase during DNA
replication?
*a. It separates the two strands of the double helix.
b. It relieves the overwinding of DNA ahead of the
replication fork due to DNA strand separation.
c. It synthesizes the RNA primers used to initiate
DNA replication.
d. It joins the Okazaki fragments together.
109. What is the function of topoisomerase during
DNA replication?
a. It separates the two strands of the double helix.
*b. It relieves the overwinding of DNA ahead of the
replication fork due to DNA strand separation.
c. It synthesizes the RNA primers used to initiate
DNA replication.
d. It joins the Okazaki fragments together.
110. What is the function of primase during DNA
replication?
a. It separates the two strands of the double helix.
b. It relieves the overwinding of DNA ahead of the
replication fork due to DNA strand separation.
*c. It synthesizes the RNA primers used to initiate
DNA replication.
d. It joins the Okazaki fragments together.
111. What is the function of ligase during DNA
replication?
a. It separates the two strands of the double helix.
b. It relieves the overwinding of DNA ahead of the
replication fork due to DNA strand separation.
c. It synthesizes the RNA primers used to initiate
DNA replication.
*d. It joins the Okazaki fragments together.
112. Which of the following statements about DNA
replication is NOT correct?
a. Leading strand synthesis is continuous, while
lagging strand synthesis is discontinuous.
b. Both leading and lagging strands are synthesized
in the 5’ to 3’ direction.
*c. Leading strand synthesis is conservative, while
lagging strand synthesis is semi-conservative.
d. Completion of the lagging strand requires ligation
of Okazaki fragments.
113. How are telomeres made?
a. By ligation of adjacent Okazaki fragments.
*b. Telomerase synthesizes them by copying the
telomerase RNA.
c. By telomerase which is capable of synthesizing
DNA in the 3’ to 5’ direction.
d. By fusion of adjacent replicons.
114. Eukaryotic chromosomes have telomeres that
protect the terminal nucleotides from degradation
by nucleases. Bacterial chromosomes do not need
telomeres because
a. bacterial DNA replication has no lagging strand
synthesis, so there is no overhang to protect.
*b. bacterial chromosomes are circular.
c. bacteria have specialized proteins that protect the
ends of their chromosomes.
d. bacterial DNA polymerases can synthesize DNA
bidirectionally.
e. bacterial chromosomes have a single origin of
replication at one end of each linear chromosome.
115. What are the repeating DNA sequences at the
ends of chromosomes that protect them from loss of
important DNA during replication?
*a. Telomeres
b. Telomerase
c. Replicons
d. Primers
e. Promoters
116. Which of the following statements about
nucleosomes are correct?
a. Contain about 150 bp of DNA wrapped around
histones
b. The histones are called H1, H2A, H3 and H4
c. The histones are basic proteins which is important
to bind DNA
d. Nucleosomes represent the first level of
compaction of the eukaryotic chromosome
*e. All of the above
117. During translation, what is the direction of
polypeptide synthesis?
a. From 5’ to 3’
b. From 3’ to 5’
*c. From N-terminal to C-terminal
d. From C-terminal to N-terminal
e. From positive to negative
121. Using the single-letter amino acid codon table
shown below, translate the following mRNA:
5’-AUG,GCG,AGA,GUU,GAG,CUG,UGA-3’
118. During DNA replication, what is the direction of
DNA synthesis?
*a. From 5’ to 3’
b. From 3’ to 5’
c. From N-terminal to C-terminal
d. From C-terminal to N-terminal
e. From positive to negative
119. The following statements are consistent with
the central dogma –
a. A. During transcription, DNA is copied into RNA.
b. B. During translation, RNA sequences code for
polypeptide sequences.
c. C. The process of transcription produces a
polypeptide sequence.
d. D. DNA is translated into ribonucleotides.
*e. A and B.
f. C and D.
120. Which of the following best summarizes the
central dogma?
a. DNA is translated into RNA, and RNA is transcribed
into polypeptides.
b. RNA is translated into DNA, and DNA is
transcribed into polypeptides.
*c. DNA is transcribed into RNA, and RNA is
translated into polypeptides.
d. polypeptides translate DNA into ribosomes
e. All of the above.
a. MAGICAL
*b. MARVEL
c. MONSTER
d. MAYHEM
122. The diagram shows a step in the experiment by
Avery, MacCleod and McCarty in which they
demonstrated that DNA was the genetic material.
Recall that they made an extract from the S strain
bacteria and mixed the extract with the R strain.
124. Why did the experimenters treat sample E with
Protease?
a. To activate the DNA
b. To allow the DNA to enter the R strain bacteria.
c. To purify the DNA from other materials in the
extract.
*d. To demonstrate that protein is not the genetic
material.
e. All of the above
125. In the structure of DNA …. (finish the sentence)
a. the “backbone” of each strand consists of
deoxyribose sugars and phosphates linked together
by phosphodiester bonds.
b. the two strands of the helix are bonded together
by hydrogen bonds between purine and pyrimidine
bases.
c. the two strands run antiparallel to each other
meaning that one strand runs 5’ to 3’ and the other
from 3’ to 5’.
*d. All of the above.
Why did the experimenters treat sample C with
DNase?
a. To activate the DNA.
b. To allow the DNA to enter the R strain bacteria.
*c. To demonstrate that DNA in the extract was the
genetic material.
d. To purify the DNA from other materials in the
extract.
e. All of the above.
123. Why did the experimenters treat sample D with
RNase?
a. To activate the DNA.
b. To demonstrate that DNA makes RNA.
*c. To demonstrate that RNA is not the genetic
material.
d. To purify the DNA from other materials in the
extract.
e. All of the above.
126. In the structure of DNA …. (finish the sentence)
*a. the “backbone” of each strand consists of
deoxyribose sugars and phosphates linked together
by phosphodiester bonds.
b. the two strands of the helix are bonded together
by hydrogen bonds from one purine to another
purine and from one pyrimidine to another
pyrimidine.
c. the two strands run parallel to each other
meaning the purines base pair with pyrimidines and
pyrimidines base pair with purines.
d. All of the above.
127. A DNA strand in double-stranded DNA is based
paired with its complementary strand. The strand
complementary to a strand with the sequence 5’GCAAGTCATGCCGAAT-3’ would read as follows:
a. 5’-CGTTCAGTACGGCTTA-3’
*b. 5’-ATTCGGCATGACTTGC-3’
c. 5’- GCAAGTCATGCCGAAT-3’
d. 5’-ATGCAGTTACAATGCA-3’
128. A DNA strand in double-stranded DNA is based
paired with its complementary strand. The strand
complementary to a strand with the sequence 5’ATGCAGTTACAATGCA-3’ would read as follows:
a. 5’-ATTGCCGTACTGAACG-3’
b. 5’-TAACGGCATGACTTGC-3’
c. 5’-ATGCAGTTACAATGCA-3’
*d. 5’-TGCATTGTAACTGCAT-3’
129. DNA synthesis is said to semi-conservative
because …….. (finish the sentence).
a. the parental DNA strands are not always
conserved, only sometimes, during DNA replication.
*b. only one parental strand is found in each sister
chromatid following DNA replication.
c. two parental strands are found in one sister
chromatid and two daughter strands are found in
the other sister chromatid following DNA replication.
d. the daughter strands have to be separated during
DNA replication.
e. none of the above.
130.
In this very simple diagram of a DNA replication fork
shown above, which red strand(s) is the lagging DNA
strand?
*a. A
b. B
c. A and B
d. Neither A nor B
131.
In this very simple diagram of a DNA replication fork
shown above, which red strand(s) is the leading DNA
strand?
a. A
*b. B
c. A and B
d. Neither A nor B
132. During DNA synthesis on the lagging strand ……
(finish the sentence)
a. DNA is made in pieces called Okazaki fragments.
b. DNA synthesis is initiated by RNA primers.
c. DNA primase hops back to the opening of the
replication fork to make additional RNA primers.
*d. All of the above.
e. None of the above.
133. During DNA replication, the function of DNA
polymerase is:
a. to removes tightened coils ahead of DNA
replication folk.
b. to separate double stranded DNA into single
strands.
*c. to synthesize DNA in both leading and lagging
strands.
d. to synthesize short RNA primers.
e. to covalently attaches adjacent Okazaki fragments
in the lagging strand.
134. Nucleosomes:
a. are DNA structures with histone proteins wrapped
around them.
*b. are composed of DNA wrapping around core
histones and linked together by a DNA linker region
to which histone H1 is bound.
c. are about 30 nanometers in diameter.
d. All of the above
e. None of the above
135. The first order of chromatin fold is:
a. the formation of 30 nanometer chromatin fiber.
b. the formation of radial loops from the 30
nanometer chromatin fiber
*c. the formation of nucleosome
d. all of the above
e. none of the above
136. The second order of chromatin fold is:
*a. the formation of 30 nanometer chromatin fiber.
b. the formation of radial loops from the 30
nanometer chromatin fiber.
c. the formation of nucleosome
d. all of the above
e. none of the above
137. The cartoon below depicts DNA replication.
139. A repeating DNA sequence at the end of
chromosomes that prevents them from losing base
pair sequences at their ends and from fusing
together is—
*a. A telomere
b. A telomerase
c. A replicon
d. A primer
e. A promoter
140. In eukaryotic cells histones bind to DNA to form
chromatin. What is the basic (and smallest)
organizational unit of chromatin?
a. Double helix
b. 30 nanometer fiber
*c. nucleosome
d. ribosome
e. circular DNA
Gene expression
141. Which of the following is the correct RNA
transcript of the DNA template strand?
The mechanism of replication is thought to be
a. Conservative
b. Dispersive
*c. Semi-conservative
138. Different fluorescent dyes were be used to label
individual chromosomes in the image below. How
would you interpret this image of an interphase
nucleus?
Cremer and Cremer, 2001
a. Chromosomes occupy overlapping domains in the
nucleus
*b. Chromosomes have mostly individual domains in
the nucleus
c. Chromosomes are a mix of DNA and proteins
d. Chromosomes do not contain protein during
interphase
a. T G A C G G G T A C T C G C T G G G G A A G C C C G
AGCCCCTTACTTAGC
b. A C T G C C C A T G A G C G A C C C C T T C G G G C
TCGGGGAATGAATCG
*c. A C U G C C C A U G A G C G A C C C C U U C G G G
CUCGGGGAAUGAAUCG
d. U G A C G G G U
ACUCGCUGGGGAAGCCCGAGCCCCUU
ACUUAGC
142. The following is/are true about Aminoacyl-tRNA
Synthetases –
a. They catalyze the attachment of amino acids to
tRNAs.
b. They are enzymes and comprise a family of
proteins.
c. They utilize energy from ATP to attach amino acids
to tRNAs.
d. Referred to as the second genetic code because
they are able to recognize the appropriate tRNA and
the corresponding amino acid.
*e. All of the above.
143. Which strand gets transcribed into mRNA?
a. The coding strand. It is read 3’ to 5’ by RNA
polymerase.
*b. The template strand. It is read 3’ to 5’ by RNA
polymerase.
c. The coding strand. It is read 5’ to 3’ by RNA
polymerase.
d. The template strand. It is read 5’ to 3’ by RNA
polymerase.
144. The resulting mRNA from transcription has the
following polarity –
a. 3’to 5’
*b. 5’to 3’
c. 5’to 5’
d. 3’to 3’
145. What parts of the following structural gene are
represented in processed mRNA?
*a. The exons only
b. The introns only
c. The exons and introns
d. The promoter and exons
e. The promoter and introns
146. The following statement is true about introns
and exons –
a. Only exons are transcribed, introns are spliced
from the RNA
b. Only introns are transcribed because exons are
spliced from the DNA
*c. Both introns and exons are transcribed, introns
are spliced from the mRNA.
d. The promoter, exons, and introns are transcribed.
Exons are spliced from the mRNA.
147. What is the promoter region?
a. It is a region of RNA that binds to the RNA
polymerase and initiates transcription.
b. It is a component of each type of RNA.
c. It is responsible for the selective nature of
transcription.
*d. It is a region of a parent DNA strand that binds to
the RNA polymerase and initiates transcription.
148. Anticodon is the term applied to—
*a. the part of the tRNA that interacts with the
codon
b. the list of amino acids that corresponds to the
genetic code
c. the concept that multiple codons sometimes code
for a single amino acid
d. the several three-nucleotide stretches that code
for "stop"
e. the part of the tRNA that binds to an amino acid
149. Which of the following may be involved in
combinatorial control of eukaryotic gene expression
–
a. Activator proteins
b. Repressor proteins
c. DNA methylation
d. Alteration of chromatin structure
*e. All of the above
150. Histone acetyltransferase and ATP-dependent
chromatin remodeling enzymes convert the
chromatin from the closed conformation to the open
conformation. What effect does this have on
transcription?
a. Splicing is increased
b. Transcription is shut down
c. RNA elongation is repressed
d. Small effector proteins are excluded from the
genes
*e. RNA polymerase is able to bind and initiate
transcription of the gene
151. In eukaryotic genes, exons are in the _________
regions of a gene and are ________.
a. coding, spliced out
b. noncoding, spliced out
*c. coding, not spliced out
d. nocoding, not spliced out
152. In eukaryotic genes, introns are in the
_________ regions of a gene and are ________.
a. coding, spliced out
*b. noncoding, spliced out
c. coding, not spliced out
celd. nocoding, not spliced out
153. Mature mRNAs have 100-200 adenine
nucleotides added to 3’-end. Which is true for the
poly A tails:
*a. It increases stability and life span of mRNA.
b. It is encoded by gene sequence.
c. It ensures proper exit of mRNA.
d. It binds to ribosome.
154. The diagram above shows the threedimensional structure of a tRNA.
What can be said about tRNAs?
a. An amino acid is linked to the 3’-end by an
aminoacyl-tRNA synthetase.
b. There is a different aminoacyl-tRNA synthetase for
every amino acid.
c. The GGC sequence is the anticodon recognizes and
base pairs with codons in the mRNA.
*d. All of the above.
e. None of the above
155. Table 12.1 is a table of codons from your
textbook.
Using the table above, translate the following mRNA
sequence from the start codon to the stop codon
(you need to find the translation start codon first):
5’-UGCCAUGGCACCUGACUAG-3’
Choose the correct amino acid sequence.
a. Leu-Val-Arg-Cys-His-Gly
b. Cys-His-Gly-Thr
c. Pro-Trp-His-Leu_Thr
*d. Met-Ala-Pro-Asp
156. Table 12.1 is a table of codons from your
textbook.
Using the table above, translate the following mRNA
sequence from the start codon to the stop codon
(you need to find the translation start codon first):
5’-CCAUGGACGAACGCUGACG-3’
Choose the correct amino acid sequence.
a. Pro-Trp-Thr-Asn-Ala-Asp
*b. Met-Asp-Glu-Arg
c. Arg-Gln-Arg-Ser-Ser-Met
d. His-Gly-Arg-Thr-Leu-Thr
157. During polypeptide chain elongation on
ribosomes
a. a tRNA at the P site transfers the growing
polypeptide chain to the tRNA at the A site, and
tRNA at the P site is moved to the E site.
b. a charged tRNA bearing a single amino acid binds
to the A site.
c. and after the peptyl transfer reaction is complete,
the ribosome moves ahead one codon toward the 3’
end of the mRNA.
*d. All of the above
158. In bacterium growth media with both lactose
and glucose, which sugar bacteria will use first:
a. lactose
*b. glucose
c. lactose and glucose at the same time
d. none of the above
159. In the media in which the bacteria, E. coli, is
growing, the presence of lactose ……… (finish the
sentence)
a. activates the CAP activator by increasing cAMP
level.
b. activates the CAP activator by decreasing cAMP
level.
c. increases the binding of lac repressor to the
operator of the lac operon.
*d. reduces the binding of lac repressor to the
operator of the lac operon
160. In the media in which the bacteria, E. coli, is
growing, the absence of glucose……… (finish the
sentence)
*a. activates the CAP activator by increasing cAMP
level.
b. activates the CAP activator by decreasing cAMP
level.
c. increases the binding of lac repressor to the
operator of the lac operon.
d. reduces the binding of lac repressor to the
operator of the lac operon
161. If you make a mutation in the lac repressor
gene (lac I), what will happen:
a. the lac operon will not be expressed
*b. the lac operon will be expressed constitutively.
c. the lac operon will be expressed only in the
presence of lactose
d. All of the above
162. If you make a mutation in the lac Operator (Lac
O), what will happen:
a. the lac operon will not be expressed
*b. the lac operon will be expressed constitutively.
c. the lac operon will be expressed only in the
presence of lactose
d. All of the above
163. The promoters of eukaryotic genes include:
a. TATA box
b. transcription start site
c. Regulatory region
*d. All of the above
164. The promoter regulatory elements to which
activators, a class of transcription factors, bind are
called:
a. Mediators
b. Accelerators
*c. Enhancers
d. Augmentors
e. None of the above
165. The initiation of transcription in eukaryotes
involves:
*a. assembly of preinitiation complex that includes
GTFs (General Transcription Factors) and RNA
polymerase II.
b. assembly preinitiation complex that includes GTFs
only.
c. assembling preinitiation complex that include RNA
polymerase II only.
d. None of the above.
166. What are the functions of GTFs (General
Transcription Factors):
a. bind to core promoter.
b. recruit RNA polymerase.
c. Melt double strand DNA at the transcriptional
start site to initiate transcription
*d. All of above
167. Transcription activators:
*a. Binds DNA elements in enhancer to activate
transcription.
b. Mediates interaction between transcription
activators and GTFs.
c. producing the 5’ cap during mRNA processing.
d. splicing out non-coding introns.
168. Coactivator or mediator:
a. Binds DNA elements in enhancer to activator
transcription.
*b. Mediates interactions between transcription
activators and GTFs
c. producing the 5’ cap during mRNA processing.
d. splicing out non-coding introns.
173. When an effector molecule binds to a
transcription repressor protein, the repressor
protein changes shape and is no longer able to bind
to DNA. What would happen to the rate of
transcription if the concentration of the effector
molecules was reduced?
169. How can transcription “activator” change
chromatin compaction?
a. by recruiting histone acetyl transferase.
b. by recruiting chromatin remodeling proteins.
*c. by recruiting both histone acetyl transferase and
chromatin remodeling proteins.
d. None of the above
170. Which is NOT ture about MicroRNA:
a. MicroRNA is generated from double stranded RNA
by dicer.
*b. MicroRNA is usually 30-50 nucleotides in length.
c. MicroRNA acts to degrade target mRNA by
bringing RISC complex to the target.
d. MicroRNAs can inhibit translation.
171. Let us assume that the transition of an insect
from the larval stage of development to a pupa is
controlled by the expression of a microRNA.
Knowing the general function of microRNAs, what
might be the possible role of the microRNA in this
developmental process?
a. Targeting the promoter of a gene required for this
developmental process.
b. Promoting the assembly of ribosomes needed for
this developmental process.
c. Enhancing the production of mRNAs required for
this developmental process.
*d. Degrading a messenger RNA encoding a protein
that might interfere with this developmental
process.
172. What the advantage for genes that are
regulated at translation initiation step?
a. For these genes, they don’t need to transcribe the
genes to make mRNAs.
b. The mRNAs of these genes form secondary
structure so the mRNA is more stable.
*c. For these genes, the regulation of protein
accumulation happens faster than the
genes regulated at transcription level.
d. None of the above.
a. Increase
*b. Decrease
c. Remain the same
174. You’ve isolated a strain of E. coli which
expresses the lac operon even in the absence of
lactose. Which of the following events could explain
this phenotype?
a. A. A mutation in the lacI gene which renders the
lac repressor unable to bind DNA.
b. B. A mutation in the lacI gene which prevents the
lac repressor from binding allolactose.
c. C. A mutation in the lac operator which prevents
binding by lac repressor.
*d. Both A and C
e. None of the above.
175. Complete the following: In regulation of the lac
operon, the lac repressor protein .....
a. Activates lac transcription when it is bound to
allolactose.
*b. Represses lac transcription when it is not bound
to allolactose.
c. Binds cAMP and activates transcription.
d. Binds cAMP and represses lac transcription.
176. Complete the following: In regulation of the lac
operon, the Catabolite Activator Protein (CAP) .....
a. Binds allolactose and activates lac transcription
b. Binds allolactose and represses lac transcription
*c. Binds cAMP and activates transcription.
d. Binds cAMP and represses lac transcription.
177. Unlike in prokaryotes, in eukaryotes RNA
transcripts are often processed in the following
ways:
a. Addition of a 5’ cap (a modified G residue).
b. Addition of a 3’ polyA tail
c. Splicing of exons
*d. All of the above.
182. Cell communication ________.
a. requires cytoplasmic connections.
b. only occurs over short distances.
c. controls mitotaxis.
d. involves the exchange of genes.
*e. coordinates developmental processes in
multicellular organisms.
178. How is gene regulation by steroid hormones
similar to induction of the E. coli lac operon by
lactose?
a. A. In both cases a transcription factor is imported
into the nucleus.
b. B. Both cases involve binding of a small effector
molecule to a transcription factor.
c. C. Both involve binding of a transcription factor
near the gene promoter.
*d. B and C only.
e. All of the above.
183. Your textbook defines three categories of cell
surface receptors that respond to extracellular
signals. They are:
a. Ligand-gated ion channels, steroid receptors, Gprotein coupled receptors
*b. Enzyme-linked receptors, G-protein coupled
receptors, ligand-gated ion channels
c. Steroid receptors, enzyme-linked receptors, Gprotein couple receptors
d. Ligand-gated channels, exocrine receptors, Gprotein couple receptors
e. Exocrine receptors, enzyme-linked receptors,
ligand-gated ion channels
179. In eukaryotes, some genes are regulated at the
post-transcriptional level by micro RNAs (miRNAs).
Which of the following about miRNAs is NOT true?
a. miRNAs are 21 – 22 nucleotides in length.
*b. each miRNA is linked to an amino acid by
aminoacyl miRNA synthetase.
c. miRNAs hybridize to their mRNA targets by
complementary base-pairing.
d. miRNAs can down-regulate their targets by either
inhibiting translation or causing the
mRNA to be degraded.
Cell Signaling
180. Receptors are ________.
*a. proteins that change conformation upon
interaction with a stimulus
b. genes that change expression in response to a
stimulus
c. phosphorylation cascades that control cellular
responses
d. specialized organelles that perceive
environmental signals
e. all of the above
181. The process by which information from a cell’s
environment is perceived and relayed to control a
cellular response is known as
*a. signal transduction
b. chemotaxis
c. meiosis
d. translation
e. impulsive respondus
184. What is the likely mechanism by which a Gprotein coupled receptor might transduce and
amplify a signal intracellularly?
a. By upregulating the expression of a transporter.
*b. By promoting the production of a second
messenger.
c. By degrading a repressor.
185. What is the likely mechanism by which an
enzyme-linked receptor might transduce and amplify
a signal intracellularly?
*a. By activating a protein kinase cascade.
b. By degrading a repressor.
c. By upregulating the expression of a transporter.
186. What benefits do hormone signaling provide for
a multicellular organism?
a. Long distance cellular communication.
b. Amplification of weak signals.
c. Coordination of bodily functions
d. Protection from pathogen attack.
e. None of the above
*f. All of the above
187. From the graph above showing the amount of
ligand bound to the receptor at different ligand
concentrations, what do you estimate to be the Kd
for ligand/receptor interaction as shown?
a. About 1 pM
*b. About 5 pM
c. About 15 pM
d. About 30 pM
e. About 60 pM
188. If you did another experiment with the same
ligand, only this time you add a fixed amount of a
weak competitive inhibitor of the ligand along with
the ligand, which of the following would be true?
Note: You are still measuring the amount of ligand
bound while increasing the ligand concentration.
a. The Kd will decrease.
b. The maximum binding will decrease.
*c. The Kd will increase.
189. With reference to the above diagram from your
textbook. The G-protein is activated ….finish the
sentence
a. when theβ/γ dimer associates with the α subunit.
b. when ATP concentrations are high enough to
activate adenylyl cyclase.
*c. by the dissociation of the β/γ dimer from the α
subunit.
d. by the exchange of ATP for GTP.
e. All of the above
f. None of the above
190. With reference to the above diagram from your
textbook. Epinephrine acts …. (finish the sentence)
a. bythe GPCR transducing the signal across the
plasma membrane.
b. by promoting the dissociation of the G-protein β/γ
dimer from the α subunit.
c. by producing a second messenger (cyclic
adenosine monophosphate).
*d. All of the above.
e. None of the above.
191. In response to unidirectional light …….. (finish
the sentence)
a. a plant seedling will bend away from the light.
b. the hormone auxin will accumulate on the side
facing the light.
*c. the side facing the light will grow more slowly
than the side away from the light.
d. the hormone auxin will slow growth on the side of
the seedling to which the hormone accumulates.
e. All of the above.
192. Indoleacetic acid (IAAH) is an example of an
auxin, a plant hormone. Its chemical structure is
depicted in the figure above. Many plant cells also
express an auxin influx carrier protein (pink in the
figure). Why is this carrier protein expressed?
a. IAAH cannot cross the membrane without a
carrier protein.
*b. Depending upon the pH, IAAH may not be able to
cross the membrane.
c. The carrier protein transports the auxin across the
plant cell wall.
d. All of the above.
193. The localized expression patterns of auxin efflux
carrier proteins influence the direction of auxin
transport. These expression patterns are dynamic
and change in response to environmental signals.
Would the PIN protein expression pattern in cell A or
cell B represent the condition when auxin transport
towards the roots needs to be increased?
*a. Cell A
b. Cell B
194. The figure above illustrates the activation and
inactivation of a G protein-coupled receptor. If a
nonhydrolyzable form of GTP, a form that does not
loose the terminal phosphate group to form GDP,
was added to cells, which of the following would be
true?
a. The ligand would not bind to the receptor.
b. The αβγ subunits of the G protein would not
dissociate.
*c. Once activated, signaling through the receptor
would continue for a longer time than normal.
d. None of the above
e. All of the above
195. The figure above illustrates signaling through
the EGF receptor. Which of the following would
represent a gain-of-function situation for the EGF
receptor?
a. A mutation in the EGF receptor that binds ligand,
but does not allow the receptor to dimerize.
b. Deletion of the gene encoding Erk
c. Increased cell division due to the inactivation of a
tumor suppressor
*d. Deletion of the ligand binding domain of the EGF
receptor so that it becomes ligand independent
e. None of the above
f. All of the above
196. The figure above illustrates signaling through
the EGF receptor. Which of the following would
represent a loss-of-function situation for the EGF
receptor?
a. A constitutively active from of the Ras protein.
b. Deletion of the ligand binding domain of the EGF
receptor so that it becomes ligand independent
*c. A mutation of the EGF receptor so that it can no
longer be phosphorylated.
d. All of the above
e. None of the above.
197. You want to test the hypothesis that EGF
receptor activation is sufficient for stimulate cell
division in cultured epithelial cells. Which of the
following would potentially test your hypothesis?
a. A. Forcing expression of the Her2 protein in the
cultured cells. The Her2 form of the EGF receptor is
constitutively active.
b. B. Add epidermal growth factor to the cell culture
medium.
c. C. Add GDP to the cell culture medium
d. All of the above
*e. A and B above
198. You want to test the hypothesis that Ca2+
release is necessary to form activated calmodulin.
Which of the following is the best test your
hypothesis?
a. Add a Ca2+ionophore to the cell culture medium.
Ca2+ionophores form Ca2+ permeable channels in
cell membranes.
b. Inhibit the activity of G protein-coupled receptors
*c. Deplete the cells of Ca2+ and then activate
phospholipase C leading to IP3 release.
199. Which is NOT a hormone found in
animals:
a. Amine
b. peptide
*c. auxin
d. steroid
200. Which is true about hypothalamus and
pituitary:
a. Hypothalamus makes neurohormones
b. The nurohormones travel to anterior pituitary
c. Anterior pituitary can synthesize different
hormones to regulate various processes
*d. All of the above
201. If Iodine (I) is missing in the diet, what will
happen to the thyroid gland:
*a. increase in size
b. decrease in size
c. remain the same
d. none of the above
202. In pancreas, two hormones, Insulin and
Glucagon, function antagonistically to regulate blood
glucose level. Insulin functions to:
a. Increase blood glucose level
*b. Decrease blood glucose level
c. Does not change blood glucose level
d)None of the above
203. In pancreas, two hormones, Insulin and
Glucagon, function antagonistically to regulate blood
glucose level. Glucagon functions to:
*a. Increase blood glucose level
b. Decrease blood glucose level
c. Does not change blood glucose level
d. None of the above